miRTarBase - #MIRT512063


—
pre-miRNA Information
pre-miRNA hsa-mir-6131   
Genomic Coordinates chr5: 10478037 - 10478145
Description Homo sapiens miR-6131 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-6131
Sequence 71| GGCUGGUCAGAUGGGAGUG |89
Evidence Experimental
Experiments Illumina
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 11 5 + 10478117 29233923 MiREDiBase
A-to-I 16 5 + 10478122 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs957913380 1 dbSNP
rs996083508 3 dbSNP
rs1304832380 16 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol DEK   
Synonyms D6S231E
Description DEK proto-oncogene
Transcript NM_001134709   
Other Transcripts NM_003472   
Expression
Putative miRNA Targets on DEK
3'UTR of DEK
(miRNA target sites are highlighted)		 
>DEK|NM_001134709|3'UTR
   1 GATAGAGGACAGAGAAGATGACTCGTTCCCATAGATTTGAAGATCTGATTTATACCATTATACCAGCAAAGAGAATGTAT
  81 TTCCTTTTCTAAATCCTTGTTAAGCAACGTTAGTAGAACTTACTGCTGACCTTTTTATCTTGAGTGTTATGTGAATTTGA
 161 GTTTGCTGTTTTAAATTGCATTTCTATGCCATTTTTAGTTTAAAATCTTGCATGGCATTAATTGTTCCTTGCTTTTATAG
 241 TTGTATTTTGTACATTTTGGATTTCTTTATATAAGGTCATAGATTCTTGAGCTGTTGTGGTTTTTAGTGCACTTAATATT
 321 AGCTTGCTTAAGGCATACTTTTAATCAAGTAGAACAAAAACTATTATCACCAGGATTTATACATACAGAGATTGTAGTAT
 401 TTAGTATATGAAATATTTTGAATACACATCTCTGTCAGTGTGAAAATTCAGCGGCAGTGTGTCCATCATATTAAAAATAT
 481 ACAAGCTACAGTTGTCCAGATCACTGAATTGGAACTTTTCTCCTGCATGTGTATATATGTCAAATTGTCAGCATGACAAA
 561 AGTGACAGATGTTATTTTTGTATTTTTAAAAAACAATTGGTTGTATATAAAGTTTTTTTATTTCTTTTGTGCAGATCACT
 641 TTTTAAACTCACATAGGTAGGTATCTTTATAGTTGTAGACTATGGAATGTCAGTGTTCAGCCAAACAGTATGATGGAACA
 721 GTGAAAGTCAATTCAGTGATGGCAACACTGAAGGAACAGTTACCCTGCTTTGCCTCGAAAGTGTCATCAATTTGTAATTT
 801 TAGTATTAACTCTGTAAAAGTGTCTGTAGGTACGTTTTATATTATATAAGGACAGACCAAAAATCAACCTATCAAAGCTT
 881 CAAAAACTTTGGGAAAGGGTGGGATTAAGTACAAGCACATTTGGCTTACAGTAAATGAACTGATTTTTATTAACTGCTTT
 961 TGCCCATATAAAATGCTGATATTTACTGGAAACCTAGCCAGCTTCACGATTATGACTAAAGTACCAGATTATAATGCCAG
1041 AATATAATGTGCAGGCAATCGTGGATGTCTCTGACAAAGTGTGTCTCAAAAATAATATACTTTTACATTAAAGAAATTTA
1121 ATGTTTCTCTGGAGTTGGGGCTCTTGGCTTTCAGAGTTTGGTTAATCAGTGTTGATTCTAGATGATCAACATAATGGACC
1201 ACTCCTGAATGAGACTTAATTTTGTCTTTCAAATTTACTGTCTTAAATCAGTTTATTAAATCTGAATTTTAAAACATGCT
1281 GTTTATGACACAATGACACATTTGTTGCACCAATTAAGTGTTGAAAAATATCTTTGCATCATAGAACAGAAATATATAAA
1361 AATATATGTTGAATGTTAACAGGTATTTTCACAGGTTTGTTTCTTGATAGTTACTCAGACACTAGGGAAAGGTAAATACA
1441 AGTGAACAAAATAAGCAACTAAATGAGACCTAATAATTGGCCTTCGATTTTAAATATTTGTTCTTATAAACCTTGTCAAT
1521 AAAAATAAATCTAAATCACTGGTGTTTTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gugAGGGUAGACUGGUCGg 5'
             | ||||:  |||||| 
Target 5' ttaTACCATTATACCAGCa 3'
 50 - 68 128.00 -14.40
2 
miRNA  3' guGAGGGUAGACUGGUCgg 5'
            || ::|||  |||||  
Target 5' aaCTATTATC--ACCAGga 3'
 359 - 375 108.00 -11.00
3 
miRNA  3' gugAGGGUAGACUGGUCGg 5'
             |:|:|  |||:|| | 
Target 5' tgaTTCTAGATGATCAACa 3'
 1173 - 1191 108.00 -10.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30633241 49 COSMIC
COSN30144389 61 COSMIC
COSN30190346 71 COSMIC
COSN31519571 73 COSMIC
COSN31603894 109 COSMIC
COSN30501692 114 COSMIC
COSN2557971 116 COSMIC
COSN31479879 128 COSMIC
COSN31502214 129 COSMIC
COSN30470136 131 COSMIC
COSN30135645 147 COSMIC
COSN30521365 159 COSMIC
COSN31581798 223 COSMIC
COSN31577678 233 COSMIC
COSN16273946 239 COSMIC
COSN22003357 276 COSMIC
COSN20075739 321 COSMIC
COSN25398250 487 COSMIC
COSN1329427 757 COSMIC
COSN26879665 1226 COSMIC
COSN21693642 1650 COSMIC
rs3476 777 GWAS
rs5029614 777 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1457159218 1 dbSNP
rs569862193 3 dbSNP
rs756105522 3 dbSNP
rs117541327 4 dbSNP
rs1373955131 5 dbSNP
rs767276591 5 dbSNP
rs779526332 7 dbSNP
rs1211026537 9 dbSNP
rs761525670 16 dbSNP
rs768857901 16 dbSNP
rs532282018 19 dbSNP
rs751175790 19 dbSNP
rs111981497 21 dbSNP
rs763685943 24 dbSNP
rs372245813 25 dbSNP
rs1382018217 28 dbSNP
rs780078216 39 dbSNP
rs769355298 42 dbSNP
rs1184287760 45 dbSNP
rs1397856114 47 dbSNP
rs1035347736 48 dbSNP
rs1422266909 54 dbSNP
rs981112274 55 dbSNP
rs776805647 58 dbSNP
rs975388687 61 dbSNP
rs770312836 69 dbSNP
rs777915374 71 dbSNP
rs1398037772 73 dbSNP
rs964302591 76 dbSNP
rs970930974 77 dbSNP
rs1019262524 80 dbSNP
rs1400931339 82 dbSNP
rs746306851 93 dbSNP
rs1393901425 95 dbSNP
rs1250146781 108 dbSNP
rs1247028772 109 dbSNP
rs1023913391 110 dbSNP
rs548358737 113 dbSNP
rs1314564589 117 dbSNP
rs986400672 123 dbSNP
rs1012803680 130 dbSNP
rs1255464475 131 dbSNP
rs951153547 132 dbSNP
rs1482338628 137 dbSNP
rs1207075043 142 dbSNP
rs553658355 150 dbSNP
rs996087832 152 dbSNP
rs193062372 159 dbSNP
rs999610922 163 dbSNP
rs377117157 167 dbSNP
rs1176758947 170 dbSNP
rs1024223018 181 dbSNP
rs143246702 183 dbSNP
rs149154358 185 dbSNP
rs900403847 186 dbSNP
rs570099618 192 dbSNP
rs1399081733 200 dbSNP
rs551591861 202 dbSNP
rs1296721464 210 dbSNP
rs533311324 211 dbSNP
rs1442438292 216 dbSNP
rs1301219740 223 dbSNP
rs752578073 224 dbSNP
rs902601612 226 dbSNP
rs1241283591 231 dbSNP
rs1286918782 232 dbSNP
rs559367950 233 dbSNP
rs1488081142 235 dbSNP
rs1179594704 239 dbSNP
rs1260727514 250 dbSNP
rs1437641779 250 dbSNP
rs1248949376 259 dbSNP
rs909043889 262 dbSNP
rs1048057202 263 dbSNP
rs559627709 265 dbSNP
rs760759627 268 dbSNP
rs1160646730 269 dbSNP
rs1291220206 269 dbSNP
rs1380439968 270 dbSNP
rs1156497075 273 dbSNP
rs1244019797 273 dbSNP
rs928373515 276 dbSNP
rs547277103 289 dbSNP
rs1437653299 299 dbSNP
rs138323242 310 dbSNP
rs547500031 314 dbSNP
rs946782336 319 dbSNP
rs1393711951 326 dbSNP
rs1310055386 327 dbSNP
rs565071968 330 dbSNP
rs561522426 333 dbSNP
rs1039924880 335 dbSNP
rs915592834 338 dbSNP
rs991067388 343 dbSNP
rs1222035263 350 dbSNP
rs1334954267 355 dbSNP
rs543573591 363 dbSNP
rs1238215918 365 dbSNP
rs550048039 365 dbSNP
rs1388513064 372 dbSNP
rs958568904 374 dbSNP
rs576175433 377 dbSNP
rs942634844 382 dbSNP
rs369000597 384 dbSNP
rs1164506086 386 dbSNP
rs966725837 386 dbSNP
rs1348557803 388 dbSNP
rs531238572 388 dbSNP
rs986433257 388 dbSNP
rs1332666443 392 dbSNP
rs997444198 393 dbSNP
rs900497116 401 dbSNP
rs1455274010 403 dbSNP
rs1469893629 403 dbSNP
rs545586055 404 dbSNP
rs1039484663 406 dbSNP
rs1231586507 406 dbSNP
rs1380156437 423 dbSNP
rs951019038 426 dbSNP
rs1201644377 434 dbSNP
rs918246976 434 dbSNP
rs1288853182 443 dbSNP
rs1319744047 448 dbSNP
rs1200408852 450 dbSNP
rs973890157 452 dbSNP
rs962760021 453 dbSNP
rs1196206420 454 dbSNP
rs115538236 457 dbSNP
rs1489330699 461 dbSNP
rs41267734 467 dbSNP
rs78888154 471 dbSNP
rs1349676556 476 dbSNP
rs188856111 478 dbSNP
rs999532751 480 dbSNP
rs1235295669 482 dbSNP
rs1400220122 484 dbSNP
rs902549164 487 dbSNP
rs948477263 490 dbSNP
rs915574489 497 dbSNP
rs1302502126 502 dbSNP
rs990254077 505 dbSNP
rs564868665 512 dbSNP
rs1318550037 516 dbSNP
rs1282671755 521 dbSNP
rs1011013872 528 dbSNP
rs113257617 534 dbSNP
rs900570754 535 dbSNP
rs1220247405 541 dbSNP
rs1278684537 543 dbSNP
rs1317213818 545 dbSNP
rs1196728606 547 dbSNP
rs1039557152 553 dbSNP
rs1399823705 559 dbSNP
rs752572511 561 dbSNP
rs1208929665 562 dbSNP
rs1235397855 562 dbSNP
rs1489438569 564 dbSNP
rs1406203747 570 dbSNP
rs1174731813 576 dbSNP
rs1194842122 580 dbSNP
rs1480983633 586 dbSNP
rs942498695 587 dbSNP
rs912487758 588 dbSNP
rs1174871023 596 dbSNP
rs1425911661 597 dbSNP
rs1413995992 602 dbSNP
rs1332365795 607 dbSNP
rs1362694588 609 dbSNP
rs1400904839 612 dbSNP
rs779704922 614 dbSNP
rs1216683198 620 dbSNP
rs976135473 620 dbSNP
rs929893922 622 dbSNP
rs1478811296 624 dbSNP
rs537610209 629 dbSNP
rs965191037 644 dbSNP
rs1215290240 645 dbSNP
rs1445543830 648 dbSNP
rs543065627 652 dbSNP
rs1355386393 657 dbSNP
rs570157073 661 dbSNP
rs887679991 663 dbSNP
rs1487530139 665 dbSNP
rs1201579273 673 dbSNP
rs778803288 682 dbSNP
rs1282490690 683 dbSNP
rs962506878 686 dbSNP
rs1341833384 687 dbSNP
rs916289847 689 dbSNP
rs990986357 694 dbSNP
rs907019211 695 dbSNP
rs960830005 702 dbSNP
rs948441260 704 dbSNP
rs1343027503 705 dbSNP
rs1035178444 707 dbSNP
rs1335815629 708 dbSNP
rs1470469663 716 dbSNP
rs999818009 718 dbSNP
rs966933189 720 dbSNP
rs1174889817 722 dbSNP
rs1272546989 734 dbSNP
rs559637735 735 dbSNP
rs532151806 740 dbSNP
rs145741832 743 dbSNP
rs925528317 748 dbSNP
rs183912065 749 dbSNP
rs900588056 753 dbSNP
rs945655720 756 dbSNP
rs140992236 757 dbSNP
rs1474485554 764 dbSNP
rs745306181 766 dbSNP
rs529269580 769 dbSNP
rs780584477 772 dbSNP
rs976230161 776 dbSNP
rs3476 777 dbSNP
rs1378704280 779 dbSNP
rs1018124759 790 dbSNP
rs890999876 803 dbSNP
rs1391246098 808 dbSNP
rs1050868004 811 dbSNP
rs984780624 812 dbSNP
rs1461590824 816 dbSNP
rs1262343899 817 dbSNP
rs929926427 824 dbSNP
rs1319983876 826 dbSNP
rs1026343837 830 dbSNP
rs146494116 833 dbSNP
rs1213440372 834 dbSNP
rs993414335 835 dbSNP
rs1208529540 838 dbSNP
rs1260568721 844 dbSNP
rs907150353 846 dbSNP
rs1024107960 847 dbSNP
rs1198085126 848 dbSNP
rs1236495990 849 dbSNP
rs1425761480 849 dbSNP
rs1188553661 850 dbSNP
rs1368787079 851 dbSNP
rs542914199 852 dbSNP
rs1359261222 875 dbSNP
rs1162632183 878 dbSNP
rs1285532041 892 dbSNP
rs1038055946 897 dbSNP
rs1466134097 898 dbSNP
rs1013166489 899 dbSNP
rs764061142 901 dbSNP
rs1393752255 905 dbSNP
rs1397379271 913 dbSNP
rs940982040 916 dbSNP
rs563640642 918 dbSNP
rs1382492867 924 dbSNP
rs1280566397 925 dbSNP
rs990601662 930 dbSNP
rs939079594 937 dbSNP
rs149949880 946 dbSNP
rs752512964 954 dbSNP
rs1355582707 961 dbSNP
rs978242814 969 dbSNP
rs966999546 975 dbSNP
rs1185520311 979 dbSNP
rs1425575695 982 dbSNP
rs1478092886 986 dbSNP
rs1022929691 988 dbSNP
rs989505412 990 dbSNP
rs1370796601 994 dbSNP
rs1164444546 999 dbSNP
rs965108712 1000 dbSNP
rs1412607201 1005 dbSNP
rs1017558015 1007 dbSNP
rs1341568067 1015 dbSNP
rs1181475448 1018 dbSNP
rs529223116 1020 dbSNP
rs1008962108 1024 dbSNP
rs766585662 1028 dbSNP
rs1234061467 1034 dbSNP
rs890529585 1038 dbSNP
rs754680402 1045 dbSNP
rs1029466226 1046 dbSNP
rs1255549297 1048 dbSNP
rs1233318920 1051 dbSNP
rs902829200 1054 dbSNP
rs1219131128 1055 dbSNP
rs993940188 1058 dbSNP
rs1041399583 1060 dbSNP
rs1192782590 1061 dbSNP
rs945598690 1082 dbSNP
rs1434905220 1083 dbSNP
rs1176139927 1085 dbSNP
rs374662564 1093 dbSNP
rs897070439 1095 dbSNP
rs1376625278 1097 dbSNP
rs1432447265 1097 dbSNP
rs1038658494 1098 dbSNP
rs923528869 1100 dbSNP
rs1361515748 1103 dbSNP
rs1203751091 1106 dbSNP
rs760811824 1107 dbSNP
rs1419494100 1110 dbSNP
rs1287563160 1117 dbSNP
rs941278080 1118 dbSNP
rs112325094 1123 dbSNP
rs1305245203 1129 dbSNP
rs943548203 1134 dbSNP
rs1368920745 1136 dbSNP
rs1291489708 1137 dbSNP
rs545875456 1139 dbSNP
rs1287029541 1140 dbSNP
rs1354067345 1148 dbSNP
rs140400691 1151 dbSNP
rs1054776316 1152 dbSNP
rs1191743043 1157 dbSNP
rs910751189 1157 dbSNP
rs985265021 1159 dbSNP
rs952205233 1160 dbSNP
rs1180057872 1164 dbSNP
rs1380529589 1167 dbSNP
rs1312502132 1169 dbSNP
rs939110843 1171 dbSNP
rs1157357227 1174 dbSNP
rs773541899 1176 dbSNP
rs927669611 1178 dbSNP
rs1374520437 1182 dbSNP
rs542161056 1184 dbSNP
rs575609291 1184 dbSNP
rs945503001 1188 dbSNP
rs1440731703 1194 dbSNP
rs1449097181 1205 dbSNP
rs868740330 1206 dbSNP
rs1351656042 1220 dbSNP
rs915405725 1224 dbSNP
rs1222335634 1226 dbSNP
rs1024245263 1229 dbSNP
rs111415771 1232 dbSNP
rs1222150019 1237 dbSNP
rs1272484169 1239 dbSNP
rs1466695699 1244 dbSNP
rs541819408 1244 dbSNP
rs1424126998 1249 dbSNP
rs1238318257 1250 dbSNP
rs964973766 1255 dbSNP
rs752044843 1257 dbSNP
rs1175158850 1259 dbSNP
rs1160691994 1261 dbSNP
rs1420598441 1270 dbSNP
rs190812256 1280 dbSNP
rs555978595 1284 dbSNP
rs1416330340 1287 dbSNP
rs1332103918 1291 dbSNP
rs142061982 1293 dbSNP
rs1000349909 1295 dbSNP
rs902948891 1295 dbSNP
rs576569045 1297 dbSNP
rs902075859 1300 dbSNP
rs866326402 1309 dbSNP
rs1220448926 1312 dbSNP
rs1270988108 1313 dbSNP
rs1436752788 1322 dbSNP
rs375611129 1325 dbSNP
rs943659266 1328 dbSNP
rs1490043990 1330 dbSNP
rs1483412124 1336 dbSNP
rs762022774 1339 dbSNP
rs1416208607 1355 dbSNP
rs910710791 1355 dbSNP
rs553180623 1365 dbSNP
rs1418836733 1368 dbSNP
rs1408287569 1378 dbSNP
rs1317891272 1382 dbSNP
rs1178416811 1384 dbSNP
rs1016766389 1390 dbSNP
rs919341347 1395 dbSNP
rs560926573 1403 dbSNP
rs1222544023 1406 dbSNP
rs1370299875 1407 dbSNP
rs1401721201 1410 dbSNP
rs1304314653 1411 dbSNP
rs1338103013 1414 dbSNP
rs972034179 1414 dbSNP
rs1280200382 1418 dbSNP
rs769306093 1438 dbSNP
rs1209766490 1439 dbSNP
rs1363810610 1447 dbSNP
rs1489490170 1459 dbSNP
rs1300267877 1460 dbSNP
rs1242046998 1470 dbSNP
rs535092234 1474 dbSNP
rs1192974950 1477 dbSNP
rs1426016737 1478 dbSNP
rs11200 1479 dbSNP
rs1054809110 1485 dbSNP
rs1373338385 1491 dbSNP
rs1421300837 1494 dbSNP
rs565807102 1497 dbSNP
rs1417110533 1498 dbSNP
rs958689001 1503 dbSNP
rs1367736163 1507 dbSNP
rs553861831 1511 dbSNP
rs535420565 1517 dbSNP
rs1042194932 1519 dbSNP
rs1000036179 1533 dbSNP
rs1200073084 1539 dbSNP
rs967078777 1541 dbSNP
rs1445750093 1544 dbSNP
rs945142972 1554 dbSNP
rs1247325412 1559 dbSNP
rs1453893103 1567 dbSNP
rs1191919813 1568 dbSNP
rs1020005711 1573 dbSNP
rs1440613259 1574 dbSNP
rs997921550 1580 dbSNP
rs1266232783 1592 dbSNP
rs3798298 1596 dbSNP
rs1039412620 1597 dbSNP
rs577284421 1607 dbSNP
rs1325476018 1615 dbSNP
rs1053943929 1616 dbSNP
rs1394505412 1634 dbSNP
rs769433769 1645 dbSNP
rs1300707147 1650 dbSNP
rs1378633529 1656 dbSNP
rs1259808786 1659 dbSNP
rs1279302727 1662 dbSNP
rs1349022739 1666 dbSNP
rs751613159 1668 dbSNP
rs1212102723 1669 dbSNP
rs1291233178 1675 dbSNP
rs1214042517 1677 dbSNP
rs745498064 1679 dbSNP
rs1468036254 1680 dbSNP
rs780967093 1681 dbSNP
rs879245582 1688 dbSNP
rs1008219517 1695 dbSNP
rs763193870 1701 dbSNP
rs954679479 1715 dbSNP
rs1284421636 1717 dbSNP
rs765322138 1719 dbSNP
rs1343717146 1720 dbSNP
rs558872035 1730 dbSNP
rs1468425508 1731 dbSNP
rs919253731 1732 dbSNP
rs1164861186 1733 dbSNP
rs930814674 1734 dbSNP
rs1460906816 1751 dbSNP
rs972599269 1755 dbSNP
rs866893495 1756 dbSNP
rs897882864 1758 dbSNP
rs963477793 1763 dbSNP
rs1017209301 1764 dbSNP
rs756731885 1766 dbSNP
rs1451281398 1767 dbSNP
rs959294454 1770 dbSNP
rs1334288853 1773 dbSNP
rs917251622 1784 dbSNP
rs746572196 1794 dbSNP
rs1334744668 1799 dbSNP
rs372332217 1800 dbSNP
rs906237554 1801 dbSNP
rs1260033152 1805 dbSNP
rs1318726534 1812 dbSNP
rs1195391200 1819 dbSNP
rs925911757 1820 dbSNP
rs1444417763 1822 dbSNP
rs531547978 1823 dbSNP
rs978973603 1823 dbSNP
rs1009759140 1824 dbSNP
rs1426560334 1826 dbSNP
rs1166889402 1833 dbSNP
rs1194637459 1837 dbSNP
rs1428628198 1839 dbSNP
rs1393871338 1840 dbSNP
rs1397468972 1841 dbSNP
rs893525292 1842 dbSNP
rs1054379254 1848 dbSNP
rs1413424485 1851 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control PAR-CLIP data was present in GSM545213. RNA binding protein: AGO2. Condition:Control PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 7913.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 7913.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000397239.3 | 3UTR | AUCUGAUUUAUACCAUUAUACCAGCAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545213
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / Control
Location of target site ENST00000397239.3 | 3UTR | AUUUAUACCAUUAUACCAGCAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000397239.3 | 3UTR | UGAUUUAUACCAUUAUACCAGCAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000397239.3 | 3UTR | UGAAGAUCUGAUUUAUACCAUUAUACCAGCAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000397239.3 | 3UTR | AUUUAUACCAUUAUACCAGCAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000397239.3 | 3UTR | AUUUAUACCAUUAUACCAGCAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM1065668
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_7
Location of target site ENST00000397239.3 | 3UTR | AUUUAUACCAUUAUACCAGCAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000397239.3 | 3UTR | GAUCUGAUUUAUACCAUUAUACCAGCAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
212 hsa-miR-6131 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT077630 IGF2BP1 insulin like growth factor 2 mRNA binding protein 1 2 6
MIRT177175 ARL5B ADP ribosylation factor like GTPase 5B 2 4
MIRT442431 CACNG8 calcium voltage-gated channel auxiliary subunit gamma 8 2 6
MIRT478684 CSRP2 cysteine and glycine rich protein 2 2 4
MIRT484891 ZNF607 zinc finger protein 607 2 2
MIRT487161 IFRD1 interferon related developmental regulator 1 2 10
MIRT488196 MAT1A methionine adenosyltransferase 1A 2 2
MIRT495470 ALDOA aldolase, fructose-bisphosphate A 2 2
MIRT497190 DUSP18 dual specificity phosphatase 18 2 2
MIRT498387 LRRC58 leucine rich repeat containing 58 2 2
MIRT499716 PAGR1 PAXIP1 associated glutamate rich protein 1 2 10
MIRT507261 FERMT2 fermitin family member 2 2 2
MIRT507290 FEM1B fem-1 homolog B 2 2
MIRT507537 DNAJB6 DnaJ heat shock protein family (Hsp40) member B6 2 6
MIRT508063 ARHGAP42 Rho GTPase activating protein 42 2 4
MIRT510064 C12orf49 chromosome 12 open reading frame 49 2 4
MIRT510825 SBNO1 strawberry notch homolog 1 2 4
MIRT511209 LNPEP leucyl and cystinyl aminopeptidase 2 4
MIRT511827 H2AFX H2A histone family member X 2 4
MIRT512063 DEK DEK proto-oncogene 2 6
MIRT513501 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 2 6
MIRT513634 TP53INP2 tumor protein p53 inducible nuclear protein 2 2 2
MIRT515274 NUCB1 nucleobindin 1 2 6
MIRT519380 FKBP14 FK506 binding protein 14 2 4
MIRT519521 ZNF8 zinc finger protein 8 2 2
MIRT520633 NPM3 nucleophosmin/nucleoplasmin 3 2 6
MIRT520952 SRSF10 serine and arginine rich splicing factor 10 2 2
MIRT522073 ORAI2 ORAI calcium release-activated calcium modulator 2 2 4
MIRT527844 RDH11 retinol dehydrogenase 11 (all-trans/9-cis/11-cis) 2 2
MIRT530067 VN1R1 vomeronasal 1 receptor 1 2 2
MIRT530226 ZMAT4 zinc finger matrin-type 4 2 2
MIRT530637 PPIC peptidylprolyl isomerase C 2 4
MIRT530677 CHRNB1 cholinergic receptor nicotinic beta 1 subunit 2 4
MIRT531681 MYO3A myosin IIIA 2 2
MIRT532175 SEC14L5 SEC14 like lipid binding 5 2 4
MIRT534235 SLC25A16 solute carrier family 25 member 16 2 4
MIRT535116 PLXNA2 plexin A2 2 2
MIRT535562 OMD osteomodulin 2 2
MIRT536483 KIAA1468 KIAA1468 2 2
MIRT538368 CRISPLD2 cysteine rich secretory protein LCCL domain containing 2 2 2
MIRT550667 TRAF1 TNF receptor associated factor 1 2 2
MIRT554736 RHOC ras homolog family member C 2 2
MIRT556522 LIN52 lin-52 DREAM MuvB core complex component 2 2
MIRT559269 BAG4 BCL2 associated athanogene 4 2 2
MIRT560957 FAM35A family with sequence similarity 35 member A 2 2
MIRT564728 ZNF268 zinc finger protein 268 2 2
MIRT573116 NUBP1 nucleotide binding protein 1 2 2
MIRT573891 MKI67 marker of proliferation Ki-67 2 2
MIRT576641 Mill2 MHC I like leukocyte 2 1 1
MIRT615883 FBXO17 F-box protein 17 2 2
MIRT618203 C22orf39 chromosome 22 open reading frame 39 2 2
MIRT620108 HARBI1 harbinger transposase derived 1 2 2
MIRT621185 FAM153B family with sequence similarity 153 member B 2 2
MIRT621573 ZBTB43 zinc finger and BTB domain containing 43 2 2
MIRT623753 GRID1 glutamate ionotropic receptor delta type subunit 1 2 2
MIRT624057 EIF4E eukaryotic translation initiation factor 4E 2 2
MIRT625013 TMIGD2 transmembrane and immunoglobulin domain containing 2 2 2
MIRT626071 CWF19L1 CWF19 like 1, cell cycle control (S. pombe) 2 2
MIRT627872 PAN2 PAN2 poly(A) specific ribonuclease subunit 2 2
MIRT629302 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT629862 GATAD1 GATA zinc finger domain containing 1 2 2
MIRT630442 IDE insulin degrading enzyme 2 2
MIRT630997 ZNF573 zinc finger protein 573 2 2
MIRT631091 UQCRB ubiquinol-cytochrome c reductase binding protein 2 2
MIRT631280 SGSM1 small G protein signaling modulator 1 2 2
MIRT631528 MYO6 myosin VI 2 2
MIRT631641 WDR91 WD repeat domain 91 2 4
MIRT631822 TMEM154 transmembrane protein 154 2 2
MIRT632776 LZIC leucine zipper and CTNNBIP1 domain containing 2 2
MIRT633277 FGFR1OP2 FGFR1 oncogene partner 2 2 2
MIRT633655 SLC28A1 solute carrier family 28 member 1 2 2
MIRT634070 PLIN3 perilipin 3 2 2
MIRT634155 YME1L1 YME1 like 1 ATPase 2 2
MIRT634224 TMEM132B transmembrane protein 132B 2 2
MIRT636400 MYO5A myosin VA 2 2
MIRT638677 GCLM glutamate-cysteine ligase modifier subunit 2 2
MIRT638736 FAXC failed axon connections homolog 2 2
MIRT640229 TOMM40 translocase of outer mitochondrial membrane 40 2 2
MIRT640302 PRR13 proline rich 13 2 2
MIRT641123 NPHP3 nephrocystin 3 2 2
MIRT643418 ERVMER34-1 endogenous retrovirus group MER34 member 1, envelope 2 2
MIRT644310 NFKBID NFKB inhibitor delta 2 2
MIRT644343 MPV17L MPV17 mitochondrial inner membrane protein like 2 2
MIRT645734 POLR3A RNA polymerase III subunit A 2 2
MIRT648055 TRMT10C tRNA methyltransferase 10C, mitochondrial RNase P subunit 2 2
MIRT649461 UBA5 ubiquitin like modifier activating enzyme 5 2 2
MIRT650006 KLB klotho beta 2 2
MIRT650565 YIPF4 Yip1 domain family member 4 2 2
MIRT652638 TIMM10 translocase of inner mitochondrial membrane 10 2 2
MIRT653886 SGK3 serum/glucocorticoid regulated kinase family member 3 2 2
MIRT655365 PCBD2 pterin-4 alpha-carbinolamine dehydratase 2 2 2
MIRT659113 DENND6A DENN domain containing 6A 2 2
MIRT659516 CHST3 carbohydrate sulfotransferase 3 2 2
MIRT659945 C8orf44-SGK3 C8orf44-SGK3 readthrough 2 2
MIRT661382 RHCG Rh family C glycoprotein 2 2
MIRT663106 NPR1 natriuretic peptide receptor 1 2 2
MIRT663756 ZNF285 zinc finger protein 285 2 2
MIRT664553 MKI67IP nucleolar protein interacting with the FHA domain of MKI67 1 1
MIRT666191 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 2 2
MIRT666793 PSMD1 proteasome 26S subunit, non-ATPase 1 2 2
MIRT668751 DDX19B DEAD-box helicase 19B 2 2
MIRT669600 AGO3 argonaute 3, RISC catalytic component 2 2
MIRT669703 AAK1 AP2 associated kinase 1 2 2
MIRT669922 LRPAP1 LDL receptor related protein associated protein 1 2 2
MIRT670002 GPR156 G protein-coupled receptor 156 2 4
MIRT670047 RPP14 ribonuclease P/MRP subunit p14 2 2
MIRT670296 RBBP4 RB binding protein 4, chromatin remodeling factor 2 2
MIRT670385 EMP2 epithelial membrane protein 2 2 2
MIRT670566 GLTP glycolipid transfer protein 2 2
MIRT671059 KIF1B kinesin family member 1B 2 2
MIRT671080 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 2
MIRT671303 RABGAP1L RAB GTPase activating protein 1 like 2 2
MIRT671803 WISP3 WNT1 inducible signaling pathway protein 3 2 2
MIRT671954 SPPL3 signal peptide peptidase like 3 2 2
MIRT671991 OSTF1 osteoclast stimulating factor 1 2 2
MIRT672090 WDR5B WD repeat domain 5B 2 2
MIRT672269 SHE Src homology 2 domain containing E 2 2
MIRT672445 TTPAL alpha tocopherol transfer protein like 2 2
MIRT672450 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 2 2
MIRT673649 CYCS cytochrome c, somatic 2 2
MIRT673998 KCNN3 potassium calcium-activated channel subfamily N member 3 2 2
MIRT674052 ATXN3 ataxin 3 2 2
MIRT674243 NUP62 nucleoporin 62 2 2
MIRT674433 MIOX myo-inositol oxygenase 2 4
MIRT674474 BCL2L15 BCL2 like 15 2 2
MIRT675467 NUBPL nucleotide binding protein like 2 2
MIRT675666 IVD isovaleryl-CoA dehydrogenase 2 2
MIRT675976 FAM126B family with sequence similarity 126 member B 2 2
MIRT676063 HSPE1-MOB4 HSPE1-MOB4 readthrough 2 2
MIRT676118 SCIMP SLP adaptor and CSK interacting membrane protein 2 2
MIRT676237 PARP2 poly(ADP-ribose) polymerase 2 2 2
MIRT676256 PBOV1 prostate and breast cancer overexpressed 1 2 2
MIRT676321 FBXL2 F-box and leucine rich repeat protein 2 2 2
MIRT676739 SGTB small glutamine rich tetratricopeptide repeat containing beta 2 2
MIRT676903 PHLDA3 pleckstrin homology like domain family A member 3 2 2
MIRT677112 SS18L1 SS18L1, nBAF chromatin remodeling complex subunit 2 2
MIRT677321 PIGO phosphatidylinositol glycan anchor biosynthesis class O 2 2
MIRT677460 PDLIM3 PDZ and LIM domain 3 2 2
MIRT677578 TRIM65 tripartite motif containing 65 2 2
MIRT677642 HAUS2 HAUS augmin like complex subunit 2 2 2
MIRT677735 MOB4 MOB family member 4, phocein 2 2
MIRT677828 TSPYL1 TSPY like 1 2 2
MIRT678078 EIF2A eukaryotic translation initiation factor 2A 2 2
MIRT678137 SEC24D SEC24 homolog D, COPII coat complex component 2 2
MIRT678157 ZNF724P zinc finger protein 724 2 2
MIRT678255 FXN frataxin 2 2
MIRT678321 FBLIM1 filamin binding LIM protein 1 2 2
MIRT678414 ANKRD36 ankyrin repeat domain 36 2 2
MIRT678596 ARPC2 actin related protein 2/3 complex subunit 2 2 2
MIRT678826 PDE6A phosphodiesterase 6A 2 2
MIRT678939 MYADM myeloid associated differentiation marker 2 2
MIRT679045 CHCHD5 coiled-coil-helix-coiled-coil-helix domain containing 5 2 2
MIRT679200 FLVCR1 feline leukemia virus subgroup C cellular receptor 1 2 2
MIRT679204 FAM9B family with sequence similarity 9 member B 2 2
MIRT679219 MAN2A2 mannosidase alpha class 2A member 2 2 2
MIRT679251 ZNF34 zinc finger protein 34 2 2
MIRT679315 NPHP1 nephrocystin 1 2 2
MIRT679484 CYTIP cytohesin 1 interacting protein 2 2
MIRT679550 LIPG lipase G, endothelial type 2 2
MIRT679624 TTC31 tetratricopeptide repeat domain 31 2 2
MIRT679646 MMAB methylmalonic aciduria (cobalamin deficiency) cblB type 2 2
MIRT679757 TLR6 toll like receptor 6 2 2
MIRT680123 ZNF576 zinc finger protein 576 2 2
MIRT680183 ZNF554 zinc finger protein 554 2 2
MIRT685770 ZNF426 zinc finger protein 426 2 2
MIRT687438 NR3C1 nuclear receptor subfamily 3 group C member 1 2 2
MIRT688384 ENAH ENAH, actin regulator 2 2
MIRT689668 RBM23 RNA binding motif protein 23 2 2
MIRT690030 CCDC90B coiled-coil domain containing 90B 2 2
MIRT691060 CRCP CGRP receptor component 2 2
MIRT691444 CXorf36 chromosome X open reading frame 36 2 2
MIRT691544 FLYWCH2 FLYWCH family member 2 2 2
MIRT691725 LARS leucyl-tRNA synthetase 2 2
MIRT692632 SUSD1 sushi domain containing 1 2 2
MIRT693822 BACE2 beta-site APP-cleaving enzyme 2 2 2
MIRT693861 IYD iodotyrosine deiodinase 2 2
MIRT693974 ZNF70 zinc finger protein 70 2 2
MIRT694143 CYP27C1 cytochrome P450 family 27 subfamily C member 1 2 2
MIRT695485 TRAT1 T-cell receptor associated transmembrane adaptor 1 2 2
MIRT695542 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 2 2
MIRT695598 TMEM199 transmembrane protein 199 2 2
MIRT696001 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 2
MIRT696017 TYRO3 TYRO3 protein tyrosine kinase 2 2
MIRT696309 NIP7 NIP7, nucleolar pre-rRNA processing protein 2 2
MIRT696397 CORO7 coronin 7 2 2
MIRT696594 ORMDL2 ORMDL sphingolipid biosynthesis regulator 2 2 2
MIRT698043 TRPM7 transient receptor potential cation channel subfamily M member 7 2 2
MIRT698136 TNRC6B trinucleotide repeat containing 6B 2 2
MIRT698287 TMEM2 transmembrane protein 2 2 2
MIRT702556 KBTBD6 kelch repeat and BTB domain containing 6 2 2
MIRT703017 HEATR5A HEAT repeat containing 5A 2 2
MIRT705116 C4orf29 abhydrolase domain containing 18 2 2
MIRT706301 NT5C2 5'-nucleotidase, cytosolic II 2 2
MIRT706609 CYB5B cytochrome b5 type B 2 2
MIRT706725 RFK riboflavin kinase 2 2
MIRT708651 LYRM7 LYR motif containing 7 2 2
MIRT710149 MTHFD1L methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1 like 2 2
MIRT710519 NDUFV3 NADH:ubiquinone oxidoreductase subunit V3 2 2
MIRT711263 CYB561A3 cytochrome b561 family member A3 2 2
MIRT711872 COX6B1 cytochrome c oxidase subunit 6B1 2 2
MIRT714282 KIF1C kinesin family member 1C 2 2
MIRT716605 MPPED1 metallophosphoesterase domain containing 1 2 2
MIRT720435 C19orf47 chromosome 19 open reading frame 47 2 2
MIRT720611 ZCCHC8 zinc finger CCHC-type containing 8 2 2
MIRT720615 PIANP PILR alpha associated neural protein 2 2
MIRT722155 ARHGAP40 Rho GTPase activating protein 40 2 2
MIRT722287 PMPCA peptidase, mitochondrial processing alpha subunit 2 2
MIRT722754 SIRPB2 signal regulatory protein beta 2 2 2
MIRT723294 MOGAT1 monoacylglycerol O-acyltransferase 1 2 2
MIRT723839 IL7R interleukin 7 receptor 2 2
MIRT724379 NEK8 NIMA related kinase 8 2 2
MIRT725335 NEUROD1 neuronal differentiation 1 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-6131 Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-6131 Temozolomide 5394 NSC362856 approved sensitive cell line (U251)
hsa-miR-6131 Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (mitochondrial RNA)
hsa-miR-6131 Tamoxifen 2733525 NSC180973 approved sensitive cell line (LCC2)
hsa-miR-6131 Osimertinib 71496458 NSC779217 approved resistant cell line (H1975)
hsa-miR-6131 Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-6131 Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)

Error report submission