pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4793 |
Genomic Coordinates | chr3: 48644194 - 48644280 |
Description | Homo sapiens miR-4793 stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | ||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4793-3p | |||||||||||||||
Sequence | 58| UCUGCACUGUGAGUUGGCUGGCU |80 | |||||||||||||||
Evidence | Experimental | |||||||||||||||
Experiments | Illumina | DRVs in miRNA |
|
|||||||||||||
SNPs in miRNA |
|
|||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | CD164 | ||||||||||||||||||||
Synonyms | DFNA66, MGC-24, MGC-24v, MUC-24, endolyn | ||||||||||||||||||||
Description | CD164 molecule | ||||||||||||||||||||
Transcript | NM_001142401 | ||||||||||||||||||||
Other Transcripts | NM_001142402 , NM_001142403 , NM_001142404 , NM_006016 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on CD164 | |||||||||||||||||||||
3'UTR of CD164 (miRNA target sites are highlighted) |
>CD164|NM_001142401|3'UTR 1 ACAGACCCATTGAATTAATAAGGACTGGTGATTCATTTGTGTAACTCACTGAAGCCAAAATACTATCTTTTAAGATGTCC 81 CACATGGAAGACGCTATTCCAGGATCTTTAAATTTCCATGGATGCATATAGGATGTTTGGGAGCATCATCCGTGAAGAAA 161 AAATCAATTAAATCATTGTGTTCAACAGGAATATTTAAAATATTCTGCATGAATCCTGTGGCTGTCTTATTTTAAATAGC 241 TGCTGCTGTGGGATTATATTTTTTTTCCTTAACATGCCAAATATAACTTTCTGAAAGTGATGGAAAATGTTGTCTTGTGC 321 AGACAACATCATGGCTCTTGGCAGTTTAAATTTAGTAATTTTAATTTAGTGAACAGAATTGAGAAGAACGTGCCAAATGA 401 GAATCAATTAGGTGGATTTTTGGCTGTCATTTCAAAAGTGGAATAAATTTATTAATTTAGTAGTACTAAATGGTATCCTT 481 AGATTAAAATTTTGTGCTTGATAACAGCTGTTTTTTCTACATTAGAAATAAGATGCCACACAAGGAACTACATTCCAGAT 561 TTAAAGAAATGAAAGGATACCATTAGTGTGTATAACAGATTATTGTTCATACTTGTAAAGCATCTTATGTCATTGAGAAT 641 ATAAAGAACAGTGCCTTAGAAGACAGTGAAAGGTAAGCTCTAGCTTAATGTCTATGATTTGTTCTTTGACATTAAGGAAG 721 GTAAGGATTGGTCAGAGGATGTAACTTGATGTGAGCAGTAGTAAACCTGTTTTAGATATCATACTGTTAATATTTTATTG 801 AAAATTTATTTCAGAGCGGAGAAACTTAAGCTAAAGTCTGTTATACAGAATTGAAAGCCTTCGTATCTTGAACCTCCCAA 881 CATTTTTCTTATGGCTGTTGAAAAGTATAGAGCTAAATTGATTTAATTACACTTTCCTTTGTACTTTAAAAAAAAGTATG 961 CTAGCACTATTGTACCTTGAAAGGATTTCCACCAGACTGTCTTGAGTAGTGACTTCTTTGGTGAGGCAAGAAGGATATAC 1041 ATTATTTTAGAATCATTTACTATTTAAATGAGACAATCATATTATTTTAGAATCATTTATTTTAAATGAGACAATCATTT 1121 TAAGTTTTAAGATAACAGAAGTGACCAATGTAATTTCACAACACCTAAGGATTTTTTGGTTGATCAGGTTACTGTAGATT 1201 TTTACTGATTGTCCTGGATGAATAGACTGTGCTTTTTCTTTTTCTCTCCCTTCCTTCTTGGTTTCCCATAGTATAATAAG 1281 CATGCATACTTTAACTTCTATAGTTTTCTCCTTTAGAGGGTCGTCTTCAGTTTTAGAGGTTTACTTCTCCCTTGCCTTTG 1361 ACTCATTGGACTAGTGCAGAGGCTTTAAGTAGTTTAAAATGGGCTTTTGCTTTTCTAGGTCATTAACGTTTTTTATTTAG 1441 TTTCTTTAGCCAATAGTGGCTGAGTTTCGCACTTGATTTTCAATATTTTATAGTAAGAAATGACAAACTGCTTTGTTTCA 1521 TTTCATAAACAAACTCTGCATTTAGATAACTATTAAAGGTTGTTAAGATGAAGATTTACTGTTTCTTTGTTACTCGTTGG 1601 TACAGCTGTTTGTTTTACTTGCACATTTGTACATATACTTAATGTTTTCAAGTGCCTTAATTGTTTAAAATCTCTGGCTT 1681 CAAAGTTTCTTGGGGAAAGGTCGGTTTACCTCACATTTTTTGTTTCCATTAGTAATATTCTAGGTACCTCACAAAATGTA 1761 TTATGGTGCCATGGCTGTTAGTTTTTAGTGAGTGCTGTAGGATTAATTCGAAAATAGGCAGAATTCCATTCCTCCCAAGG 1841 TGGCAAAAATTAGCTATACTGATGTAATTGTCATTTACCTGGGTATGAATTCCCTGACACACATTCATGTCAACATATGT 1921 AGCAAATTTTGTGAAAACATAACAATTTGAAGCTTCTGTAATTTTGAGCACTGCTCTAACAACAAGCATAATATAAAATT 2001 AGTTAGATTTTGCAAGTCTACAAATGAGCTCTTGCAACAGAACTCACAGCCTTTTTACTTTTTTCCCCTAACTTTAGCAA 2081 TGTAGTATCTTGAGCCATTAATTTTTGGGTTTTTTTAAAATCCAGAAGGTATATAGAAACCTTTTCAGATTTTTCATCTG 2161 ATTTGTTCTTGCAGATGTTCTTCTATCAAATACCTTATTTTACCTTACAGATATTTGTTGCACAGGCAGATACTGCTGTA 2241 TTTAGACATTTCTATTTCAGTTCATTAAAAACTGCAAAACCAATCTGTATCATGTACCAAACTGACTTAAAATAAATCTA 2321 CATGTTTATTGAATTAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293 | ||||||
Disease | 8763.0 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
Experimental Support 3 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Disease | 8763.0 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine
"PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine
"PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
CLIP-seq Support 1 for dataset GSM4903833 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | Dermal fibroblasts / CTL_TD_21_a |
Location of target site | NM_001142402 | 3UTR | UUGGACUAGUGCAGAGGCUUUAAGUAGUUUAAAAUGGGCUUUUGCUUUUCUAGGUCAUUAACGUUUUUUAUUUAGUUUCUUUAGCCAAUAGUGGCUGAGUUUCGCACUUGAUUUUCAAUAUUUUAUAGUAAGAAAUGACA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE161239 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM4903834 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | Dermal fibroblasts / CTL_TD_21_b |
Location of target site | NM_001142402 | 3UTR | GAGGCUUUAAGUAGUUUAAAAUGGGCUUUUGCUUUUCUAGGUCAUUAACGUUUUUUAUUUAGUUUCUUUAGCCAAUAGUGGCUGAGUUUCGCACUUGAUUUUCAAUAUUUUAUAGUAAGAAAUGACA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE161239 |
CLIP-seq Viewer | Link |
CLIP-seq Support 3 for dataset GSM4903835 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | Dermal fibroblasts / CTL_TD_21_c |
Location of target site | NM_001142402 | 3UTR | UUGGACUAGUGCAGAGGCUUUAAGUAGUUUAAAAUGGGCUUUUGCUUUUCUAGGUCAUUAACGUUUUUUAUUUAGUUUCUUUAGCCAAUAGUGGCUGAGUUUCGCACUUGAUUUUCAAUAUUUUAUAGUAAGAAAUGACA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE161239 |
CLIP-seq Viewer | Link |
CLIP-seq Support 4 for dataset GSM4903836 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | Dermal fibroblasts / 124_TD_21_a |
Location of target site | NM_001142402 | 3UTR | UGCAGAGGCUUUAAGUAGUUUAAAAUGGGCUUUUGCUUUUCUAGGUCAUUAACGUUUUUUAUUUAGUUUCUUUAGCCAAUAGUGGCUGAGUUUCGCACUUGAUUUUCAAUAUUUUAUAGUAAGAAAUGACA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE161239 |
CLIP-seq Viewer | Link |
CLIP-seq Support 5 for dataset GSM4903837 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | Dermal fibroblasts / 124_TD_21_b |
Location of target site | NM_001142402 | 3UTR | CUCAUUGGACUAGUGCAGAGGCUUUAAGUAGUUUAAAAUGGGCUUUUGCUUUUCUAGGUCAUUAACGUUUUUUAUUUAGUUUCUUUAGCCAAUAGUGGCUGAGUUUCGCACUUGAUUUUCAAUAUUUUAUAGUAAGAAAUGACA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE161239 |
CLIP-seq Viewer | Link |
CLIP-seq Support 6 for dataset GSM4903838 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | Dermal fibroblasts / 124_TD_21_c |
Location of target site | NM_001142402 | 3UTR | GCCAAAUAUAACUUUCUGAAAGUGAUGGAAAAUGUUGUCUUGUGCAGACAACAUCAUGGCUC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE161239 |
CLIP-seq Viewer | Link |
CLIP-seq Support 7 for dataset GSM545214 | |
---|---|
Method / RBP | PAR-CLIP / AGO3 |
Cell line / Condition | HEK293 / Control |
Location of target site | ENST00000368961.5 | 3UTR | ACAACAUCAUGGCUCUUGGCAGUUU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 8 for dataset GSM714644 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repA |
Location of target site | ENST00000368961.5 | 3UTR | ACAACAUCAUGGCUCUUGGCAGUUUAAAUUUAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
CLIP-seq Support 9 for dataset GSM1065667 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_6 |
Location of target site | ENST00000368961.5 | 3UTR | GACAACAUCAUGGCUCUUGGCAGUUUAAAUUUAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23446348 / GSE43573 |
CLIP-seq Viewer | Link |
CLIP-seq Support 10 for dataset GSM1065668 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_7 |
Location of target site | ENST00000368961.5 | 3UTR | ACAACAUCAUGGCUCUUGGCAGUUUA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23446348 / GSE43573 |
CLIP-seq Viewer | Link |
CLIP-seq Support 11 for dataset GSM1065669 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_8 |
Location of target site | ENST00000368961.5 | 3UTR | ACAACAUCAUGGCUCUUGGCAGUUUA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23446348 / GSE43573 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
296 hsa-miR-4793-3p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT092332 | EDEM1 | ER degradation enhancing alpha-mannosidase like protein 1 | 2 | 6 | ||||||||
MIRT131237 | ATG2A | autophagy related 2A | 2 | 2 | ||||||||
MIRT145926 | ANKFY1 | ankyrin repeat and FYVE domain containing 1 | 2 | 2 | ||||||||
MIRT206559 | SOCS5 | suppressor of cytokine signaling 5 | 2 | 8 | ||||||||
MIRT226455 | TP53INP1 | tumor protein p53 inducible nuclear protein 1 | 2 | 2 | ||||||||
MIRT337662 | ZNF695 | zinc finger protein 695 | 2 | 2 | ||||||||
MIRT405828 | SIX4 | SIX homeobox 4 | 2 | 2 | ||||||||
MIRT455113 | RILPL1 | Rab interacting lysosomal protein like 1 | 2 | 2 | ||||||||
MIRT456756 | TMEM239 | transmembrane protein 239 | 2 | 4 | ||||||||
MIRT457974 | RGS9BP | regulator of G protein signaling 9 binding protein | 2 | 2 | ||||||||
MIRT458173 | LYRM4 | LYR motif containing 4 | 2 | 4 | ||||||||
MIRT458245 | SLC9A7 | solute carrier family 9 member A7 | 2 | 2 | ||||||||
MIRT466145 | TMEM120B | transmembrane protein 120B | 2 | 2 | ||||||||
MIRT474981 | KATNAL1 | katanin catalytic subunit A1 like 1 | 2 | 2 | ||||||||
MIRT475601 | HMGB2 | high mobility group box 2 | 2 | 4 | ||||||||
MIRT480759 | BMP3 | bone morphogenetic protein 3 | 2 | 4 | ||||||||
MIRT481156 | AVL9 | AVL9 cell migration associated | 2 | 2 | ||||||||
MIRT482155 | AK2 | adenylate kinase 2 | 2 | 2 | ||||||||
MIRT488386 | VAV3 | vav guanine nucleotide exchange factor 3 | 2 | 6 | ||||||||
MIRT496575 | KIF18B | kinesin family member 18B | 2 | 2 | ||||||||
MIRT498411 | TXNDC16 | thioredoxin domain containing 16 | 2 | 4 | ||||||||
MIRT504547 | ZNF417 | zinc finger protein 417 | 2 | 6 | ||||||||
MIRT505417 | TCF7L2 | transcription factor 7 like 2 | 2 | 2 | ||||||||
MIRT509349 | ALDH9A1 | aldehyde dehydrogenase 9 family member A1 | 2 | 6 | ||||||||
MIRT512164 | CD164 | CD164 molecule | 2 | 6 | ||||||||
MIRT517238 | PRIM1 | DNA primase subunit 1 | 2 | 2 | ||||||||
MIRT518671 | KCNMB1 | potassium calcium-activated channel subfamily M regulatory beta subunit 1 | 2 | 2 | ||||||||
MIRT519298 | MLH1 | mutL homolog 1 | 2 | 2 | ||||||||
MIRT523662 | FOSL2 | FOS like 2, AP-1 transcription factor subunit | 2 | 2 | ||||||||
MIRT525452 | GPATCH2L | G-patch domain containing 2 like | 2 | 2 | ||||||||
MIRT539847 | ZNF766 | zinc finger protein 766 | 2 | 2 | ||||||||
MIRT540076 | SSH3 | slingshot protein phosphatase 3 | 2 | 2 | ||||||||
MIRT540320 | PIGR | polymeric immunoglobulin receptor | 2 | 2 | ||||||||
MIRT540548 | MAGI3 | membrane associated guanylate kinase, WW and PDZ domain containing 3 | 2 | 2 | ||||||||
MIRT540759 | UTP6 | UTP6, small subunit processome component | 2 | 2 | ||||||||
MIRT541545 | HIATL2 | major facilitator superfamily domain containing 14C | 2 | 2 | ||||||||
MIRT541553 | SLC35E1 | solute carrier family 35 member E1 | 2 | 2 | ||||||||
MIRT541666 | ATP8B3 | ATPase phospholipid transporting 8B3 | 2 | 4 | ||||||||
MIRT541722 | TFDP2 | transcription factor Dp-2 | 2 | 2 | ||||||||
MIRT541800 | DUSP28 | dual specificity phosphatase 28 | 2 | 2 | ||||||||
MIRT541816 | SMU1 | DNA replication regulator and spliceosomal factor | 2 | 2 | ||||||||
MIRT541907 | VWA7 | von Willebrand factor A domain containing 7 | 2 | 2 | ||||||||
MIRT542154 | UGDH | UDP-glucose 6-dehydrogenase | 2 | 2 | ||||||||
MIRT542207 | C14orf142 | GON7, KEOPS complex subunit homolog | 2 | 2 | ||||||||
MIRT542233 | FUT9 | fucosyltransferase 9 | 2 | 2 | ||||||||
MIRT542320 | SERPING1 | serpin family G member 1 | 2 | 2 | ||||||||
MIRT542369 | PAICS | phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide synthase | 2 | 2 | ||||||||
MIRT542476 | APOC3 | apolipoprotein C3 | 2 | 2 | ||||||||
MIRT542641 | TIMM8A | translocase of inner mitochondrial membrane 8A | 2 | 2 | ||||||||
MIRT542660 | TAF11 | TATA-box binding protein associated factor 11 | 2 | 2 | ||||||||
MIRT542749 | PRRG4 | proline rich and Gla domain 4 | 2 | 4 | ||||||||
MIRT542789 | PLEKHA3 | pleckstrin homology domain containing A3 | 2 | 2 | ||||||||
MIRT545442 | FGFRL1 | fibroblast growth factor receptor like 1 | 2 | 2 | ||||||||
MIRT546206 | TOR1AIP2 | torsin 1A interacting protein 2 | 2 | 2 | ||||||||
MIRT552270 | RAB3D | RAB3D, member RAS oncogene family | 2 | 2 | ||||||||
MIRT552655 | ZADH2 | zinc binding alcohol dehydrogenase domain containing 2 | 2 | 2 | ||||||||
MIRT554134 | SMARCA5 | SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 | 2 | 2 | ||||||||
MIRT556795 | KIAA1958 | KIAA1958 | 2 | 2 | ||||||||
MIRT564762 | ZHX3 | zinc fingers and homeoboxes 3 | 2 | 2 | ||||||||
MIRT569428 | STX7 | syntaxin 7 | 2 | 2 | ||||||||
MIRT573245 | ZBTB46 | zinc finger and BTB domain containing 46 | 2 | 2 | ||||||||
MIRT607390 | LANCL3 | LanC like 3 | 2 | 2 | ||||||||
MIRT607430 | NOTCH2NL | notch 2 N-terminal like | 2 | 2 | ||||||||
MIRT607452 | ZNF543 | zinc finger protein 543 | 2 | 2 | ||||||||
MIRT607580 | TANGO2 | transport and golgi organization 2 homolog | 2 | 2 | ||||||||
MIRT607748 | ANGPT4 | angiopoietin 4 | 2 | 2 | ||||||||
MIRT607907 | SPRYD4 | SPRY domain containing 4 | 2 | 2 | ||||||||
MIRT608703 | GMPR | guanosine monophosphate reductase | 2 | 2 | ||||||||
MIRT612127 | NDUFA10 | NADH:ubiquinone oxidoreductase subunit A10 | 2 | 2 | ||||||||
MIRT612786 | MAP3K9 | mitogen-activated protein kinase kinase kinase 9 | 2 | 4 | ||||||||
MIRT616692 | LPL | lipoprotein lipase | 2 | 2 | ||||||||
MIRT617045 | ZNF610 | zinc finger protein 610 | 2 | 2 | ||||||||
MIRT617091 | ZNF43 | zinc finger protein 43 | 2 | 2 | ||||||||
MIRT617314 | MBOAT1 | membrane bound O-acyltransferase domain containing 1 | 2 | 2 | ||||||||
MIRT617355 | MELK | maternal embryonic leucine zipper kinase | 2 | 2 | ||||||||
MIRT617486 | ALG9 | ALG9, alpha-1,2-mannosyltransferase | 2 | 2 | ||||||||
MIRT617579 | NDUFB5 | NADH:ubiquinone oxidoreductase subunit B5 | 2 | 2 | ||||||||
MIRT617669 | RSRC1 | arginine and serine rich coiled-coil 1 | 2 | 2 | ||||||||
MIRT617722 | TRAPPC2 | trafficking protein particle complex 2 | 2 | 4 | ||||||||
MIRT617893 | PTCHD3 | patched domain containing 3 | 2 | 2 | ||||||||
MIRT617982 | ZNF234 | zinc finger protein 234 | 2 | 4 | ||||||||
MIRT618434 | MYLK3 | myosin light chain kinase 3 | 2 | 4 | ||||||||
MIRT618732 | HIST1H2AH | histone cluster 1 H2A family member h | 2 | 2 | ||||||||
MIRT619045 | CASS4 | Cas scaffolding protein family member 4 | 2 | 2 | ||||||||
MIRT619573 | ATAT1 | alpha tubulin acetyltransferase 1 | 2 | 4 | ||||||||
MIRT619671 | CYP1A2 | cytochrome P450 family 1 subfamily A member 2 | 2 | 2 | ||||||||
MIRT619887 | ABHD17B | abhydrolase domain containing 17B | 2 | 2 | ||||||||
MIRT620519 | SNRPD1 | small nuclear ribonucleoprotein D1 polypeptide | 2 | 4 | ||||||||
MIRT620535 | AVPR1A | arginine vasopressin receptor 1A | 2 | 2 | ||||||||
MIRT620996 | C19orf52 | translocase of inner mitochondrial membrane 29 | 2 | 2 | ||||||||
MIRT621304 | YIPF4 | Yip1 domain family member 4 | 2 | 2 | ||||||||
MIRT622086 | SRPX2 | sushi repeat containing protein, X-linked 2 | 2 | 2 | ||||||||
MIRT622168 | SMYD1 | SET and MYND domain containing 1 | 2 | 2 | ||||||||
MIRT622543 | PXMP4 | peroxisomal membrane protein 4 | 2 | 2 | ||||||||
MIRT622761 | PGM3 | phosphoglucomutase 3 | 2 | 2 | ||||||||
MIRT622885 | PDCL3 | phosducin like 3 | 2 | 4 | ||||||||
MIRT623130 | NDUFC2 | NADH:ubiquinone oxidoreductase subunit C2 | 2 | 2 | ||||||||
MIRT624840 | ACAP2 | ArfGAP with coiled-coil, ankyrin repeat and PH domains 2 | 2 | 2 | ||||||||
MIRT625047 | MBD3 | methyl-CpG binding domain protein 3 | 2 | 2 | ||||||||
MIRT625059 | ZNF556 | zinc finger protein 556 | 2 | 2 | ||||||||
MIRT625508 | PPAPDC1A | phospholipid phosphatase 4 | 2 | 2 | ||||||||
MIRT625573 | ANKRD42 | ankyrin repeat domain 42 | 2 | 2 | ||||||||
MIRT626133 | SNRNP48 | small nuclear ribonucleoprotein U11/U12 subunit 48 | 2 | 2 | ||||||||
MIRT626327 | LRTOMT | leucine rich transmembrane and O-methyltransferase domain containing | 2 | 2 | ||||||||
MIRT626765 | CDC14B | cell division cycle 14B | 2 | 2 | ||||||||
MIRT626798 | CSE1L | chromosome segregation 1 like | 2 | 2 | ||||||||
MIRT627212 | ZC3H12B | zinc finger CCCH-type containing 12B | 2 | 2 | ||||||||
MIRT627225 | ZBTB8B | zinc finger and BTB domain containing 8B | 2 | 4 | ||||||||
MIRT627256 | XKR4 | XK related 4 | 2 | 2 | ||||||||
MIRT628190 | GATSL2 | cytosolic arginine sensor for mTORC1 subunit 2 | 2 | 2 | ||||||||
MIRT628466 | AHSA2 | activator of HSP90 ATPase homolog 2 | 2 | 2 | ||||||||
MIRT628627 | CCT4 | chaperonin containing TCP1 subunit 4 | 2 | 2 | ||||||||
MIRT629040 | KLLN | killin, p53-regulated DNA replication inhibitor | 2 | 2 | ||||||||
MIRT630847 | ACACB | acetyl-CoA carboxylase beta | 2 | 2 | ||||||||
MIRT631721 | RNASEH2B | ribonuclease H2 subunit B | 2 | 2 | ||||||||
MIRT632264 | USP1 | ubiquitin specific peptidase 1 | 2 | 4 | ||||||||
MIRT632571 | POLQ | DNA polymerase theta | 2 | 2 | ||||||||
MIRT633992 | SLC35E2 | solute carrier family 35 member E2 | 2 | 2 | ||||||||
MIRT635211 | ZNF286A | zinc finger protein 286A | 2 | 4 | ||||||||
MIRT635249 | ELOVL6 | ELOVL fatty acid elongase 6 | 2 | 4 | ||||||||
MIRT635261 | FBXL20 | F-box and leucine rich repeat protein 20 | 2 | 2 | ||||||||
MIRT635283 | GK5 | glycerol kinase 5 (putative) | 2 | 2 | ||||||||
MIRT635663 | DTX3L | deltex E3 ubiquitin ligase 3L | 2 | 2 | ||||||||
MIRT636251 | SEC63 | SEC63 homolog, protein translocation regulator | 2 | 2 | ||||||||
MIRT636564 | EPB41 | erythrocyte membrane protein band 4.1 | 2 | 2 | ||||||||
MIRT636814 | TBC1D24 | TBC1 domain family member 24 | 2 | 2 | ||||||||
MIRT637358 | ZNF460 | zinc finger protein 460 | 2 | 2 | ||||||||
MIRT637473 | DEFB105B | defensin beta 105B | 2 | 4 | ||||||||
MIRT637505 | DEFB105A | defensin beta 105A | 2 | 4 | ||||||||
MIRT637861 | SC5D | sterol-C5-desaturase | 2 | 2 | ||||||||
MIRT638080 | ZNF652 | zinc finger protein 652 | 2 | 2 | ||||||||
MIRT638096 | ZBTB8A | zinc finger and BTB domain containing 8A | 2 | 2 | ||||||||
MIRT638174 | TMED4 | transmembrane p24 trafficking protein 4 | 2 | 2 | ||||||||
MIRT638201 | TAF13 | TATA-box binding protein associated factor 13 | 2 | 2 | ||||||||
MIRT638278 | SH2B3 | SH2B adaptor protein 3 | 2 | 2 | ||||||||
MIRT638714 | FUT11 | fucosyltransferase 11 | 2 | 2 | ||||||||
MIRT638852 | CLMP | CXADR like membrane protein | 2 | 2 | ||||||||
MIRT639815 | TMED8 | transmembrane p24 trafficking protein family member 8 | 2 | 2 | ||||||||
MIRT640879 | ENTPD1 | ectonucleoside triphosphate diphosphohydrolase 1 | 2 | 2 | ||||||||
MIRT640937 | FAM129A | family with sequence similarity 129 member A | 2 | 2 | ||||||||
MIRT640971 | ORAI2 | ORAI calcium release-activated calcium modulator 2 | 2 | 2 | ||||||||
MIRT641642 | GNAZ | G protein subunit alpha z | 2 | 2 | ||||||||
MIRT641931 | SLC25A16 | solute carrier family 25 member 16 | 2 | 2 | ||||||||
MIRT642136 | CRY2 | cryptochrome circadian clock 2 | 2 | 2 | ||||||||
MIRT643199 | JAK3 | Janus kinase 3 | 2 | 2 | ||||||||
MIRT643256 | ZNF566 | zinc finger protein 566 | 2 | 2 | ||||||||
MIRT643378 | TRIM16L | tripartite motif containing 16 like | 2 | 2 | ||||||||
MIRT643683 | AMER3 | APC membrane recruitment protein 3 | 2 | 2 | ||||||||
MIRT643728 | MCMDC2 | minichromosome maintenance domain containing 2 | 2 | 2 | ||||||||
MIRT643949 | CCDC141 | coiled-coil domain containing 141 | 2 | 2 | ||||||||
MIRT644915 | SERF1B | small EDRK-rich factor 1B | 2 | 2 | ||||||||
MIRT645163 | NOL9 | nucleolar protein 9 | 2 | 2 | ||||||||
MIRT645547 | PABPC1L2B | poly(A) binding protein cytoplasmic 1 like 2B | 2 | 2 | ||||||||
MIRT645550 | PABPC1L2A | poly(A) binding protein cytoplasmic 1 like 2A | 2 | 2 | ||||||||
MIRT645572 | TACR2 | tachykinin receptor 2 | 2 | 2 | ||||||||
MIRT646697 | SERF1A | small EDRK-rich factor 1A | 2 | 2 | ||||||||
MIRT647806 | FRMD8 | FERM domain containing 8 | 2 | 2 | ||||||||
MIRT647903 | CIRH1A | UTP4, small subunit processome component | 2 | 2 | ||||||||
MIRT648978 | ACAD8 | acyl-CoA dehydrogenase family member 8 | 2 | 2 | ||||||||
MIRT649907 | SLFN12L | schlafen family member 12 like | 2 | 2 | ||||||||
MIRT650224 | SIGLEC9 | sialic acid binding Ig like lectin 9 | 2 | 4 | ||||||||
MIRT651880 | UGGT1 | UDP-glucose glycoprotein glucosyltransferase 1 | 2 | 2 | ||||||||
MIRT651935 | UBN1 | ubinuclein 1 | 2 | 2 | ||||||||
MIRT652839 | TACO1 | translational activator of cytochrome c oxidase I | 2 | 2 | ||||||||
MIRT652994 | SUGT1 | SGT1 homolog, MIS12 kinetochore complex assembly cochaperone | 2 | 2 | ||||||||
MIRT654800 | PRICKLE1 | prickle planar cell polarity protein 1 | 2 | 2 | ||||||||
MIRT655591 | OTUD7B | OTU deubiquitinase 7B | 2 | 2 | ||||||||
MIRT658760 | EIF4EBP2 | eukaryotic translation initiation factor 4E binding protein 2 | 2 | 2 | ||||||||
MIRT659358 | CRKL | CRK like proto-oncogene, adaptor protein | 2 | 2 | ||||||||
MIRT660717 | AMER1 | APC membrane recruitment protein 1 | 2 | 2 | ||||||||
MIRT660737 | ALG14 | ALG14, UDP-N-acetylglucosaminyltransferase subunit | 2 | 2 | ||||||||
MIRT661088 | TMEM145 | transmembrane protein 145 | 2 | 2 | ||||||||
MIRT661176 | S1PR2 | sphingosine-1-phosphate receptor 2 | 2 | 2 | ||||||||
MIRT662005 | ZNF445 | zinc finger protein 445 | 2 | 2 | ||||||||
MIRT662178 | KIAA1210 | KIAA1210 | 2 | 2 | ||||||||
MIRT662270 | OR51E2 | olfactory receptor family 51 subfamily E member 2 | 2 | 2 | ||||||||
MIRT663046 | SLC16A4 | solute carrier family 16 member 4 | 2 | 2 | ||||||||
MIRT663476 | POFUT2 | protein O-fucosyltransferase 2 | 2 | 2 | ||||||||
MIRT664039 | RPL27A | ribosomal protein L27a | 2 | 2 | ||||||||
MIRT664096 | ZDHHC24 | zinc finger DHHC-type containing 24 | 2 | 2 | ||||||||
MIRT664109 | FUT1 | fucosyltransferase 1 (H blood group) | 2 | 2 | ||||||||
MIRT664317 | CD209 | CD209 molecule | 2 | 2 | ||||||||
MIRT664455 | BBS5 | Bardet-Biedl syndrome 5 | 2 | 2 | ||||||||
MIRT664595 | HSD17B12 | hydroxysteroid 17-beta dehydrogenase 12 | 2 | 4 | ||||||||
MIRT664694 | DBF4 | DBF4 zinc finger | 2 | 2 | ||||||||
MIRT665162 | SF3A1 | splicing factor 3a subunit 1 | 2 | 2 | ||||||||
MIRT665214 | RBM22 | RNA binding motif protein 22 | 2 | 2 | ||||||||
MIRT665254 | ZNF286B | zinc finger protein 286B | 2 | 2 | ||||||||
MIRT665268 | ZFP69B | ZFP69 zinc finger protein B | 2 | 2 | ||||||||
MIRT665606 | TTC39A | tetratricopeptide repeat domain 39A | 2 | 2 | ||||||||
MIRT665830 | TIMELESS | timeless circadian clock | 2 | 2 | ||||||||
MIRT666201 | SMARCC1 | SWI/SNF related, matrix associated, actin dependent regulator of chromatin subfamily c member 1 | 2 | 2 | ||||||||
MIRT666546 | RNF115 | ring finger protein 115 | 2 | 2 | ||||||||
MIRT666602 | REEP3 | receptor accessory protein 3 | 2 | 2 | ||||||||
MIRT666862 | POU2F3 | POU class 2 homeobox 3 | 2 | 4 | ||||||||
MIRT666886 | POLA2 | DNA polymerase alpha 2, accessory subunit | 2 | 2 | ||||||||
MIRT667158 | NRXN3 | neurexin 3 | 2 | 2 | ||||||||
MIRT667252 | NEK9 | NIMA related kinase 9 | 2 | 2 | ||||||||
MIRT667419 | MFSD2A | major facilitator superfamily domain containing 2A | 2 | 2 | ||||||||
MIRT667434 | METTL8 | methyltransferase like 8 | 2 | 2 | ||||||||
MIRT668023 | HAUS3 | HAUS augmin like complex subunit 3 | 2 | 2 | ||||||||
MIRT668062 | GPR75 | G protein-coupled receptor 75 | 2 | 2 | ||||||||
MIRT668070 | GOSR1 | golgi SNAP receptor complex member 1 | 2 | 2 | ||||||||
MIRT668607 | EHD4 | EH domain containing 4 | 2 | 4 | ||||||||
MIRT668694 | DNAL1 | dynein axonemal light chain 1 | 2 | 2 | ||||||||
MIRT668782 | DAAM1 | dishevelled associated activator of morphogenesis 1 | 2 | 2 | ||||||||
MIRT669037 | CHEK1 | checkpoint kinase 1 | 2 | 2 | ||||||||
MIRT669044 | CHAF1B | chromatin assembly factor 1 subunit B | 2 | 4 | ||||||||
MIRT669156 | CCNG1 | cyclin G1 | 2 | 2 | ||||||||
MIRT670090 | ABCF3 | ATP binding cassette subfamily F member 3 | 2 | 4 | ||||||||
MIRT670206 | SLC24A4 | solute carrier family 24 member 4 | 2 | 2 | ||||||||
MIRT672488 | FUS | FUS RNA binding protein | 2 | 2 | ||||||||
MIRT673830 | SLC11A2 | solute carrier family 11 member 2 | 2 | 2 | ||||||||
MIRT675481 | VEGFC | vascular endothelial growth factor C | 2 | 2 | ||||||||
MIRT675634 | HACE1 | HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 | 2 | 2 | ||||||||
MIRT677913 | HIST1H2BN | histone cluster 1 H2B family member n | 2 | 2 | ||||||||
MIRT678420 | ANKRD36 | ankyrin repeat domain 36 | 2 | 2 | ||||||||
MIRT678626 | OLFML2A | olfactomedin like 2A | 2 | 2 | ||||||||
MIRT678791 | NUPL2 | nucleoporin like 2 | 2 | 2 | ||||||||
MIRT679561 | LIN9 | lin-9 DREAM MuvB core complex component | 2 | 2 | ||||||||
MIRT680743 | CA5B | carbonic anhydrase 5B | 2 | 2 | ||||||||
MIRT682481 | LIX1L | limb and CNS expressed 1 like | 2 | 4 | ||||||||
MIRT682701 | PSMD9 | proteasome 26S subunit, non-ATPase 9 | 2 | 2 | ||||||||
MIRT682759 | MDM2 | MDM2 proto-oncogene | 2 | 2 | ||||||||
MIRT682811 | TMCO1 | transmembrane and coiled-coil domains 1 | 2 | 2 | ||||||||
MIRT682847 | DNAJC28 | DnaJ heat shock protein family (Hsp40) member C28 | 2 | 2 | ||||||||
MIRT682896 | XIAP | X-linked inhibitor of apoptosis | 2 | 2 | ||||||||
MIRT682916 | FAM73A | mitoguardin 1 | 2 | 2 | ||||||||
MIRT682935 | ZNF292 | zinc finger protein 292 | 2 | 2 | ||||||||
MIRT682953 | RPL12 | ribosomal protein L12 | 2 | 2 | ||||||||
MIRT682972 | NF2 | neurofibromin 2 | 2 | 2 | ||||||||
MIRT683033 | SUSD5 | sushi domain containing 5 | 2 | 2 | ||||||||
MIRT683081 | A1BG | alpha-1-B glycoprotein | 2 | 2 | ||||||||
MIRT683105 | TIMM10B | translocase of inner mitochondrial membrane 10B | 2 | 2 | ||||||||
MIRT686640 | TMEM184C | transmembrane protein 184C | 2 | 2 | ||||||||
MIRT687444 | NR3C1 | nuclear receptor subfamily 3 group C member 1 | 2 | 2 | ||||||||
MIRT688401 | EMC8 | ER membrane protein complex subunit 8 | 2 | 2 | ||||||||
MIRT688886 | C3orf70 | chromosome 3 open reading frame 70 | 2 | 2 | ||||||||
MIRT689148 | IRAK1BP1 | interleukin 1 receptor associated kinase 1 binding protein 1 | 2 | 2 | ||||||||
MIRT689234 | RPS19 | ribosomal protein S19 | 2 | 2 | ||||||||
MIRT689306 | C5AR2 | complement component 5a receptor 2 | 2 | 2 | ||||||||
MIRT689364 | ZNF101 | zinc finger protein 101 | 2 | 2 | ||||||||
MIRT689498 | SCARF1 | scavenger receptor class F member 1 | 2 | 2 | ||||||||
MIRT689655 | RBM23 | RNA binding motif protein 23 | 2 | 2 | ||||||||
MIRT689897 | SOD2 | superoxide dismutase 2 | 2 | 2 | ||||||||
MIRT690150 | PPIL6 | peptidylprolyl isomerase like 6 | 2 | 2 | ||||||||
MIRT690601 | C17orf105 | chromosome 17 open reading frame 105 | 2 | 2 | ||||||||
MIRT690805 | FAHD1 | fumarylacetoacetate hydrolase domain containing 1 | 2 | 2 | ||||||||
MIRT690946 | GLG1 | golgi glycoprotein 1 | 2 | 2 | ||||||||
MIRT691388 | ATP13A4 | ATPase 13A4 | 2 | 2 | ||||||||
MIRT691408 | DNA2 | DNA replication helicase/nuclease 2 | 2 | 2 | ||||||||
MIRT692175 | LRRC3C | leucine rich repeat containing 3C | 2 | 2 | ||||||||
MIRT692235 | ALDH1B1 | aldehyde dehydrogenase 1 family member B1 | 2 | 2 | ||||||||
MIRT693283 | GINM1 | glycoprotein integral membrane 1 | 2 | 2 | ||||||||
MIRT693439 | TPGS1 | tubulin polyglutamylase complex subunit 1 | 2 | 2 | ||||||||
MIRT693460 | HIST1H2AG | histone cluster 1 H2A family member g | 2 | 2 | ||||||||
MIRT693768 | ZNF383 | zinc finger protein 383 | 2 | 2 | ||||||||
MIRT694018 | PPIL4 | peptidylprolyl isomerase like 4 | 2 | 2 | ||||||||
MIRT694236 | ZNF749 | zinc finger protein 749 | 2 | 2 | ||||||||
MIRT694321 | NLRP9 | NLR family pyrin domain containing 9 | 2 | 2 | ||||||||
MIRT694347 | CHST6 | carbohydrate sulfotransferase 6 | 2 | 2 | ||||||||
MIRT694430 | MCF2L2 | MCF.2 cell line derived transforming sequence-like 2 | 2 | 2 | ||||||||
MIRT695763 | WDR35 | WD repeat domain 35 | 2 | 2 | ||||||||
MIRT696167 | TIPIN | TIMELESS interacting protein | 2 | 2 | ||||||||
MIRT696417 | DOCK7 | dedicator of cytokinesis 7 | 2 | 2 | ||||||||
MIRT696543 | C3 | complement C3 | 2 | 2 | ||||||||
MIRT696998 | CCDC80 | coiled-coil domain containing 80 | 2 | 2 | ||||||||
MIRT697232 | ZYG11A | zyg-11 family member A, cell cycle regulator | 2 | 2 | ||||||||
MIRT697806 | UBXN2A | UBX domain protein 2A | 2 | 2 | ||||||||
MIRT697944 | TVP23C | trans-golgi network vesicle protein 23 homolog C | 2 | 2 | ||||||||
MIRT698161 | TNFRSF13C | TNF receptor superfamily member 13C | 2 | 2 | ||||||||
MIRT698778 | STK4 | serine/threonine kinase 4 | 2 | 2 | ||||||||
MIRT700259 | RBM12B | RNA binding motif protein 12B | 2 | 2 | ||||||||
MIRT700970 | PDK3 | pyruvate dehydrogenase kinase 3 | 2 | 2 | ||||||||
MIRT701251 | NUP35 | nucleoporin 35 | 2 | 2 | ||||||||
MIRT701607 | MYPN | myopalladin | 2 | 2 | ||||||||
MIRT702457 | KIAA1467 | family with sequence similarity 234 member B | 2 | 2 | ||||||||
MIRT702613 | ITPRIPL2 | inositol 1,4,5-trisphosphate receptor interacting protein like 2 | 2 | 2 | ||||||||
MIRT702691 | IRGQ | immunity related GTPase Q | 2 | 2 | ||||||||
MIRT702934 | HMX3 | H6 family homeobox 3 | 2 | 2 | ||||||||
MIRT702991 | HERPUD2 | HERPUD family member 2 | 2 | 2 | ||||||||
MIRT703148 | GPR137C | G protein-coupled receptor 137C | 2 | 2 | ||||||||
MIRT703980 | EMC1 | ER membrane protein complex subunit 1 | 2 | 2 | ||||||||
MIRT704569 | CLPX | caseinolytic mitochondrial matrix peptidase chaperone subunit | 2 | 2 | ||||||||
MIRT705065 | C4orf32 | family with sequence similarity 241 member A | 2 | 2 | ||||||||
MIRT705447 | ATL2 | atlastin GTPase 2 | 2 | 2 | ||||||||
MIRT705856 | AFF3 | AF4/FMR2 family member 3 | 2 | 2 | ||||||||
MIRT705886 | ADIPOR2 | adiponectin receptor 2 | 2 | 2 | ||||||||
MIRT714370 | HP1BP3 | heterochromatin protein 1 binding protein 3 | 2 | 2 | ||||||||
MIRT715784 | PHF12 | PHD finger protein 12 | 2 | 2 | ||||||||
MIRT715864 | KIAA0101 | PCNA clamp associated factor | 2 | 2 | ||||||||
MIRT715947 | NUP93 | nucleoporin 93 | 2 | 2 | ||||||||
MIRT716132 | THOC5 | THO complex 5 | 2 | 2 | ||||||||
MIRT717084 | EBF4 | early B-cell factor 4 | 2 | 2 | ||||||||
MIRT725424 | HNRNPA3 | heterogeneous nuclear ribonucleoprotein A3 | 2 | 2 | ||||||||
MIRT736091 | GREM1 | gremlin 1, DAN family BMP antagonist | 3 | 0 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|