miRTarBase - #MIRT512198


—
pre-miRNA Information
pre-miRNA hsa-mir-103b-1   
Genomic Coordinates chr5: 168560904 - 168560965
Description Homo sapiens miR-103b-1 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-103b-2   
Genomic Coordinates chr20: 3917502 - 3917563
Description Homo sapiens miR-103b-2 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-103b
Sequence 1| UCAUAGCCCUGUACAAUGCUGCU |23
Evidence Experimental
Experiments ChIP-seq
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN28198041 16 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs369221403 4 dbSNP
rs1283132774 7 dbSNP
rs1222085747 10 dbSNP
rs572980521 14 dbSNP
rs748411363 15 dbSNP
rs769854452 23 dbSNP
Putative Targets

Gene Information
Gene Symbol C1orf43   
Synonyms HSPC012, NICE-3, NICE3, NS5ATP4, S863-3
Description chromosome 1 open reading frame 43
Transcript NM_001098616   
Other Transcripts NM_015449 , NM_138740   
Expression
Putative miRNA Targets on C1orf43
3'UTR of C1orf43
(miRNA target sites are highlighted)		 
>C1orf43|NM_001098616|3'UTR
   1 CGGAGCTGAAGGACTCTTGCCGTAGATTAAGCCAGTCAGTTGCAATGTGCAAGACAGGCTGCTTGCCGGGCCGCCCTCGG
  81 AACATCTGGCCCAGCAGGCCCAGACTGTATCCATCCAAGTTCCCGTTGTATCCAGAGTTCTTAGAGCTTGTGTCTAAAGG
 161 GTAATTCCCCAACCCTTCCTTATGAGCATTTTTAGAACATTGGCTAAGACTATTTTCCCCCAGTAGCGCTTTTTTCTGGA
 241 TTTGCATTCAGGTGTTATTCTTAATGTTTCTGTCAAAGCTTCTTAAAAATCTTCACTTGGTTTCAGCCATAGTTCACCTT
 321 CCCTGTTCCAGGTTTATTTAATTCCAAAGGTGAGAGTTGGAGTGAGATGTCTTCCATATCTATACCTTTGTGCACAGTTG
 401 AATGGGAACTGTTTGGGTTTAGGGCATCTTAGAGTTGATTGATGGAAAAAGCAGACAGGAACTGGTGGGAGGTCAAGTGG
 481 GGAAGTTGGTGAATGTGGAATAACTTACCTTTGTGCTCCACTTAAACCAGATGTGTTGCAGCTTTCCTGACATGCAAGGA
 561 TCTACTTTAATTCCACACTCTCATTAATAAATTGAATAAAAGGGAATGTTTTGGCACCTGATATAATCTGCCAGGCTATG
 641 TGACAGTAGGAAGGAATGGTTTCCCCTAACAAGCCCAATGCACTGGTCTGACTTTATAAATTATTTAATAAAATGAACTA
 721 TTATCAAATAAAACGTATGAATCAGTCCTTTA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ucgucGUAACAUGUCCCGAUACu 5'
               :| | |:|  ||||||| 
Target 5' tgataTAATCTGCCAGGCTATGt 3'
 619 - 641 150.00 -11.00
2 
miRNA  3' ucgUCGUAA----CAUGU-CCCGAUACu 5'
             ||||||    | |||  ||||| | 
Target 5' atgAGCATTTTTAGAACATTGGCTAAGa 3'
 182 - 209 130.00 -11.10
3 
miRNA  3' ucguCGUAACAUG-UC---CCGAUacu 5'
              ||| |||:| ||   ||||:   
Target 5' agttGCAATGTGCAAGACAGGCTGctt 3'
 38 - 64 107.00 -12.82
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30500381 1 COSMIC
COSN30544781 2 COSMIC
COSN31594522 5 COSMIC
COSN16125433 51 COSMIC
COSN30486869 66 COSMIC
COSN30487354 67 COSMIC
COSN30192900 78 COSMIC
COSN30662103 90 COSMIC
COSN31497675 92 COSMIC
COSN30168876 103 COSMIC
COSN30500563 112 COSMIC
COSN26968506 115 COSMIC
COSN30731946 125 COSMIC
COSN22157815 134 COSMIC
COSN16129434 135 COSMIC
COSN30675726 161 COSMIC
COSN2511454 174 COSMIC
COSN1089746 212 COSMIC
COSN7178232 236 COSMIC
COSN9363612 262 COSMIC
COSN30129925 276 COSMIC
COSN7178231 291 COSMIC
COSN21090621 304 COSMIC
COSN28158619 474 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs761481558 1 dbSNP
rs375042634 2 dbSNP
rs534655057 3 dbSNP
rs779922007 4 dbSNP
rs1486298343 5 dbSNP
rs777317974 9 dbSNP
rs771121487 18 dbSNP
rs749320897 20 dbSNP
rs778003213 21 dbSNP
rs577581738 22 dbSNP
rs756356772 22 dbSNP
rs1258438721 24 dbSNP
rs74538949 28 dbSNP
rs781589783 31 dbSNP
rs755365435 33 dbSNP
rs1285934266 34 dbSNP
rs752097301 37 dbSNP
rs371479727 38 dbSNP
rs1337397062 39 dbSNP
rs767363195 39 dbSNP
rs1424973065 42 dbSNP
rs758912396 43 dbSNP
rs749897909 45 dbSNP
rs1039987694 46 dbSNP
rs764745979 47 dbSNP
rs759463153 48 dbSNP
rs139844682 55 dbSNP
rs1352374927 64 dbSNP
rs56900557 65 dbSNP
rs1461204123 67 dbSNP
rs868226907 68 dbSNP
rs758054541 71 dbSNP
rs376331077 73 dbSNP
rs1412392800 76 dbSNP
rs1168941396 78 dbSNP
rs1034317443 79 dbSNP
rs1216089254 86 dbSNP
rs1001069079 91 dbSNP
rs1050826419 94 dbSNP
rs57651556 103 dbSNP
rs1020740998 104 dbSNP
rs1183142339 109 dbSNP
rs1483280902 113 dbSNP
rs1257998601 115 dbSNP
rs145273762 116 dbSNP
rs1208646319 119 dbSNP
rs890840746 122 dbSNP
rs372265049 124 dbSNP
rs187831459 125 dbSNP
rs1382537096 127 dbSNP
rs1204850374 136 dbSNP
rs1427538832 137 dbSNP
rs368962986 148 dbSNP
rs1176254028 153 dbSNP
rs764824434 154 dbSNP
rs1340366669 160 dbSNP
rs1396546169 164 dbSNP
rs1432275779 168 dbSNP
rs779179442 171 dbSNP
rs755606744 172 dbSNP
rs754266785 183 dbSNP
rs559448599 188 dbSNP
rs113836745 198 dbSNP
rs371507833 204 dbSNP
rs766814848 212 dbSNP
rs1412883915 214 dbSNP
rs1346020206 217 dbSNP
rs981403839 220 dbSNP
rs1308448989 227 dbSNP
rs908365898 228 dbSNP
rs1449228824 236 dbSNP
rs1046844562 238 dbSNP
rs969600442 239 dbSNP
rs929393273 249 dbSNP
rs6719 250 dbSNP
rs1452234386 251 dbSNP
rs1172470411 254 dbSNP
rs992270121 260 dbSNP
rs1166462568 265 dbSNP
rs1423964228 268 dbSNP
rs1412460888 273 dbSNP
rs1401952094 276 dbSNP
rs1156760372 279 dbSNP
rs528861348 280 dbSNP
rs1179557614 282 dbSNP
rs1436870020 292 dbSNP
rs959621326 295 dbSNP
rs182391693 301 dbSNP
rs1440524282 304 dbSNP
rs376203360 305 dbSNP
rs1352852901 306 dbSNP
rs1222143926 309 dbSNP
rs1284127150 319 dbSNP
rs1204971776 326 dbSNP
rs1322907685 330 dbSNP
rs1215912714 357 dbSNP
rs1482276307 359 dbSNP
rs968295211 364 dbSNP
rs1021136196 369 dbSNP
rs1128829 373 dbSNP
rs1009716274 376 dbSNP
rs1174995145 382 dbSNP
rs1407133616 391 dbSNP
rs955122208 405 dbSNP
rs1166816597 420 dbSNP
rs1000876453 427 dbSNP
rs1029407469 428 dbSNP
rs996540292 439 dbSNP
rs899495948 441 dbSNP
rs1337779581 443 dbSNP
rs11547687 444 dbSNP
rs1222611146 444 dbSNP
rs750760170 451 dbSNP
rs903818312 457 dbSNP
rs1287856834 471 dbSNP
rs1380530268 490 dbSNP
rs1018203794 491 dbSNP
rs1271842801 494 dbSNP
rs1334537261 495 dbSNP
rs1352309719 503 dbSNP
rs1288890194 504 dbSNP
rs1007202548 514 dbSNP
rs1005887951 516 dbSNP
rs1201787008 519 dbSNP
rs890988553 521 dbSNP
rs1475484733 538 dbSNP
rs1409055140 540 dbSNP
rs1370911622 542 dbSNP
rs1050877185 546 dbSNP
rs1415584678 552 dbSNP
rs1046896574 558 dbSNP
rs756447503 567 dbSNP
rs1171191283 569 dbSNP
rs1398873931 570 dbSNP
rs929767767 576 dbSNP
rs1408501938 578 dbSNP
rs896914187 583 dbSNP
rs1359756759 591 dbSNP
rs949857433 602 dbSNP
rs1038053173 611 dbSNP
rs896602269 614 dbSNP
rs1056455077 615 dbSNP
rs938064186 623 dbSNP
rs941050702 624 dbSNP
rs926929936 631 dbSNP
rs565801042 635 dbSNP
rs114552165 640 dbSNP
rs1485672662 652 dbSNP
rs1182098059 655 dbSNP
rs948289894 663 dbSNP
rs1212437667 666 dbSNP
rs1255294491 671 dbSNP
rs1485328816 671 dbSNP
rs1193631717 672 dbSNP
rs1471865402 672 dbSNP
rs918120583 673 dbSNP
rs1474311548 674 dbSNP
rs1269945098 675 dbSNP
rs1167488813 677 dbSNP
rs992322422 678 dbSNP
rs1192103095 679 dbSNP
rs1426178947 682 dbSNP
rs879600794 682 dbSNP
rs956819190 685 dbSNP
rs1311189848 686 dbSNP
rs1375339992 690 dbSNP
rs1401217010 695 dbSNP
rs750055262 696 dbSNP
rs924029389 696 dbSNP
rs41315565 699 dbSNP
rs1227155878 733 dbSNP
rs968093978 734 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 25912.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ucgucGUAACAUGUCCCGAUAcu 5'
               :| | |:|  ||||||  
Target 5' --auaUAAUCUGCCAGGCUAU-- 3'
 		1 - 19
Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM4903825
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / PID14_NS
Location of target site NM_138740 | 3UTR | AAUCUGCCAGGCUAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161237
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM4903833
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_a
Location of target site NM_001098616 | 3UTR | UGAAUGUGGAAUAACUUACCUUUGUGCUCCACUUAAACCAGAUGUGUUGCAGCUUUCCUGACAUGCAAGGAUCUACUUUAAUUCCACACUCUCAUUAAUAAAUUGAAUAAAAGGGAAUGUUUUGGCACCUGAUAUAAUCUGCCAGGCUAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM4903834
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_b
Location of target site NM_001098616 | 3UTR | UGGAAUAACUUACCUUUGUGCUCCACUUAAACCAGAUGUGUUGCAGCUUUCCUGACAUGCAAGGAUCUACUUUAAUUCCACACUCUCAUUAAUAAAUUGAAUAAAAGGGAAUGUUUUGGCACCUGAUAUAAUCUGCCAGGCUAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM4903835
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_c
Location of target site NM_001098616 | 3UTR | UUACCUUUGUGCUCCACUUAAACCAGAUGUGUUGCAGCUUUCCUGACAUGCAAGGAUCUACUUUAAUUCCACACUCUCAUUAAUAAAUUGAAUAAAAGGGAAUGUUUUGGCACCUGAUAUAAUCUGCCAGGCUAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM4903836
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_a
Location of target site NM_001098616 | 3UTR | UACCUUUGUGCUCCACUUAAACCAGAUGUGUUGCAGCUUUCCUGACAUGCAAGGAUCUACUUUAAUUCCACACUCUCAUUAAUAAAUUGAAUAAAAGGGAAUGUUUUGGCACCUGAUAUAAUCUGCCAGGCUAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM4903837
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_b
Location of target site NM_001098616 | 3UTR | UGGAAUAACUUACCUUUGUGCUCCACUUAAACCAGAUGUGUUGCAGCUUUCCUGACAUGCAAGGAUCUACUUUAAUUCCACACUCUCAUUAAUAAAUUGAAUAAAAGGGAAUGUUUUGGCACCUGAUAUAAUCUGCCAGGCUAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM4903838
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_c
Location of target site NM_001098616 | 3UTR | CUUUGUGCACAGUUGAAUGGGAACUGUUUGGGUUUAGGGCAUCUUAGAGUUGAUUGAUGGAAAAAGCAGACAGGAACUGGUGGGAGGUCAAGUGGGGAAGUUGGUGAAUGUGGAAUAACUUACCUUUGUGCUCCACUUAAACCAGAUGUGUUGCAGCUUUCCUGACAUGCAAGGAUCUACUUUAAUUCCACACUCUCAUUAAUAAAUUGAAUAAAAGGGAAUGUUUUGGCACCUGAUAUAAUCUGCCAGGCUAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000368521.5 | 3UTR | AUAUAAUCUGCCAGGCUAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28260 Renal cortex and medulla -0.825 2.6e-4 -0.846 1.3e-4 13 Click to see details
GSE28544 Breast cancer -0.054 4.0e-1 0.058 3.9e-1 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
53 hsa-miR-103b Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT218386 E2F3 E2F transcription factor 3 2 2
MIRT404221 RPL7L1 ribosomal protein L7 like 1 2 2
MIRT441502 SPG20 spartin 2 6
MIRT444124 ZNRF3 zinc and ring finger 3 2 2
MIRT454236 OSBPL10 oxysterol binding protein like 10 2 4
MIRT457919 ZNF212 zinc finger protein 212 2 2
MIRT462254 LAMA4 laminin subunit alpha 4 2 2
MIRT463176 ZNF281 zinc finger protein 281 2 2
MIRT472355 TSPAN1 tetraspanin 1 2 2
MIRT474133 LIN54 lin-54 DREAM MuvB core complex component 2 4
MIRT494946 IFFO2 intermediate filament family orphan 2 2 2
MIRT497403 NPY4R neuropeptide Y receptor Y4 2 2
MIRT497641 GLDN gliomedin 2 2
MIRT505340 TMEM245 transmembrane protein 245 2 6
MIRT505680 SESTD1 SEC14 and spectrin domain containing 1 2 6
MIRT510706 SREK1IP1 SREK1 interacting protein 1 2 6
MIRT512198 C1orf43 chromosome 1 open reading frame 43 2 2
MIRT522089 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 4
MIRT525074 FRK fyn related Src family tyrosine kinase 2 2
MIRT531276 PPIL3 peptidylprolyl isomerase like 3 2 2
MIRT535119 PLXNA2 plexin A2 2 2
MIRT540836 GNAT1 G protein subunit alpha transducin 1 2 4
MIRT541018 WIPI2 WD repeat domain, phosphoinositide interacting 2 2 2
MIRT545752 CA12 carbonic anhydrase 12 2 4
MIRT546404 SRP9 signal recognition particle 9 2 2
MIRT547991 HCFC2 host cell factor C2 2 4
MIRT554502 SAE1 SUMO1 activating enzyme subunit 1 2 2
MIRT558360 DMTF1 cyclin D binding myb like transcription factor 1 2 2
MIRT558863 CD2AP CD2 associated protein 2 2
MIRT559939 ZNF567 zinc finger protein 567 2 2
MIRT566300 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 2 2
MIRT567490 FOXK1 forkhead box K1 2 2
MIRT617139 ZNF556 zinc finger protein 556 2 2
MIRT625400 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 2 2
MIRT626491 CEP89 centrosomal protein 89 2 2
MIRT629487 GSN gelsolin 2 4
MIRT638456 PLXDC2 plexin domain containing 2 2 2
MIRT648498 CMBL carboxymethylenebutenolidase homolog 2 2
MIRT654845 PPM1L protein phosphatase, Mg2+/Mn2+ dependent 1L 2 2
MIRT664587 HSD17B12 hydroxysteroid 17-beta dehydrogenase 12 2 2
MIRT664977 TDRD1 tudor domain containing 1 2 2
MIRT665028 ELK1 ELK1, ETS transcription factor 2 2
MIRT666043 STON2 stonin 2 2 2
MIRT668863 CRY2 cryptochrome circadian clock 2 2 2
MIRT669297 C17orf85 nuclear cap binding subunit 3 2 2
MIRT680975 DCAF17 DDB1 and CUL4 associated factor 17 2 2
MIRT682267 RS1 retinoschisin 1 2 2
MIRT685283 KIAA1143 KIAA1143 2 2
MIRT693375 PIGP phosphatidylinositol glycan anchor biosynthesis class P 2 2
MIRT701785 MSL1 male specific lethal 1 homolog 2 2
MIRT709373 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 2 2
MIRT715154 IL12B interleukin 12B 2 2
MIRT734499 ADAMTS5 ADAM metallopeptidase with thrombospondin type 1 motif 5 3 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-1 Anthocyanin NULL 145858 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Caffeic acid NULL 689043 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Catechin approved 9064 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-1 Curcumin NULL 969516 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Ferulic acid NULL 445858 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Hesperidin NULL 10621 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-1 Quercetin NULL 5280343 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 up-regulated
miR-1 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 down-regulated
miR-1 Trichostatin A (TSA) NULL 444732 Quantitative real-time PCR myocardial differentiation of mouse ES cells 19521018 2009 down-regulated
miR-1 Sulfonyl-hydrazone-1 (SHZ) NULL NULL Quantitative real-time PCR Murine broblast-derived Induced pluripotent stem cells 21445862 2011 up-regulated
miR-1 Cocaine NULL 446220 Next-generation sequencing ventral striatum 21708909 2011 up-regulated
miR-1 Atorvastatin approved 60823 Quantitative real-time PCR Cardiomyocyte 23860036 2013 down-regualted
miR-1 Glucose NULL 5793 Quantitative real-time PCR endothelial cells 24394957 2014 down-regulated
miR-1 Docosahexaenoic acid NULL 445580 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-1 Palmitic acid approved 985 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-1 17beta-estradiol (E2) approved 5757 Microarray MCF-7AKT breast cancer cells 19528081 2009 down-regulated
miR-1 Essential amino acids (EAA) NULL NULL Quantitative real-time PCR skeletal muscle of young adults 19828686 2009 up-regulated
miR-1 Hydrogen peroxide (H2O2) NULL 784 Quantitative real-time PCR Human umbilical vein endothelial cells 21527937 2011 down-regulated
miR-1 Trichostatin A (TSA) NULL 444732 Microarray apoptosis-resistant breast cancer cells 21971930 2011 up-regulated
miR-1 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-1 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miR-1 Bicalutamide approved 2375 Microarray prostate 22674191 2012 up-regulated
miR-1 Arsenic trioxide approved 14888 Quantitative real-time PCR cardia 22889704 2012 up-regulated
miR-1 Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-1 Quinidine approved 441074 Quantitative real-time PCR myocardial infarction (MI) rats 19775284 2009 up-regulated
miR-1 Tanshinone IIA NULL 164676 Quantitative real-time PCR myocardial infarction (MI) rats 19775284 2009 down-regulated
miR-1 Tanshinone IIA NULL 164676 Quantitative real-time PCR post-infarction rat cardiomyocytes 21220930 2011 down-regulated
miR-1 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 down-regulated
miR-1 Dexamethasone approved 5743 Microarray adrenals and granulosa cells 24205079 2014 up-regulated
miR-1 Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 up-regulated
miR-1 Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 down-regulated
miR-1 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-103b Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (BGC823)
hsa-miR-103b Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-103b Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-103b Tamoxifen+Fulvestrant sensitive cell line (LCC9)
hsa-miR-103b Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-103b Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-103b Cisplatin 5460033 NSC119875 approved resistant cell line (BGC-823)

Error report submission