>MTRNR2L3|NM_001190472|3'UTR
   1 ACAAATAAGACGAGAAAACCTTATGGAGCTTTAATTCATCAATGCAAATAAAAACTCCAACAAGCCTACAGGCCCTAGCC
  81 TCCTATCCCTGCATTAAAAATTTTGGTTGGGGTGACCTCGGAGCATAATTCAACCTCCTAACAACCTAAGACCACACAAG
 161 TCTAAGTGAGTTATTACACATCGACCCAATAATTTGATAAACGGAGTAAGTTACCCTAGGGATAACAGCGCAATCCTATA
 241 CTAGAGTCCATATCGACAATAGAGTTTACGACCTCGATGTTGGATCAGGACATCCTAATGGTGTAGCCGCTATTAAGAGT
 321 TTGTTTGTTCAATGATTAAAGTCCTATGTGATCTCAGTTCAGACCAGAGTAATCCAGGTCGGTTTCTACCTACTTAACAT
 401 TCCTCCTACTACGAAAGGACAAGAGAAATAGGGCCCACTTCATAAAGTGCCCTCACTCCATAGATGATGCCATCCCAGTC
 481 TCTTAAATCATCACACATCCTACCCAAGAACAGGGTTTGTTAAGA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' ucuccgucCAAGGACCUAGUa 5' | | :||||||| Target 5' acgacctcGATGTTGGATCAg 3'	268 - 288	145.00	-10.80
2	miRNA 3' ucuccguccAAGGACCUAGUa 5' | |||| ||:| Target 5' agcctcctaTCCCTGCATTAa 3'	77 - 97	104.00	-5.20
3	miRNA 3' ucuccGUCCAAGGACCUAGUa 5' ||| ||:| |||| Target 5' catccCAGTCTCTTAAATCAt 3'	471 - 491	96.00	-7.80

Mutant ID	Mutant Position	Mutant Source
COSN26507550	17	COSMIC
COSN26668417	37	COSMIC
COSN1250998	40	COSMIC
COSN5975245	118	COSMIC
COSN7099072	285	COSMIC
COSN29942812	418	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs370978883	2	dbSNP
rs373398511	4	dbSNP
rs529473650	5	dbSNP
rs370865382	6	dbSNP
rs376745588	7	dbSNP
rs751248475	11	dbSNP
rs763516988	12	dbSNP
rs376221259	17	dbSNP
rs1312231936	19	dbSNP
rs6070079	20	dbSNP
rs373366940	21	dbSNP
rs766254662	24	dbSNP
rs369158342	37	dbSNP
rs375885483	40	dbSNP
rs1326381479	41	dbSNP
rs1406728074	43	dbSNP
rs563525675	46	dbSNP
rs372518026	49	dbSNP
rs368736392	51	dbSNP
rs377292031	52	dbSNP
rs1441765607	54	dbSNP
rs372709331	54	dbSNP
rs373827533	59	dbSNP
rs776086157	61	dbSNP
rs1159552952	64	dbSNP
rs6099578	64	dbSNP
rs1417688598	65	dbSNP
rs6070078	66	dbSNP
rs6099577	67	dbSNP
rs368392449	73	dbSNP
rs1291271863	76	dbSNP
rs564579329	77	dbSNP
rs375416333	78	dbSNP
rs372158818	79	dbSNP
rs367975884	82	dbSNP
rs374646605	84	dbSNP
rs371517921	86	dbSNP
rs367680837	87	dbSNP
rs1408475508	88	dbSNP
rs1238381015	90	dbSNP
rs958233518	90	dbSNP
rs1396065444	91	dbSNP
rs1032683929	97	dbSNP
rs1173191732	99	dbSNP
rs374640907	104	dbSNP
rs1221555682	106	dbSNP
rs1001698880	108	dbSNP
rs370903205	113	dbSNP
rs1459179226	119	dbSNP
rs1179472821	120	dbSNP
rs545001674	121	dbSNP
rs188624435	125	dbSNP
rs376236704	126	dbSNP
rs374173049	129	dbSNP
rs370812647	130	dbSNP
rs1024409789	131	dbSNP
rs559515813	134	dbSNP
rs1172997147	137	dbSNP
rs1440071278	145	dbSNP
rs6070077	146	dbSNP
rs1013947258	147	dbSNP
rs151087931	155	dbSNP
rs1446813823	161	dbSNP
rs897063368	166	dbSNP
rs573741694	168	dbSNP
rs535522085	173	dbSNP
rs1036986830	174	dbSNP
rs1005384006	175	dbSNP
rs1357578243	179	dbSNP
rs888280651	183	dbSNP
rs1288413490	187	dbSNP
rs1049805421	189	dbSNP
rs1199310640	196	dbSNP
rs1201608029	198	dbSNP
rs1345137172	199	dbSNP
rs1189955925	202	dbSNP
rs183391348	203	dbSNP
rs536798286	206	dbSNP
rs1466081087	214	dbSNP
rs1354828103	221	dbSNP
rs1041424800	222	dbSNP
rs577877668	229	dbSNP
rs945425652	230	dbSNP
rs746233944	235	dbSNP
rs1341428027	236	dbSNP
rs867265642	239	dbSNP
rs77244255	240	dbSNP
rs142903261	245	dbSNP
rs936807363	246	dbSNP
rs1219841528	247	dbSNP
rs1277638967	250	dbSNP
rs1335324843	251	dbSNP
rs1335115775	252	dbSNP
rs1202372210	254	dbSNP
rs78716855	255	dbSNP
rs926807584	259	dbSNP
rs979853932	260	dbSNP
rs1172899403	262	dbSNP
rs746593199	262	dbSNP
rs75466433	263	dbSNP
rs1207677649	264	dbSNP
rs1265079400	269	dbSNP
rs6025513	272	dbSNP
rs1024088604	276	dbSNP
rs992898307	278	dbSNP
rs6014981	288	dbSNP
rs1478754520	295	dbSNP
rs78623528	296	dbSNP
rs1217855438	303	dbSNP
rs376578903	304	dbSNP
rs565715401	308	dbSNP
rs192052169	309	dbSNP
rs1367110450	310	dbSNP
rs535571228	312	dbSNP
rs549809812	323	dbSNP
rs888251152	323	dbSNP
rs1401107693	327	dbSNP
rs757792113	330	dbSNP
rs80103660	333	dbSNP
rs1325222711	341	dbSNP
rs74692174	347	dbSNP
rs147947065	349	dbSNP
rs1344512362	350	dbSNP
rs570025153	352	dbSNP
rs901239363	353	dbSNP
rs79644226	355	dbSNP
rs1488518043	357	dbSNP
rs74614633	366	dbSNP
rs1215785511	367	dbSNP
rs1041169272	368	dbSNP
rs145061190	370	dbSNP
rs139427701	380	dbSNP
rs113906620	381	dbSNP
rs79316607	389	dbSNP
rs1160124110	394	dbSNP
rs75670297	396	dbSNP
rs74688723	398	dbSNP
rs936944295	402	dbSNP
rs548084803	405	dbSNP
rs16985477	409	dbSNP
rs559403653	412	dbSNP
rs570767402	413	dbSNP
rs778816074	414	dbSNP
rs1353617309	415	dbSNP
rs542614562	416	dbSNP
rs960995133	420	dbSNP
rs1042381356	422	dbSNP
rs1354721795	425	dbSNP
rs945370182	428	dbSNP
rs1239114672	429	dbSNP
rs915163982	429	dbSNP
rs1283632971	432	dbSNP
rs1358313863	436	dbSNP
rs1400724305	441	dbSNP
rs989438358	444	dbSNP
rs984012743	458	dbSNP
rs1316149361	463	dbSNP
rs1449423310	470	dbSNP
rs952588761	473	dbSNP
rs1238364527	480	dbSNP
rs1438697861	484	dbSNP
rs1158358346	487	dbSNP
rs1362480283	497	dbSNP
rs373306072	498	dbSNP
rs959539815	499	dbSNP
rs6099576	500	dbSNP
rs926511922	501	dbSNP
rs369978122	502	dbSNP
rs1399883545	511	dbSNP
rs1459893852	512	dbSNP
rs1391273636	514	dbSNP
rs1390080590	515	dbSNP

- Cell, 2013

The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.

- Nature, 2013

Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.

- Breast cancer research and treatment, 2014

miRNAs regulate the expression of genes in both normal physiology and disease. While miRNAs have been demonstrated to play a pivotal role in aspects of cancer biology, these reports have generally focused on the regulation of single genes. Such single-gene approaches have significant limitations, relying on miRNA expression levels and heuristic predictions of mRNA-binding sites. This results in only circumstantial evidence of miRNA-target interaction and typically leads to large numbers of false positive predictions. Here, we used a genome-wide approach (high-throughput sequencing of RNA isolated by crosslinking immunoprecipitation, HITS-CLIP) to define direct miRNA-mRNA interactions in three breast cancer subtypes (estrogen receptor positive, Her2 amplified, and triple negative). Focusing on steroid receptor signaling, we identified two novel regulators of the ER pathway (miR-9-5p and miR-193a/b-3p), which together target multiple genes involved in ER signaling. Moreover, this approach enabled the definition of miR-9-5p as a global regulator of steroid receptor signaling in breast cancer. We show that miRNA targets and networks defined by HITS-CLIP under physiologic conditions are predictive of patient outcomes and provide global insight into miRNA regulation in breast cancer.