miRTarBase - #MIRT512418


—
pre-miRNA Information
pre-miRNA hsa-mir-6501   
Genomic Coordinates chr21: 33550662 - 33550728
Description Homo sapiens miR-6501 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-6501-5p
Sequence 3| AGUUGCCAGGGCUGCCUUUGGU |24
Evidence Experimental
Experiments Illumina
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
1055619 20 ClinVar
COSM5974214 5 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs756127353 5 dbSNP
rs764400023 6 dbSNP
rs753967693 8 dbSNP
rs1283296362 14 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol LAYN   
Synonyms -
Description layilin
Transcript NM_178834   
Expression
Putative miRNA Targets on LAYN
3'UTR of LAYN
(miRNA target sites are highlighted)		 
>LAYN|NM_178834|3'UTR
   1 GACATATAAAAAACTGAAACTGACAACAATGGAAAAGAAATGATAAGCAAAATCCTCTTATTTTCTATAAGGAAAATACA
  81 CAGAAGGTCTATGAACAAGCTTAGATCAGGTCCTGTGGATGAGCATGTGGTCCCCACGACCTCCTGTTGGACCCCCACGT
 161 TTTGGCTGTATCCTTTATCCCAGCCAGTCATCCAGCTCGACCTTATGAGAAGGTACCTTGCCCAGGTCTGGCACATAGTA
 241 GAGTCTCAATAAATGTCACTTGGTTGGTTGTATCTAACTTTTAAGGGACAGAGCTTTACCTGGCAGTGATAAAGATGGGC
 321 TGTGGAGCTTGGAAAACCACCTCTGTTTTCCTTGCTCTATACAGCAGCACATATTATCATACAGACAGAAAATCCAGAAT
 401 CTTTTCAAAGCCCACATATGGTAGCACAGGCTGGCCTGTGCATCGGCAATTCTCATATCTGTTTTTTTCAAAGAATAATA
 481 AAATCAAATAAAGAGCAGGAAACAGAGTGTTAGTCTGTGTCTACAGCCCTTCCTCTGCATGTGGCCACAGGGGACCTTTT
 561 TTTGTTTCTCCTGACATCCAGACTTGGAAATATCTAACTACTTGCAAAACTAAAAATGAGGCCAGGCGCAGTGGCTGACG
 641 CCTGTAATCCCAGAACCTTGGGAGACCAAGATTGGAGGATAGCTTGAGTTCAGGAGTTCCAGACCTTCCTGGGCAAAATA
 721 GTGAGACTCTGACTCTACAAAAAATTTAAAAATTAGCAGGGCATGGTGGCATGCGCCTGCAGTCCCAGCTACTCAGGAGG
 801 CCGAGGTGGGGGAATTGCTTGAGCCCAGGAGGTTGAGGCTGCAGTGAGCTAGGATCACGCCACTGCTCTCCTGCGTGGGC
 881 AACAGAATGAGACCCTGTCTCTAAACAAAAATATTTTTTAAAGAAACTAAAAATGAAATTTGAGTCTCAGCTTCTAGGCT
 961 TATGTACTCCCATCCCTGATACTACACGTTGTTCTGTTTGCATGTTTGTTACTGCAGCATCAACATAACATGACTAATAA
1041 TGATGACAGTTCTACCTTTTGTTGACAGACCTCATTGTTTCAATTGTGTTTGGCCTCAAATTCAGAGAAAAGTTTCTCAG
1121 CCCAGCATCAATCATATACACATTGGAGGTCTGAAAGCCATTATTTAAATCACCAGCAATTTCCCTCAATCAGCTTCATA
1201 ATCTCATATTTTAACCTTTCCTCATATGTCTTATTTTTTAATAGCTCAGCAACTTTGCTTCACATATGGAGCCCCAACCT
1281 CTAGAGT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ugGUUUCCGUCGGGACCGUUGa 5'
            ||:|| :   |||||||:: 
Target 5' gaCAGAGCTTTACCTGGCAGTg 3'
 287 - 308 128.00 -18.00
2 
miRNA  3' ugGUUUC-CGUCGGGACCGUUGa 5'
            |||||  ||  : |||:|:| 
Target 5' ttCAAAGCCCACATATGGTAGCa 3'
 404 - 426 124.00 -13.10
3 
miRNA  3' ugguuuccgucgggaCCGUUGa 5'
                         |||||| 
Target 5' ctgctctcctgcgtgGGCAACa 3'
 863 - 884 120.00 -11.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31512684 3 COSMIC
COSN31554975 56 COSMIC
COSN31559055 56 COSMIC
COSN31575373 66 COSMIC
COSN30179793 94 COSMIC
COSN5296687 138 COSMIC
COSN19454820 203 COSMIC
COSN10077973 389 COSMIC
COSN17029677 445 COSMIC
COSN21988549 446 COSMIC
COSN29460963 447 COSMIC
COSN20108741 480 COSMIC
COSN20697081 512 COSMIC
COSN31569365 564 COSMIC
COSN9030061 754 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs770233875 1 dbSNP
rs773852200 2 dbSNP
rs759317614 3 dbSNP
rs767133161 5 dbSNP
rs1421125508 8 dbSNP
rs1410076556 9 dbSNP
rs775075932 14 dbSNP
rs760276509 18 dbSNP
rs1028424497 20 dbSNP
rs763888952 21 dbSNP
rs1377487505 25 dbSNP
rs753848438 26 dbSNP
rs756974432 28 dbSNP
rs765130815 30 dbSNP
rs1366605662 31 dbSNP
rs750604198 34 dbSNP
rs1420238348 36 dbSNP
rs1215281349 37 dbSNP
rs1272602284 38 dbSNP
rs1333409752 39 dbSNP
rs1216089790 43 dbSNP
rs1169596764 46 dbSNP
rs933103821 60 dbSNP
rs533908029 63 dbSNP
rs553865881 64 dbSNP
rs1188366775 65 dbSNP
rs1486482995 66 dbSNP
rs1254959590 67 dbSNP
rs753817659 68 dbSNP
rs1437917982 71 dbSNP
rs966395480 73 dbSNP
rs566576035 77 dbSNP
rs1247302805 87 dbSNP
rs533958377 88 dbSNP
rs1004573924 95 dbSNP
rs971902797 99 dbSNP
rs1234275128 101 dbSNP
rs1357679892 105 dbSNP
rs1475220074 110 dbSNP
rs1447510218 120 dbSNP
rs549113596 127 dbSNP
rs1016329140 130 dbSNP
rs567340856 133 dbSNP
rs919114063 135 dbSNP
rs1399444317 136 dbSNP
rs898948319 139 dbSNP
rs1165468159 140 dbSNP
rs1421881317 147 dbSNP
rs181406783 149 dbSNP
rs185772962 154 dbSNP
rs369172638 159 dbSNP
rs539790110 160 dbSNP
rs1462888995 169 dbSNP
rs558409687 171 dbSNP
rs970884283 178 dbSNP
rs1436643108 185 dbSNP
rs1326015327 190 dbSNP
rs1214796533 195 dbSNP
rs752511187 196 dbSNP
rs1428000642 199 dbSNP
rs1031238521 200 dbSNP
rs1045844101 206 dbSNP
rs1281406378 210 dbSNP
rs1440109419 217 dbSNP
rs1376168326 218 dbSNP
rs1271617835 222 dbSNP
rs1326514506 227 dbSNP
rs1462908710 233 dbSNP
rs907450504 236 dbSNP
rs1400983252 240 dbSNP
rs1409699317 240 dbSNP
rs1362208507 241 dbSNP
rs1438551219 242 dbSNP
rs934933316 248 dbSNP
rs1194837954 250 dbSNP
rs1053280060 258 dbSNP
rs1292986808 264 dbSNP
rs1333349005 268 dbSNP
rs956941118 271 dbSNP
rs893266290 286 dbSNP
rs1011771094 289 dbSNP
rs1028373698 290 dbSNP
rs989532847 295 dbSNP
rs1446543952 299 dbSNP
rs1213706717 309 dbSNP
rs1443070200 311 dbSNP
rs889883684 319 dbSNP
rs1292790207 320 dbSNP
rs1244117365 328 dbSNP
rs1351462379 333 dbSNP
rs758193597 340 dbSNP
rs1156517339 351 dbSNP
rs915227872 367 dbSNP
rs1478270440 371 dbSNP
rs1186963852 372 dbSNP
rs140906743 380 dbSNP
rs540396530 388 dbSNP
rs1423684220 390 dbSNP
rs1191057464 402 dbSNP
rs386757485 410 dbSNP
rs150167238 411 dbSNP
rs138885489 412 dbSNP
rs1051576869 418 dbSNP
rs1213960798 420 dbSNP
rs542275 432 dbSNP
rs1319711278 441 dbSNP
rs746400484 445 dbSNP
rs951840382 450 dbSNP
rs142705857 451 dbSNP
rs191010525 455 dbSNP
rs1413721035 456 dbSNP
rs1312673464 457 dbSNP
rs1286869000 459 dbSNP
rs915652318 462 dbSNP
rs182725214 463 dbSNP
rs149186676 474 dbSNP
rs377335486 474 dbSNP
rs1432334599 477 dbSNP
rs373701340 477 dbSNP
rs201966266 480 dbSNP
rs551939573 496 dbSNP
rs1011886600 499 dbSNP
rs770259514 500 dbSNP
rs72645436 508 dbSNP
rs1191932348 510 dbSNP
rs775870019 529 dbSNP
rs1031122942 530 dbSNP
rs147344957 539 dbSNP
rs1488748107 543 dbSNP
rs111957205 546 dbSNP
rs956993392 550 dbSNP
rs1011579525 553 dbSNP
rs1293246534 556 dbSNP
rs1217779844 557 dbSNP
rs1049956295 566 dbSNP
rs1294763640 567 dbSNP
rs1022508977 571 dbSNP
rs964403056 572 dbSNP
rs868643367 582 dbSNP
rs1298224270 595 dbSNP
rs889855894 596 dbSNP
rs1486557127 597 dbSNP
rs1008756437 602 dbSNP
rs138041078 607 dbSNP
rs1169074808 616 dbSNP
rs1465443227 622 dbSNP
rs1418963775 626 dbSNP
rs1232298621 628 dbSNP
rs1422249280 631 dbSNP
rs149481622 632 dbSNP
rs1159804589 640 dbSNP
rs761276481 641 dbSNP
rs1481613415 642 dbSNP
rs1256082309 643 dbSNP
rs955428442 654 dbSNP
rs1433745959 657 dbSNP
rs1274772966 658 dbSNP
rs1171405549 659 dbSNP
rs376143130 665 dbSNP
rs1339490460 671 dbSNP
rs537978105 673 dbSNP
rs549842683 678 dbSNP
rs1392624471 679 dbSNP
rs1329932287 683 dbSNP
rs1376876662 695 dbSNP
rs73555172 701 dbSNP
rs1456636047 703 dbSNP
rs1026614265 705 dbSNP
rs1335275528 711 dbSNP
rs1335695287 715 dbSNP
rs371641767 716 dbSNP
rs1160018780 718 dbSNP
rs1420973283 722 dbSNP
rs1440575098 723 dbSNP
rs1281372019 724 dbSNP
rs144362375 736 dbSNP
rs1468835865 738 dbSNP
rs1254716709 740 dbSNP
rs1207834044 745 dbSNP
rs1260955694 746 dbSNP
rs1354455859 754 dbSNP
rs951995192 757 dbSNP
rs984587807 758 dbSNP
rs907706450 762 dbSNP
rs940495683 767 dbSNP
rs1446754287 771 dbSNP
rs373940944 772 dbSNP
rs761873022 775 dbSNP
rs368640023 776 dbSNP
rs969769624 779 dbSNP
rs981572175 788 dbSNP
rs1378589378 793 dbSNP
rs767666986 803 dbSNP
rs1454704633 804 dbSNP
rs1436027892 807 dbSNP
rs928423081 811 dbSNP
rs1044724026 815 dbSNP
rs955858533 816 dbSNP
rs1450837957 820 dbSNP
rs376879745 830 dbSNP
rs1238679115 833 dbSNP
rs1003246422 839 dbSNP
rs1453323811 840 dbSNP
rs1191193924 846 dbSNP
rs914819505 847 dbSNP
rs1234379886 852 dbSNP
rs186388945 858 dbSNP
rs773144328 860 dbSNP
rs572086489 875 dbSNP
rs1011044274 876 dbSNP
rs1402134884 877 dbSNP
rs1022986642 881 dbSNP
rs911364489 884 dbSNP
rs944237267 891 dbSNP
rs765262092 892 dbSNP
rs1334001512 898 dbSNP
rs1373476416 914 dbSNP
rs1378277461 914 dbSNP
rs1185803120 916 dbSNP
rs897243443 922 dbSNP
rs752599333 923 dbSNP
rs555500003 930 dbSNP
rs994566789 945 dbSNP
rs1029659773 952 dbSNP
rs1048418961 960 dbSNP
rs1486378957 960 dbSNP
rs568038 979 dbSNP
rs1199286517 983 dbSNP
rs1006124261 984 dbSNP
rs982867379 987 dbSNP
rs1015658310 988 dbSNP
rs560966833 989 dbSNP
rs1220849049 997 dbSNP
rs970273808 999 dbSNP
rs1277823398 1000 dbSNP
rs1415576721 1004 dbSNP
rs1342380470 1006 dbSNP
rs1332245700 1018 dbSNP
rs529790681 1023 dbSNP
rs1413891730 1024 dbSNP
rs1002712302 1031 dbSNP
rs1172648384 1035 dbSNP
rs973243675 1036 dbSNP
rs1463878404 1040 dbSNP
rs920538734 1041 dbSNP
rs1188256583 1044 dbSNP
rs1197307929 1050 dbSNP
rs1235296391 1051 dbSNP
rs1186209910 1053 dbSNP
rs75568536 1061 dbSNP
rs1274331090 1069 dbSNP
rs980446250 1072 dbSNP
rs756815068 1073 dbSNP
rs1234180725 1083 dbSNP
rs1254275541 1085 dbSNP
rs927637861 1093 dbSNP
rs556603336 1094 dbSNP
rs968385647 1095 dbSNP
rs577971700 1098 dbSNP
rs938988492 1100 dbSNP
rs944167282 1110 dbSNP
rs1052145777 1126 dbSNP
rs77023778 1135 dbSNP
rs560190087 1137 dbSNP
rs1406796050 1142 dbSNP
rs111561113 1144 dbSNP
rs542931374 1146 dbSNP
rs1401666640 1150 dbSNP
rs1162213321 1152 dbSNP
rs1470212895 1178 dbSNP
rs1461325272 1183 dbSNP
rs1323996504 1185 dbSNP
rs900117233 1186 dbSNP
rs1234069818 1188 dbSNP
rs1392915319 1190 dbSNP
rs1387390528 1194 dbSNP
rs997105015 1202 dbSNP
rs1323808133 1207 dbSNP
rs1295182649 1208 dbSNP
rs561111714 1224 dbSNP
rs1048370202 1228 dbSNP
rs1029880101 1245 dbSNP
rs142382974 1249 dbSNP
rs1334092099 1250 dbSNP
rs549647175 1258 dbSNP
rs146398816 1267 dbSNP
rs1347846042 1268 dbSNP
rs1322505155 1270 dbSNP
rs1004193115 1278 dbSNP
rs1381674900 1279 dbSNP
rs1156286678 1282 dbSNP
rs1274539947 1285 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293
Disease 143903.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "HITS-CLIP data was present in GSM714642. RNA binding protein: AGO2. Condition:completeT1 "HITS-CLIP data was present in GSM714643. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ugguuuccgucgggaCCGUUGa 5'
                         |||||| 
Target 5' ------------cugGGCAACa 3'
 		1 - 10
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 143903.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM714642
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000525126.1 | 3UTR | UGGGCAACAUAACGAGACCCCGUCUCUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714643
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000525126.1 | 3UTR | CUGGGCAACAUAACGAGACCCCGUCUCUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1065668
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_7
Location of target site ENST00000525126.1 | 3UTR | CAACAUAACGAGACCCCGUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
167 hsa-miR-6501-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT156859 FAM126B family with sequence similarity 126 member B 2 2
MIRT173355 TP53INP1 tumor protein p53 inducible nuclear protein 1 2 2
MIRT369102 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 2
MIRT442037 TRPV2 transient receptor potential cation channel subfamily V member 2 2 2
MIRT442829 AZIN1 antizyme inhibitor 1 2 2
MIRT443729 CCND2 cyclin D2 2 2
MIRT453771 NUCB1 nucleobindin 1 2 10
MIRT453875 IFRD1 interferon related developmental regulator 1 2 12
MIRT454229 OSBPL10 oxysterol binding protein like 10 2 11
MIRT458829 RPUSD2 RNA pseudouridylate synthase domain containing 2 2 2
MIRT459898 PIGO phosphatidylinositol glycan anchor biosynthesis class O 2 10
MIRT464162 VMP1 vacuole membrane protein 1 2 15
MIRT495411 SMAD2 SMAD family member 2 2 2
MIRT496906 TRIM56 tripartite motif containing 56 2 2
MIRT498653 AP3B2 adaptor related protein complex 3 beta 2 subunit 2 6
MIRT498706 PGAM5 PGAM family member 5, mitochondrial serine/threonine protein phosphatase 2 10
MIRT499308 ZNF485 zinc finger protein 485 2 6
MIRT499707 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 2 10
MIRT499755 CIRH1A UTP4, small subunit processome component 2 6
MIRT499827 PCSK9 proprotein convertase subtilisin/kexin type 9 2 8
MIRT503691 MAVS mitochondrial antiviral signaling protein 2 2
MIRT512418 LAYN layilin 2 4
MIRT516232 RAB3B RAB3B, member RAS oncogene family 2 2
MIRT522554 MCAM melanoma cell adhesion molecule 2 4
MIRT523760 FBXO27 F-box protein 27 2 4
MIRT525107 PRKD2 protein kinase D2 2 2
MIRT525919 KIAA0391 KIAA0391 2 2
MIRT527246 COMMD6 COMM domain containing 6 2 2
MIRT527564 ADCY7 adenylate cyclase 7 2 2
MIRT528764 CD1D CD1d molecule 2 2
MIRT529362 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 2 4
MIRT529464 ZNF546 zinc finger protein 546 2 2
MIRT530676 CHRNB1 cholinergic receptor nicotinic beta 1 subunit 2 4
MIRT531635 C19orf52 translocase of inner mitochondrial membrane 29 2 4
MIRT531909 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 2 2
MIRT532172 SEC14L5 SEC14 like lipid binding 5 2 4
MIRT534234 SLC25A16 solute carrier family 25 member 16 2 4
MIRT534561 RRAGD Ras related GTP binding D 2 2
MIRT534971 PSD3 pleckstrin and Sec7 domain containing 3 2 2
MIRT536738 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT538544 CELF1 CUGBP Elav-like family member 1 2 2
MIRT540462 ZNF71 zinc finger protein 71 2 2
MIRT540554 PPIC peptidylprolyl isomerase C 2 2
MIRT543593 KIAA1549 KIAA1549 2 2
MIRT543963 RNF20 ring finger protein 20 2 2
MIRT544047 C9orf64 chromosome 9 open reading frame 64 2 2
MIRT544670 AP1S1 adaptor related protein complex 1 sigma 1 subunit 2 2
MIRT550665 TRAF1 TNF receptor associated factor 1 2 2
MIRT558540 CSNK1G3 casein kinase 1 gamma 3 2 4
MIRT574917 Vmp1 vacuole membrane protein 1 2 9
MIRT575298 Osbpl10 oxysterol binding protein-like 10 2 7
MIRT607960 SNX22 sorting nexin 22 2 2
MIRT610649 TIPRL TOR signaling pathway regulator 2 8
MIRT615899 GATAD1 GATA zinc finger domain containing 1 2 2
MIRT617438 CCS copper chaperone for superoxide dismutase 2 2
MIRT617510 C5orf45 MRN complex interacting protein 2 2
MIRT617548 MTO1 mitochondrial tRNA translation optimization 1 2 2
MIRT620565 WBSCR27 methyltransferase like 27 2 2
MIRT623166 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 2 2
MIRT624161 DGKE diacylglycerol kinase epsilon 2 2
MIRT626090 MKLN1 muskelin 1 2 2
MIRT627010 FIG4 FIG4 phosphoinositide 5-phosphatase 2 2
MIRT627073 SF3A1 splicing factor 3a subunit 1 2 2
MIRT627136 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 2 2
MIRT627340 TSHZ2 teashirt zinc finger homeobox 2 2 2
MIRT627436 TAS2R5 taste 2 receptor member 5 2 2
MIRT628273 CYB5D1 cytochrome b5 domain containing 1 2 2
MIRT629091 F2RL1 F2R like trypsin receptor 1 2 4
MIRT629282 UNC13A unc-13 homolog A 2 2
MIRT630122 ARHGEF5 Rho guanine nucleotide exchange factor 5 2 2
MIRT630247 SMTNL2 smoothelin like 2 2 2
MIRT631260 CENPM centromere protein M 2 2
MIRT631336 CD300E CD300e molecule 2 2
MIRT631399 IL2RA interleukin 2 receptor subunit alpha 2 2
MIRT632593 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT632991 DUSP18 dual specificity phosphatase 18 2 2
MIRT633079 CXorf21 chromosome X open reading frame 21 2 2
MIRT634223 TMEM132B transmembrane protein 132B 2 2
MIRT635046 MYH11 myosin heavy chain 11 2 2
MIRT636444 LRCH3 leucine rich repeats and calponin homology domain containing 3 2 2
MIRT636649 CDK4 cyclin dependent kinase 4 2 2
MIRT637129 BAMBI BMP and activin membrane bound inhibitor 2 2
MIRT637282 IBA57 IBA57 homolog, iron-sulfur cluster assembly 2 2
MIRT637527 RGS9BP regulator of G protein signaling 9 binding protein 2 2
MIRT637783 OLA1 Obg like ATPase 1 2 2
MIRT637920 LILRA2 leukocyte immunoglobulin like receptor A2 2 2
MIRT638238 SLC1A5 solute carrier family 1 member 5 2 2
MIRT638444 PLXDC2 plexin domain containing 2 2 2
MIRT639765 GPR45 G protein-coupled receptor 45 2 2
MIRT640437 ERVMER34-1 endogenous retrovirus group MER34 member 1, envelope 2 2
MIRT643006 ZNF829 zinc finger protein 829 2 2
MIRT644233 SLC35E3 solute carrier family 35 member E3 2 2
MIRT644661 TMCO1 transmembrane and coiled-coil domains 1 2 2
MIRT644957 ATP6AP1L ATPase H+ transporting accessory protein 1 like 2 2
MIRT645086 SLC35E2B solute carrier family 35 member E2B 2 2
MIRT645256 DFFA DNA fragmentation factor subunit alpha 2 2
MIRT645861 GBP6 guanylate binding protein family member 6 2 2
MIRT645987 ACP6 acid phosphatase 6, lysophosphatidic 2 2
MIRT646502 FAM217B family with sequence similarity 217 member B 2 2
MIRT646811 COX19 COX19, cytochrome c oxidase assembly factor 2 2
MIRT647706 NFX1 nuclear transcription factor, X-box binding 1 2 2
MIRT649657 TEP1 telomerase associated protein 1 2 2
MIRT650550 YIPF4 Yip1 domain family member 4 2 2
MIRT650785 GSR glutathione-disulfide reductase 2 2
MIRT651461 XIAP X-linked inhibitor of apoptosis 2 2
MIRT652098 TRUB2 TruB pseudouridine synthase family member 2 2 2
MIRT654117 RPS6KA5 ribosomal protein S6 kinase A5 2 2
MIRT658901 DPY19L4 dpy-19 like 4 2 2
MIRT659370 CREG2 cellular repressor of E1A stimulated genes 2 2 2
MIRT662537 MTAP methylthioadenosine phosphorylase 2 2
MIRT662617 MCM8 minichromosome maintenance 8 homologous recombination repair factor 2 2
MIRT663491 IYD iodotyrosine deiodinase 2 2
MIRT663899 MRI1 methylthioribose-1-phosphate isomerase 1 2 2
MIRT664552 MKI67IP nucleolar protein interacting with the FHA domain of MKI67 1 1
MIRT664582 HSD17B12 hydroxysteroid 17-beta dehydrogenase 12 2 2
MIRT664953 PTCD3 pentatricopeptide repeat domain 3 2 2
MIRT665193 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 2 2
MIRT665446 WDR17 WD repeat domain 17 2 2
MIRT665894 TCEANC2 transcription elongation factor A N-terminal and central domain containing 2 2 2
MIRT666480 SBNO1 strawberry notch homolog 1 2 2
MIRT666514 RNF170 ring finger protein 170 2 2
MIRT666692 RBM23 RNA binding motif protein 23 2 2
MIRT666791 PSMD1 proteasome 26S subunit, non-ATPase 1 2 2
MIRT667453 MAPK14 mitogen-activated protein kinase 14 2 2
MIRT667553 LRAT lecithin retinol acyltransferase 2 4
MIRT667744 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 2 2
MIRT668080 GMEB1 glucocorticoid modulatory element binding protein 1 2 2
MIRT668114 GK5 glycerol kinase 5 (putative) 2 2
MIRT668501 ESYT2 extended synaptotagmin 2 2 2
MIRT668942 CNKSR3 CNKSR family member 3 2 2
MIRT670408 ELP2 elongator acetyltransferase complex subunit 2 2 2
MIRT671134 CD226 CD226 molecule 2 2
MIRT671919 PLEKHS1 pleckstrin homology domain containing S1 2 4
MIRT672287 GP2 glycoprotein 2 2 2
MIRT672427 POLR2D RNA polymerase II subunit D 2 2
MIRT672762 UBE2V2 ubiquitin conjugating enzyme E2 V2 2 2
MIRT672923 LRRC2 leucine rich repeat containing 2 2 2
MIRT673150 C1orf50 chromosome 1 open reading frame 50 2 2
MIRT673309 UBE2G2 ubiquitin conjugating enzyme E2 G2 2 2
MIRT673560 PLA2G16 phospholipase A2 group XVI 2 2
MIRT673895 DCTN6 dynactin subunit 6 2 2
MIRT674513 PRR23A proline rich 23A 2 2
MIRT674614 RBBP4 RB binding protein 4, chromatin remodeling factor 2 2
MIRT674747 SLC16A1 solute carrier family 16 member 1 2 2
MIRT675693 PIWIL1 piwi like RNA-mediated gene silencing 1 2 2
MIRT675890 SNAP29 synaptosome associated protein 29 2 2
MIRT685271 KIAA1143 KIAA1143 2 2
MIRT686057 KCNA7 potassium voltage-gated channel subfamily A member 7 2 2
MIRT693886 C3orf62 chromosome 3 open reading frame 62 2 2
MIRT695594 TMEM199 transmembrane protein 199 2 2
MIRT696592 ORMDL2 ORMDL sphingolipid biosynthesis regulator 2 2 2
MIRT698041 TRPM7 transient receptor potential cation channel subfamily M member 7 2 2
MIRT699907 RUNDC1 RUN domain containing 1 2 2
MIRT706608 CYB5B cytochrome b5 type B 2 2
MIRT706628 PNPT1 polyribonucleotide nucleotidyltransferase 1 2 2
MIRT706640 NCBP2 nuclear cap binding protein subunit 2 2 2
MIRT706676 COL13A1 collagen type XIII alpha 1 chain 2 2
MIRT706723 RFK riboflavin kinase 2 2
MIRT706857 MAFF MAF bZIP transcription factor F 2 2
MIRT706891 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 2 2
MIRT706958 FANCC Fanconi anemia complementation group C 2 2
MIRT706976 XPO5 exportin 5 2 2
MIRT707010 RRP36 ribosomal RNA processing 36 2 2
MIRT707028 ACTR5 ARP5 actin related protein 5 homolog 2 2
MIRT707068 MED29 mediator complex subunit 29 2 2
MIRT713253 ZFP30 ZFP30 zinc finger protein 2 2
MIRT719130 NR2F6 nuclear receptor subfamily 2 group F member 6 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-6501 Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-6501 Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-6501-5p Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-6501-5p Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-6501-5p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-6501-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-6501-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-6501-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-6501-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-6501-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-6501-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-6501-5p Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)

Error report submission