miRTarBase - #MIRT513021


—
pre-miRNA Information
pre-miRNA hsa-mir-4667   
Genomic Coordinates chr9: 35608094 - 35608159
Description Homo sapiens miR-4667 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4667-3p
Sequence 46| UCCCUCCUUCUGUCCCCACAG |66
Evidence Experimental
Experiments Illumina
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSM9588049 20 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs774051936 3 dbSNP
rs1178819936 5 dbSNP
rs1467653371 6 dbSNP
rs770405488 6 dbSNP
rs776175657 7 dbSNP
rs370758546 11 dbSNP
rs1341648855 13 dbSNP
rs1023852947 14 dbSNP
rs374809971 19 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol NSFL1C   
Synonyms P47, UBX1, UBXD10, UBXN2C, dJ776F14.1
Description NSFL1 cofactor
Transcript NM_016143   
Other Transcripts NM_018839   
Expression
Putative miRNA Targets on NSFL1C
3'UTR of NSFL1C
(miRNA target sites are highlighted)		 
>NSFL1C|NM_016143|3'UTR
   1 CCGCCCAGCCAGCTGCCTGGCCTCCCTCCTGTGTTTCCCATGGCCAGTGGCCATGCCCCATGGGGATCGCCCCTCCTGCC
  81 CCCTTGTGCACACCCAGCAGTCCAGTGCAACGTCTCCTCCATAGCTCTGGGTTCTTAGATCTTGGTTGGACGTTTGTTTT
 161 CTCCTTAGTTGCATTTCCTGGGTTTTTGTGATGATCAATGGACTTTAATGAAAAAAAAAATAAAAACAACCAAAAAAATT
 241 GAAGGAATATCACCAGCATGTTGTACGGAAACTCTCCCACTGAAGCAGGCTTTAATTGCTTTAAAATTATATTTATCTTG
 321 GGGCCTGTGGGAGGAAACTTCCTTCCATCTTCTCTGCATAAAAACTTGTGGCACACAATGCTTATTCACTAGTGTGTCCC
 401 ACCCGCCAGCCCCACAGATGACTGGAGGAAGGAGGGGAAATGTGTAGAAAGAGGCTTCGCCACCACTTGTTCCCACGAGA
 481 ATATGTCACTTGCCCAGATAAAACTGGGCGGCAGCCAGAGTTCCCTGAAGTGGGAAGTCAGAGCTCCATGCACACAGTGT
 561 CTTCAGAAGGTGAAAATAAATATTTCCCTGTGCTCCTTTTACTCAACCCCTGGGGTATCTAATCTTGCCAGGTCTTGGCC
 641 AGTTGAGATTCTGTTCCACCTGCCTGCCTGGCCCTTTCCTCCATTACCATCCAGACTGCTCGCCTCCTGGGGATTCTCAG
 721 GGGCTCCATTATGGCTTGATTTACTCCACGTGCAGAAGTCTTGAGTGGACCTAGGAGGTAGGTGGGATATTTTTTTTCAC
 801 TAGGATACAGCTCATGCCAACCCATCCTAAGTGAGTTCAGAATCAGGGTATCTTGCCCTATAAGATAAACAGTCAAAATG
 881 CCACCGAGCTGTTCACTAGTGATGTGTGGCAAATCAAATCAACTGTTGAAGAAGGGGTGAGTTTTCTGTGCTACAAGCAC
 961 CTGTCACTGTTGGTACTTGCAGGAGGCTTCTGCTGGGTATGTTTTGGAAGTGAGTGTCACTACTTGGCTTTGCTTAGCAG
1041 GTTCTGCTTCACACTTGTTCTTTGACCTGCTGACTTGTGACTTGCAGAAACATAGGCAGTAGTCCTAGCCTGGTAAAGAC
1121 CCTCCACCACCCCTATAAGTTTGATTGCTATGCAGGTTTGGGAGAGGAGGCCTATTGGGCTCTTGGATGGAACCCTTTCC
1201 CGTATTAAACAAACCAGAGACAGAATCAGTGCTGACTCAGGATCTCCTGGTTTGGAATCGTAATGTGCCTCAATCCTCTT
1281 TCCAAGCAGGCCTCACCAGTCTCTTTCTCTTTCCTGCTTCACCCCTGCAATGAGCCAAGAACCAACACTACATCCACCTA
1361 GAACTGCAGAAGGGCTTGTGGTTTCAACCAAGACCCATCCTGAGCAAGGGACTTGGCTTGGTGCTTTTGATCCCAAAGTT
1441 CCCACACCGGCAGTGGCCTGCTGGGGCAATGGCATCTGTCACGGTGTTTTCTCCAGCAGGTGGAGATTATGGAACCTACA
1521 TATGGGTCTGGAAAAACTGTACACTGTTGTCACCTTGACCATTAAAAACCAGAATGAGGACAATGGA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gacaccCCUGUCUUCCUCCCu 5'
                ||| :||||||||| 
Target 5' atgactGGA-GGAAGGAGGGg 3'
 418 - 437 158.00 -21.60
2 
miRNA  3' gaCACCCCUG-UCUUCCUCCcu 5'
            || || ||  | ||||||  
Target 5' ctGTTGGTACTTGCAGGAGGct 3'
 967 - 988 135.00 -15.40
3 
miRNA  3' gacACCCCUGUCUUCCUCCcu 5'
             | ||||   :||||||  
Target 5' ggtTTGGGA---GAGGAGGcc 3'
 1155 - 1172 131.00 -15.34
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30467167 2 COSMIC
COSN30134815 3 COSMIC
COSN30458983 25 COSMIC
COSN30492627 51 COSMIC
COSN30478424 62 COSMIC
COSN30500294 69 COSMIC
COSN31499708 70 COSMIC
COSN30190098 78 COSMIC
COSN18743242 91 COSMIC
COSN30494769 97 COSMIC
COSN18743391 100 COSMIC
COSN9396035 111 COSMIC
COSN30497460 125 COSMIC
COSN27270749 210 COSMIC
COSN30001297 506 COSMIC
COSN26249610 574 COSMIC
COSN23350130 872 COSMIC
COSN25784314 930 COSMIC
COSN16328260 998 COSMIC
COSN1865216 1007 COSMIC
COSN32065251 1027 COSMIC
COSN17076271 1277 COSMIC
COSN32064959 1369 COSMIC
COSN31961815 1483 COSMIC
COSN15436987 1511 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs746799852 2 dbSNP
rs1359186815 3 dbSNP
rs1169195227 5 dbSNP
rs1428347813 10 dbSNP
rs1277519659 15 dbSNP
rs372893417 17 dbSNP
rs1228352673 19 dbSNP
rs758353232 21 dbSNP
rs1372029657 22 dbSNP
rs1444333646 24 dbSNP
rs752599735 27 dbSNP
rs1183775099 28 dbSNP
rs1483712390 29 dbSNP
rs1292767298 31 dbSNP
rs367632040 40 dbSNP
rs1037200835 43 dbSNP
rs1202568139 44 dbSNP
rs1339968824 47 dbSNP
rs745591457 54 dbSNP
rs151293535 60 dbSNP
rs1483640630 65 dbSNP
rs1204304358 69 dbSNP
rs142406814 74 dbSNP
rs1423074274 79 dbSNP
rs890763739 82 dbSNP
rs6110021 83 dbSNP
rs953819545 86 dbSNP
rs1169873103 87 dbSNP
rs6891 91 dbSNP
rs977038723 93 dbSNP
rs1363605789 94 dbSNP
rs1360745686 95 dbSNP
rs966517699 97 dbSNP
rs1316000717 103 dbSNP
rs1382236285 105 dbSNP
rs1299866010 110 dbSNP
rs945758345 111 dbSNP
rs892919387 112 dbSNP
rs1271486455 116 dbSNP
rs1010683900 120 dbSNP
rs1054287345 121 dbSNP
rs937210556 125 dbSNP
rs186535074 126 dbSNP
rs371776668 128 dbSNP
rs957476851 141 dbSNP
rs770480323 144 dbSNP
rs1190079829 146 dbSNP
rs1203576899 149 dbSNP
rs981737153 151 dbSNP
rs529816701 152 dbSNP
rs1166160662 168 dbSNP
rs907864113 175 dbSNP
rs565469528 182 dbSNP
rs1033490943 188 dbSNP
rs1225148808 196 dbSNP
rs1001558835 197 dbSNP
rs779234356 198 dbSNP
rs905826150 209 dbSNP
rs1237771501 210 dbSNP
rs1384708644 211 dbSNP
rs1024563064 217 dbSNP
rs1014555335 221 dbSNP
rs1451739264 221 dbSNP
rs3215612 221 dbSNP
rs1224528815 222 dbSNP
rs1262958963 224 dbSNP
rs1357527843 231 dbSNP
rs1210275121 240 dbSNP
rs1320310454 245 dbSNP
rs1401333039 247 dbSNP
rs952123119 255 dbSNP
rs1261993113 256 dbSNP
rs1445921714 260 dbSNP
rs897404532 261 dbSNP
rs1248407894 263 dbSNP
rs149208204 265 dbSNP
rs1037230281 266 dbSNP
rs965198338 267 dbSNP
rs888221239 274 dbSNP
rs1161735224 275 dbSNP
rs1385854539 277 dbSNP
rs965205960 278 dbSNP
rs532024952 287 dbSNP
rs1333361123 290 dbSNP
rs1386190466 295 dbSNP
rs1049913205 296 dbSNP
rs1283192705 302 dbSNP
rs371913911 309 dbSNP
rs932341595 315 dbSNP
rs1260960836 316 dbSNP
rs1349444661 321 dbSNP
rs1183523719 323 dbSNP
rs146633910 327 dbSNP
rs1490363857 328 dbSNP
rs1235268194 330 dbSNP
rs976441553 332 dbSNP
rs1266678737 334 dbSNP
rs902789394 335 dbSNP
rs1473452636 340 dbSNP
rs1019948506 341 dbSNP
rs1364619438 345 dbSNP
rs1009938874 351 dbSNP
rs945326879 353 dbSNP
rs892888755 354 dbSNP
rs913804938 363 dbSNP
rs1447073019 364 dbSNP
rs1393048047 365 dbSNP
rs755520473 368 dbSNP
rs1364190614 369 dbSNP
rs957840601 369 dbSNP
rs1308109111 374 dbSNP
rs1412092147 374 dbSNP
rs1335516351 377 dbSNP
rs1033105558 381 dbSNP
rs1285576265 382 dbSNP
rs1054574147 385 dbSNP
rs749545591 392 dbSNP
rs905669483 396 dbSNP
rs1021085726 397 dbSNP
rs987775739 401 dbSNP
rs1289515445 404 dbSNP
rs970166321 405 dbSNP
rs1045593819 407 dbSNP
rs1024762270 408 dbSNP
rs1417070711 413 dbSNP
rs1180016518 418 dbSNP
rs772386738 423 dbSNP
rs1245175814 424 dbSNP
rs949958647 426 dbSNP
rs1162956172 428 dbSNP
rs543367679 437 dbSNP
rs1432217218 440 dbSNP
rs1380527340 446 dbSNP
rs780533458 451 dbSNP
rs531127697 455 dbSNP
rs1335784637 456 dbSNP
rs983416272 459 dbSNP
rs1244625739 470 dbSNP
rs1312228116 473 dbSNP
rs563983357 475 dbSNP
rs920616789 476 dbSNP
rs542472913 477 dbSNP
rs1250691048 482 dbSNP
rs3171292 485 dbSNP
rs199852286 487 dbSNP
rs1201911737 489 dbSNP
rs1245224061 493 dbSNP
rs1005736706 495 dbSNP
rs964840135 496 dbSNP
rs1183194716 501 dbSNP
rs1426718518 502 dbSNP
rs1366620362 503 dbSNP
rs181844185 504 dbSNP
rs1019511077 508 dbSNP
rs987664893 509 dbSNP
rs966943116 510 dbSNP
rs1187597944 512 dbSNP
rs569225048 517 dbSNP
rs900911917 524 dbSNP
rs750722504 525 dbSNP
rs956992302 536 dbSNP
rs13063 546 dbSNP
rs1001674235 550 dbSNP
rs190902224 552 dbSNP
rs751714535 557 dbSNP
rs558694787 568 dbSNP
rs566938461 570 dbSNP
rs1305649668 574 dbSNP
rs1235185468 575 dbSNP
rs989325700 576 dbSNP
rs1322536591 587 dbSNP
rs1014082873 590 dbSNP
rs886278498 593 dbSNP
rs1047606720 595 dbSNP
rs1292020544 601 dbSNP
rs1241523935 603 dbSNP
rs930572732 606 dbSNP
rs3088080 615 dbSNP
rs1039057394 618 dbSNP
rs1427212945 620 dbSNP
rs115495907 621 dbSNP
rs970577758 624 dbSNP
rs1275103921 627 dbSNP
rs1215029452 630 dbSNP
rs912014280 634 dbSNP
rs1339948986 637 dbSNP
rs1276344935 639 dbSNP
rs1346544229 641 dbSNP
rs1407022473 642 dbSNP
rs762955764 643 dbSNP
rs1287741571 645 dbSNP
rs1346445725 648 dbSNP
rs185358664 651 dbSNP
rs1302772785 658 dbSNP
rs1434831154 664 dbSNP
rs1356578582 666 dbSNP
rs752432406 671 dbSNP
rs144557683 678 dbSNP
rs961339388 684 dbSNP
rs368922093 685 dbSNP
rs1221388361 693 dbSNP
rs1261510061 694 dbSNP
rs373654071 697 dbSNP
rs1318906744 700 dbSNP
rs1216622842 701 dbSNP
rs1033079584 702 dbSNP
rs1484919869 707 dbSNP
rs1001244164 712 dbSNP
rs1270149071 716 dbSNP
rs1422317584 722 dbSNP
rs1197655963 730 dbSNP
rs547141034 731 dbSNP
rs1167976875 732 dbSNP
rs1409756914 734 dbSNP
rs970211265 735 dbSNP
rs1024840804 738 dbSNP
rs1419344175 740 dbSNP
rs1342987429 743 dbSNP
rs1481113702 743 dbSNP
rs1426001309 745 dbSNP
rs538359158 749 dbSNP
rs1024019676 750 dbSNP
rs1015859544 752 dbSNP
rs1013969747 754 dbSNP
rs1269243305 758 dbSNP
rs886247244 764 dbSNP
rs1005766153 769 dbSNP
rs1047569847 787 dbSNP
rs756131744 789 dbSNP
rs796937937 798 dbSNP
rs1224590763 807 dbSNP
rs997008307 808 dbSNP
rs994692602 813 dbSNP
rs1315205978 814 dbSNP
rs1224743588 822 dbSNP
rs899110275 825 dbSNP
rs6110018 827 dbSNP
rs1039436440 837 dbSNP
rs1487390959 837 dbSNP
rs1040743261 838 dbSNP
rs74741643 844 dbSNP
rs549536899 850 dbSNP
rs1470711371 852 dbSNP
rs531317319 857 dbSNP
rs892093111 860 dbSNP
rs3210915 861 dbSNP
rs936620137 867 dbSNP
rs945456067 869 dbSNP
rs914054781 876 dbSNP
rs776222785 881 dbSNP
rs1300859170 885 dbSNP
rs958524441 886 dbSNP
rs1045323717 894 dbSNP
rs1441200403 896 dbSNP
rs3171290 896 dbSNP
rs1248303785 902 dbSNP
rs1315870769 910 dbSNP
rs139072640 912 dbSNP
rs981434904 913 dbSNP
rs146193043 922 dbSNP
rs1438761547 930 dbSNP
rs1023941611 932 dbSNP
rs559993398 934 dbSNP
rs1230839729 935 dbSNP
rs1446479937 937 dbSNP
rs760118110 940 dbSNP
rs992511312 941 dbSNP
rs1183785306 956 dbSNP
rs1339260041 957 dbSNP
rs1442225545 959 dbSNP
rs541604019 961 dbSNP
rs1169644205 962 dbSNP
rs772780316 967 dbSNP
rs961369232 980 dbSNP
rs908581635 983 dbSNP
rs984129271 994 dbSNP
rs1454830372 995 dbSNP
rs953104486 997 dbSNP
rs1026089798 1006 dbSNP
rs1429311046 1006 dbSNP
rs1272441151 1007 dbSNP
rs1028552736 1010 dbSNP
rs994711945 1013 dbSNP
rs1256601068 1014 dbSNP
rs1326073548 1017 dbSNP
rs1409922320 1037 dbSNP
rs577288223 1038 dbSNP
rs1459594515 1042 dbSNP
rs965542010 1046 dbSNP
rs1457132377 1050 dbSNP
rs749862385 1057 dbSNP
rs1184685999 1063 dbSNP
rs1236341891 1065 dbSNP
rs1431243566 1065 dbSNP
rs1470124709 1068 dbSNP
rs1177428767 1080 dbSNP
rs1405552246 1084 dbSNP
rs1412856008 1089 dbSNP
rs1007897365 1093 dbSNP
rs1205418501 1104 dbSNP
rs1320319907 1108 dbSNP
rs763359937 1120 dbSNP
rs1461827791 1124 dbSNP
rs780259212 1124 dbSNP
rs1430699487 1127 dbSNP
rs565358519 1128 dbSNP
rs746266590 1132 dbSNP
rs1224432961 1133 dbSNP
rs1009311706 1135 dbSNP
rs1342389957 1137 dbSNP
rs781515800 1149 dbSNP
rs115906937 1150 dbSNP
rs1214450116 1170 dbSNP
rs533991711 1172 dbSNP
rs1053957695 1174 dbSNP
rs1375134231 1176 dbSNP
rs180695708 1179 dbSNP
rs940119330 1181 dbSNP
rs1453927173 1187 dbSNP
rs149683952 1192 dbSNP
rs926793966 1193 dbSNP
rs952716357 1196 dbSNP
rs981020760 1199 dbSNP
rs949690146 1200 dbSNP
rs921524867 1201 dbSNP
rs536142281 1202 dbSNP
rs1346643040 1214 dbSNP
rs753130269 1215 dbSNP
rs1279769962 1228 dbSNP
rs1349340397 1231 dbSNP
rs1213754165 1240 dbSNP
rs1490480927 1241 dbSNP
rs1438865142 1244 dbSNP
rs1378176322 1245 dbSNP
rs992480228 1246 dbSNP
rs751527901 1260 dbSNP
rs1019775012 1267 dbSNP
rs1184329850 1273 dbSNP
rs1364534559 1279 dbSNP
rs950461276 1279 dbSNP
rs1156875885 1280 dbSNP
rs1387134326 1287 dbSNP
rs1026058618 1290 dbSNP
rs1255356860 1295 dbSNP
rs1389114715 1301 dbSNP
rs567240665 1303 dbSNP
rs973563144 1304 dbSNP
rs1198840788 1306 dbSNP
rs1316584613 1307 dbSNP
rs1486886602 1307 dbSNP
rs1359504899 1308 dbSNP
rs879432183 1311 dbSNP
rs963208409 1311 dbSNP
rs1017868388 1318 dbSNP
rs1341215975 1322 dbSNP
rs1196098732 1324 dbSNP
rs1251541572 1325 dbSNP
rs1421015658 1327 dbSNP
rs1261592131 1330 dbSNP
rs754766188 1346 dbSNP
rs1245104956 1347 dbSNP
rs1351969873 1350 dbSNP
rs1007452597 1369 dbSNP
rs1317565411 1374 dbSNP
rs1445311481 1375 dbSNP
rs890406320 1387 dbSNP
rs1247375762 1395 dbSNP
rs1164701644 1406 dbSNP
rs777979050 1409 dbSNP
rs571966074 1412 dbSNP
rs1030329607 1417 dbSNP
rs1168815773 1427 dbSNP
rs1311172618 1429 dbSNP
rs1000951612 1430 dbSNP
rs1444184426 1434 dbSNP
rs1393860242 1442 dbSNP
rs904821496 1443 dbSNP
rs1023976424 1448 dbSNP
rs1009610977 1449 dbSNP
rs892475882 1456 dbSNP
rs1176768721 1459 dbSNP
rs76434628 1465 dbSNP
rs190043604 1469 dbSNP
rs758257612 1472 dbSNP
rs1315823788 1474 dbSNP
rs940486037 1479 dbSNP
rs905338441 1481 dbSNP
rs139525846 1482 dbSNP
rs1461841628 1483 dbSNP
rs949647132 1493 dbSNP
rs1048442319 1499 dbSNP
rs931311006 1510 dbSNP
rs150549584 1520 dbSNP
rs1423419862 1523 dbSNP
rs921316970 1525 dbSNP
rs975812510 1531 dbSNP
rs116233763 1532 dbSNP
rs912797656 1539 dbSNP
rs988287675 1541 dbSNP
rs1363426476 1542 dbSNP
rs752733236 1543 dbSNP
rs537485421 1548 dbSNP
rs1294765892 1552 dbSNP
rs1338151926 1553 dbSNP
rs1225062513 1560 dbSNP
rs992449312 1561 dbSNP
rs928934577 1571 dbSNP
rs918931252 1583 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545213. RNA binding protein: AGO2. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gacaccCCUGUCUUCCUCCCu 5'
                ||| :||||||||| 
Target 5' ---acuGGA-GGAAGGAGGGg 3'
 		1 - 17
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 55968.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gacaccCCUGUCUUCCUCCCu 5'
                ||| :||||||||| 
Target 5' --gacuGGA-GGAAGGAGGGg 3'
 		1 - 18
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 55968.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM4903825
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / PID14_NS
Location of target site NM_001206736 | 3UTR | AGGAAGGAGGGGAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161237
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545213
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / Control
Location of target site ENST00000353088.2 | 3UTR | ACUGGAGGAAGGAGGGGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000353088.2 | 3UTR | GACUGGAGGAAGGAGGGGAAAUGUGUAGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM1065668
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_7
Location of target site ENST00000353088.2 | 3UTR | ACUGGAGGAAGGAGGGGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
236 hsa-miR-4667-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT256051 UBE2K ubiquitin conjugating enzyme E2 K 2 4
MIRT306046 SKIL SKI like proto-oncogene 2 10
MIRT348290 ZBTB7A zinc finger and BTB domain containing 7A 2 2
MIRT380488 AREL1 apoptosis resistant E3 ubiquitin protein ligase 1 2 2
MIRT441955 MAGEB10 MAGE family member B10 2 6
MIRT447735 MOCOS molybdenum cofactor sulfurase 2 2
MIRT449260 PALM2 paralemmin 2 2 4
MIRT456108 VAV3 vav guanine nucleotide exchange factor 3 2 8
MIRT471140 PHF19 PHD finger protein 19 2 4
MIRT486256 BCORL1 BCL6 corepressor like 1 2 2
MIRT489562 PLD6 phospholipase D family member 6 2 2
MIRT489898 PPIC peptidylprolyl isomerase C 2 4
MIRT497434 SEC63 SEC63 homolog, protein translocation regulator 2 4
MIRT499611 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 2 8
MIRT506401 NSD1 nuclear receptor binding SET domain protein 1 2 8
MIRT513021 NSFL1C NSFL1 cofactor 2 6
MIRT513044 BRIX1 BRX1, biogenesis of ribosomes 2 2
MIRT526173 ANKRD65 ankyrin repeat domain 65 2 2
MIRT527820 TMEM74B transmembrane protein 74B 2 2
MIRT528177 C6orf47 chromosome 6 open reading frame 47 2 2
MIRT530306 TNFRSF10D TNF receptor superfamily member 10d 2 2
MIRT531943 AACS acetoacetyl-CoA synthetase 2 2
MIRT531987 SLCO1B3 solute carrier organic anion transporter family member 1B3 2 2
MIRT534821 RAB30 RAB30, member RAS oncogene family 2 2
MIRT536153 MAP4K5 mitogen-activated protein kinase kinase kinase kinase 5 2 2
MIRT540297 TMA16 translation machinery associated 16 homolog 2 2
MIRT543485 RXRA retinoid X receptor alpha 2 2
MIRT547506 MAZ MYC associated zinc finger protein 2 2
MIRT569289 SLC35C2 solute carrier family 35 member C2 2 2
MIRT572754 FAM204A family with sequence similarity 204 member A 2 2
MIRT575266 Timp3 tissue inhibitor of metalloproteinase 3 2 2
MIRT609477 LSAMP limbic system-associated membrane protein 2 2
MIRT610265 LRRC47 leucine rich repeat containing 47 2 2
MIRT610350 AGTRAP angiotensin II receptor associated protein 2 2
MIRT610396 FOXE1 forkhead box E1 2 2
MIRT610492 GPC4 glypican 4 2 4
MIRT612511 SH3PXD2A SH3 and PX domains 2A 2 2
MIRT612760 MYOCD myocardin 2 2
MIRT613414 CDH8 cadherin 8 2 2
MIRT613703 QPRT quinolinate phosphoribosyltransferase 2 2
MIRT613814 ATP6AP1L ATPase H+ transporting accessory protein 1 like 2 2
MIRT614170 MYO1F myosin IF 2 2
MIRT614214 LENG9 leukocyte receptor cluster member 9 2 2
MIRT614225 TSKU tsukushi, small leucine rich proteoglycan 2 2
MIRT614497 RHOB ras homolog family member B 2 2
MIRT614986 GIPC1 GIPC PDZ domain containing family member 1 2 2
MIRT615222 ARSE arylsulfatase E (chondrodysplasia punctata 1) 2 2
MIRT615326 ERN1 endoplasmic reticulum to nucleus signaling 1 2 2
MIRT615494 SHB SH2 domain containing adaptor protein B 2 2
MIRT615506 CNNM3 cyclin and CBS domain divalent metal cation transport mediator 3 2 2
MIRT615536 PHF1 PHD finger protein 1 2 2
MIRT615550 TNFSF15 TNF superfamily member 15 2 2
MIRT615954 SORD sorbitol dehydrogenase 2 2
MIRT616478 MACC1 MACC1, MET transcriptional regulator 2 2
MIRT616667 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 2 2
MIRT616742 DCTN5 dynactin subunit 5 2 2
MIRT616760 SVOP SV2 related protein 2 2
MIRT616913 LINC00598 long intergenic non-protein coding RNA 598 2 2
MIRT617645 RAB43 RAB43, member RAS oncogene family 2 2
MIRT617822 EMX2 empty spiracles homeobox 2 2 2
MIRT618468 GPR55 G protein-coupled receptor 55 2 2
MIRT618517 SELPLG selectin P ligand 2 2
MIRT618687 DVL1 dishevelled segment polarity protein 1 2 2
MIRT619464 XRCC2 X-ray repair cross complementing 2 2 2
MIRT619560 GABRG2 gamma-aminobutyric acid type A receptor gamma2 subunit 2 2
MIRT620004 C1orf64 steroid receptor associated and regulated protein 2 2
MIRT620210 VN1R1 vomeronasal 1 receptor 1 2 2
MIRT620446 SEMA3E semaphorin 3E 2 2
MIRT621297 SLC35B1 solute carrier family 35 member B1 2 2
MIRT621765 TNFAIP3 TNF alpha induced protein 3 2 2
MIRT621812 TMEM170B transmembrane protein 170B 2 2
MIRT622171 SMYD1 SET and MYND domain containing 1 2 2
MIRT622202 SLC5A12 solute carrier family 5 member 12 2 2
MIRT622295 SH3BP5L SH3 binding domain protein 5 like 2 2
MIRT622718 PLEKHA2 pleckstrin homology domain containing A2 2 2
MIRT622893 PDCL phosducin like 2 2
MIRT623215 MTFR1L mitochondrial fission regulator 1 like 2 2
MIRT623230 MON1B MON1 homolog B, secretory trafficking associated 2 2
MIRT623548 KCNJ6 potassium voltage-gated channel subfamily J member 6 2 2
MIRT623557 JPH3 junctophilin 3 2 2
MIRT623669 HRK harakiri, BCL2 interacting protein 2 2
MIRT623730 GTDC1 glycosyltransferase like domain containing 1 2 4
MIRT623742 GRIN2B glutamate ionotropic receptor NMDA type subunit 2B 2 2
MIRT623906 FOXK2 forkhead box K2 2 2
MIRT624181 DERL2 derlin 2 2 2
MIRT625758 GPC5 glypican 5 2 2
MIRT625975 PIK3C2B phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta 2 2
MIRT626300 KCNK12 potassium two pore domain channel subfamily K member 12 2 2
MIRT626779 PI4K2B phosphatidylinositol 4-kinase type 2 beta 2 2
MIRT627034 TMEM109 transmembrane protein 109 2 4
MIRT627109 PDRG1 p53 and DNA damage regulated 1 2 2
MIRT627405 TMEM170A transmembrane protein 170A 2 2
MIRT628390 CACNB2 calcium voltage-gated channel auxiliary subunit beta 2 2 2
MIRT628428 ARRB1 arrestin beta 1 2 2
MIRT629824 REL REL proto-oncogene, NF-kB subunit 2 2
MIRT630870 UBXN11 UBX domain protein 11 2 2
MIRT630968 KIAA2022 neurite extension and migration factor 2 2
MIRT631588 ITGAL integrin subunit alpha L 2 2
MIRT633209 WFDC6 WAP four-disulfide core domain 6 2 2
MIRT635310 FAM179A TOG array regulator of axonemal microtubules 2 2 2
MIRT637062 PRKAG1 protein kinase AMP-activated non-catalytic subunit gamma 1 2 2
MIRT637116 KLHL21 kelch like family member 21 2 2
MIRT637635 ZNF431 zinc finger protein 431 2 2
MIRT638390 RAB11FIP1 RAB11 family interacting protein 1 2 2
MIRT639178 CEP70 centrosomal protein 70 2 2
MIRT639777 GPR45 G protein-coupled receptor 45 2 2
MIRT639885 STC1 stanniocalcin 1 2 2
MIRT640003 PHF21B PHD finger protein 21B 2 2
MIRT640640 FBXL18 F-box and leucine rich repeat protein 18 2 2
MIRT640824 GPR107 G protein-coupled receptor 107 2 2
MIRT641253 CENPN centromere protein N 2 2
MIRT641434 SCUBE3 signal peptide, CUB domain and EGF like domain containing 3 2 2
MIRT641746 MACROD2 MACRO domain containing 2 2 2
MIRT641869 STOML1 stomatin like 1 2 2
MIRT641890 SND1 staphylococcal nuclease and tudor domain containing 1 2 2
MIRT642356 C19orf40 Fanconi anemia core complex associated protein 24 1 1
MIRT644007 PPP1R3G protein phosphatase 1 regulatory subunit 3G 2 2
MIRT644301 ZSCAN29 zinc finger and SCAN domain containing 29 2 2
MIRT645706 C1orf50 chromosome 1 open reading frame 50 2 2
MIRT645752 FAM213A family with sequence similarity 213 member A 2 2
MIRT646123 SLC26A9 solute carrier family 26 member 9 2 2
MIRT646397 SLC22A6 solute carrier family 22 member 6 2 2
MIRT646490 APBB3 amyloid beta precursor protein binding family B member 3 2 2
MIRT646576 XPNPEP3 X-prolyl aminopeptidase 3 2 2
MIRT647151 CYP27C1 cytochrome P450 family 27 subfamily C member 1 2 2
MIRT647554 CYP2B6 cytochrome P450 family 2 subfamily B member 6 2 2
MIRT647761 RNF168 ring finger protein 168 2 2
MIRT648078 ZMIZ2 zinc finger MIZ-type containing 2 2 2
MIRT648644 ZNF562 zinc finger protein 562 2 2
MIRT648967 TMEM45B transmembrane protein 45B 2 2
MIRT649126 SRD5A1 steroid 5 alpha-reductase 1 2 2
MIRT649556 FAM20B FAM20B, glycosaminoglycan xylosylkinase 2 2
MIRT649644 SAMHD1 SAM and HD domain containing deoxynucleoside triphosphate triphosphohydrolase 1 2 2
MIRT649781 MRPS27 mitochondrial ribosomal protein S27 2 4
MIRT649945 SIT1 signaling threshold regulating transmembrane adaptor 1 2 2
MIRT649975 TRAFD1 TRAF-type zinc finger domain containing 1 2 2
MIRT650250 CD68 CD68 molecule 2 2
MIRT650717 KRT32 keratin 32 2 2
MIRT650979 ZNF831 zinc finger protein 831 2 2
MIRT651049 ZNF644 zinc finger protein 644 2 2
MIRT651120 ZNF48 zinc finger protein 48 2 2
MIRT651221 ZNF225 zinc finger protein 225 2 2
MIRT651277 ZDHHC5 zinc finger DHHC-type containing 5 2 2
MIRT651401 ZBTB16 zinc finger and BTB domain containing 16 2 2
MIRT651410 ZADH2 zinc binding alcohol dehydrogenase domain containing 2 2 2
MIRT652198 TRIM39 tripartite motif containing 39 2 2
MIRT652710 THBS2 thrombospondin 2 2 4
MIRT652763 TENM4 teneurin transmembrane protein 4 2 2
MIRT653031 STX1B syntaxin 1B 2 2
MIRT653099 SRSF7 serine and arginine rich splicing factor 7 2 2
MIRT653354 SMG7 SMG7, nonsense mediated mRNA decay factor 2 2
MIRT653366 SMARCE1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 2 2
MIRT653755 SLC12A5 solute carrier family 12 member 5 2 2
MIRT653864 SHANK2 SH3 and multiple ankyrin repeat domains 2 2 2
MIRT653961 SEPN1 selenoprotein N 2 2
MIRT654463 RAP2B RAP2B, member of RAS oncogene family 2 2
MIRT654483 RANBP2 RAN binding protein 2 2 2
MIRT654696 PSMB5 proteasome subunit beta 5 2 2
MIRT655075 PIP4K2B phosphatidylinositol-5-phosphate 4-kinase type 2 beta 2 2
MIRT655443 PALM2-AKAP2 PALM2-AKAP2 readthrough 2 2
MIRT655606 ORMDL3 ORMDL sphingolipid biosynthesis regulator 3 2 2
MIRT656026 MYO5A myosin VA 2 4
MIRT656038 MYO10 myosin X 2 2
MIRT656304 METTL1 methyltransferase like 1 2 2
MIRT656372 MDFI MyoD family inhibitor 2 4
MIRT656399 MCU mitochondrial calcium uniporter 2 2
MIRT656415 MCTP1 multiple C2 and transmembrane domain containing 1 2 2
MIRT656762 LCOR ligand dependent nuclear receptor corepressor 2 2
MIRT656905 KIAA1958 KIAA1958 2 2
MIRT658938 DPY19L1 dpy-19 like C-mannosyltransferase 1 2 2
MIRT659221 CXXC5 CXXC finger protein 5 2 2
MIRT659281 CTIF cap binding complex dependent translation initiation factor 2 2
MIRT659483 CLDN1 claudin 1 2 2
MIRT660112 BTBD3 BTB domain containing 3 2 2
MIRT660305 BHLHE40 basic helix-loop-helix family member e40 2 2
MIRT660334 BCL11B B-cell CLL/lymphoma 11B 2 2
MIRT660788 AKAP2 A-kinase anchoring protein 2 2 2
MIRT661578 EPHX2 epoxide hydrolase 2 2 2
MIRT661744 DTHD1 death domain containing 1 2 2
MIRT661873 PDLIM5 PDZ and LIM domain 5 2 2
MIRT662256 C15orf52 chromosome 15 open reading frame 52 2 2
MIRT662698 SPIRE2 spire type actin nucleation factor 2 2 2
MIRT662761 LRRC3C leucine rich repeat containing 3C 2 2
MIRT663315 TECPR2 tectonin beta-propeller repeat containing 2 2 2
MIRT664687 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 2 4
MIRT665966 SZRD1 SUZ RNA binding domain containing 1 2 2
MIRT666057 STK40 serine/threonine kinase 40 2 2
MIRT666875 POMGNT1 protein O-linked mannose N-acetylglucosaminyltransferase 1 (beta 1,2-) 2 2
MIRT667214 NIPAL1 NIPA like domain containing 1 2 2
MIRT667285 NAV1 neuron navigator 1 2 2
MIRT667648 LGALSL galectin like 2 2
MIRT668045 GTPBP10 GTP binding protein 10 2 2
MIRT668155 GDE1 glycerophosphodiester phosphodiesterase 1 2 2
MIRT668492 ETV3 ETS variant 3 2 2
MIRT669356 BHLHE22 basic helix-loop-helix family member e22 2 2
MIRT676486 DSN1 DSN1 homolog, MIS12 kinetochore complex component 2 2
MIRT684285 CDK9 cyclin dependent kinase 9 2 2
MIRT686689 TIMM10 translocase of inner mitochondrial membrane 10 2 2
MIRT691270 GET4 golgi to ER traffic protein 4 2 2
MIRT698669 TEF TEF, PAR bZIP transcription factor 2 2
MIRT699893 RUNX1 runt related transcription factor 1 2 2
MIRT702635 ITGA5 integrin subunit alpha 5 2 2
MIRT708797 KIFC3 kinesin family member C3 2 2
MIRT710950 AMZ1 archaelysin family metallopeptidase 1 2 2
MIRT711228 RETSAT retinol saturase 2 2
MIRT711637 PEBP1 phosphatidylethanolamine binding protein 1 2 2
MIRT711968 APOA5 apolipoprotein A5 2 2
MIRT712078 WDR37 WD repeat domain 37 2 2
MIRT712542 CYB561D1 cytochrome b561 family member D1 2 2
MIRT713595 ANKMY1 ankyrin repeat and MYND domain containing 1 2 2
MIRT713715 PAOX polyamine oxidase 2 2
MIRT714482 TBL2 transducin beta like 2 2 2
MIRT715510 MAPKBP1 mitogen-activated protein kinase binding protein 1 2 2
MIRT715833 SZT2 SZT2, KICSTOR complex subunit 2 2
MIRT715931 CHD4 chromodomain helicase DNA binding protein 4 2 2
MIRT716183 MTRNR2L1 MT-RNR2-like 1 2 2
MIRT716330 POU5F1 POU class 5 homeobox 1 2 2
MIRT716942 CACNB1 calcium voltage-gated channel auxiliary subunit beta 1 2 2
MIRT717337 URM1 ubiquitin related modifier 1 2 2
MIRT718114 CRTC1 CREB regulated transcription coactivator 1 2 2
MIRT718866 LRSAM1 leucine rich repeat and sterile alpha motif containing 1 2 2
MIRT719456 APBA1 amyloid beta precursor protein binding family A member 1 2 2
MIRT719989 MAPK1 mitogen-activated protein kinase 1 2 2
MIRT720262 FAM83F family with sequence similarity 83 member F 2 2
MIRT721361 ENTHD1 ENTH domain containing 1 2 2
MIRT721370 SEC14L6 SEC14 like lipid binding 6 2 2
MIRT721489 LTB4R2 leukotriene B4 receptor 2 2 2
MIRT723010 FADS1 fatty acid desaturase 1 2 2
MIRT723608 FKRP fukutin related protein 2 2
MIRT723686 CIRH1A UTP4, small subunit processome component 2 2
MIRT723972 GPR146 G protein-coupled receptor 146 2 2
MIRT724826 HOXB8 homeobox B8 2 2
MIRT725283 OSTM1 osteopetrosis associated transmembrane protein 1 2 2
MIRT725437 HIVEP3 human immunodeficiency virus type I enhancer binding protein 3 2 2
MIRT725606 CAPN6 calpain 6 2 2
MIRT731686 BTK Bruton tyrosine kinase 3 1
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4667 Cisplatin 5460033 NSC119875 approved sensitive cell line (CIS)
hsa-mir-4667 Androstenedione 6128 NSC9563 resistant cell line (MCF-7)
hsa-mir-4667 Tamoxifen 2733525 NSC180973 approved resistant cell line (MCF7)
hsa-miR-4667-3p Tripterygium wilfordii Hook F sensitive tissue
hsa-miR-4667-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-4667-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CP20)
hsa-miR-4667-3p Platinum 23939 sensitive tissue (non-small cell lung cancer)
hsa-miR-4667-3p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-4667-3p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)

Error report submission