pre-miRNA Information
pre-miRNA hsa-mir-367   
Genomic Coordinates chr4: 112647874 - 112647941
Synonyms MIRN367, hsa-mir-367, MIR367
Description Homo sapiens miR-367 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-367-3p
Sequence 44| AAUUGCACUUUAGCAAUGGUGA |65
Evidence Experimental
Experiments Cloned
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN24411246 17 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs535597757 1 dbSNP
rs1013348949 11 dbSNP
rs896333735 12 dbSNP
rs751269136 14 dbSNP
rs1163501507 16 dbSNP
rs757092597 21 dbSNP
Putative Targets

Gene Information
Gene Symbol MOAP1   
Synonyms MAP-1, PNMA4
Description modulator of apoptosis 1
Transcript NM_022151   
Expression
Putative miRNA Targets on MOAP1
3'UTR of MOAP1
(miRNA target sites are highlighted)
>MOAP1|NM_022151|3'UTR
   1 GTCTCAGGGAACCACGAAGGGATATGGCAATGAGTAGAGCATGAAGGTAGAACAGTCTATATACTCTTGTGACACATACA
  81 ATCCCTACCTTGTGCTGCCAAGTAACTCATTTTTGTGCAATTCTCAGTATAAGCCCTTTGTCGTTTCTGTGCCTATTTAA
 161 AGTCTCCTAAAGGTGTAATTGACTAGGAAGGATGTAGTTCTACACTGCCATTTACCTATTTAAATTCATCCTTGTGAATA
 241 TCTTTGTTGTTGTTGTTGAGACAGAGTCTCGCTCTGTCACCCAGGCTGGAGTGCAGTGGCGTGATCTTGGCTCACTGCAT
 321 CCTCCGCCTTCCAGGTTTAAGCTATTCTCCTGCCTCAGTTGCCCGAGTAGCTGGGACTACAGGCATGTGCCACCACGCCC
 401 AGCTAAGTTTTGCATTATCAGTAGAGACGGGGTTTCACCATGTTGGCCAGGCTAGTTTCGAACTCCTGACCTCAAGTGAT
 481 CCACCTGCTTCGGCCTCTGAAAGTGCTGGGATTACAGGCGTGAGACACTGCGCCCAGCCTCATCCCTGTGAATTTCTTAT
 561 TGTACACAAGTTCTTTCACTATCTGTGTGCAGTGCTCTGAGGGGACAGACAAGGCTTGGGTGTATATGCCAACCAGATCT
 641 CATTGAAGTATCAGCTTGTTTGGTACTAGGTGCAAGTGTAGCATGTCACATGTGACCATGTTGGATCATTGACAATTTTT
 721 AGGTATGTACTGACCTACATTTATGATGAAGATCCTGAGCGGAGGTTAAGATATTAAGTTATTTTCCATATGAATCAGAA
 801 TTATATTGATTCTGTGCAATCAAAACAAAAGGCAGAATAGAATGCTGAGATTGGTTAAGTTTGCAATGACCATCTTGAAC
 881 CACAGATTTCTGCTATGTGTCATCAAAACATCTAGTTCTGAGTAACATTTTCACGATTGTTATAAAATTATAGGTGTGAA
 961 CTTCTAAAATAAAGGAATGCTAATAAAATGAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' agugGUAACGAUUUCACGUUAa 5'
              :|||| |   ||||||| 
Target 5' attaTATTGATTCTGTGCAATc 3'
800 - 821 154.00 -10.90
2
miRNA  3' agUG-GUAACGAUUUCACGUUAa 5'
            || |||| :|   ||||||| 
Target 5' taACTCATTTTT---GTGCAATt 3'
103 - 122 153.00 -8.90
3
miRNA  3' agUGGUAACGAUUUCACGUUAa 5'
            |||   |||::||||||:| 
Target 5' tcACCCAGGCTGGAGTGCAGTg 3'
277 - 298 152.00 -23.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30138112 16 COSMIC
COSN30159835 16 COSMIC
COSN5752227 36 COSMIC
COSN30171820 66 COSMIC
COSN30128401 95 COSMIC
COSN31600601 119 COSMIC
COSN1173085 178 COSMIC
COSN14815221 181 COSMIC
COSN31961024 271 COSMIC
COSN16598935 325 COSMIC
COSN26332055 488 COSMIC
COSN22404288 821 COSMIC
COSN8462197 899 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1034984701 2 dbSNP
rs745374087 3 dbSNP
rs748928852 6 dbSNP
rs1195867693 9 dbSNP
rs1461764749 11 dbSNP
rs371892869 13 dbSNP
rs1163027215 15 dbSNP
rs1405030325 16 dbSNP
rs752903110 19 dbSNP
rs756942904 21 dbSNP
rs751135476 27 dbSNP
rs1194543878 30 dbSNP
rs1046099 31 dbSNP
rs1247957469 32 dbSNP
rs193202063 39 dbSNP
rs752674243 40 dbSNP
rs1271701715 42 dbSNP
rs1218868335 43 dbSNP
rs1320765009 47 dbSNP
rs200675369 50 dbSNP
rs1477571363 56 dbSNP
rs1011529948 59 dbSNP
rs956225599 61 dbSNP
rs1031663664 74 dbSNP
rs553655848 78 dbSNP
rs115060758 81 dbSNP
rs755588291 88 dbSNP
rs1297643557 92 dbSNP
rs1324685272 93 dbSNP
rs1217471325 94 dbSNP
rs1049815987 120 dbSNP
rs997389242 134 dbSNP
rs1336450258 135 dbSNP
rs1211471131 136 dbSNP
rs1271607350 142 dbSNP
rs1256816465 143 dbSNP
rs898667050 144 dbSNP
rs15837 149 dbSNP
rs1319440400 160 dbSNP
rs1193009840 162 dbSNP
rs940320450 164 dbSNP
rs907518351 166 dbSNP
rs1163073946 169 dbSNP
rs1367612562 192 dbSNP
rs551449168 196 dbSNP
rs1290473566 197 dbSNP
rs1047404365 205 dbSNP
rs1312911984 208 dbSNP
rs1356839633 243 dbSNP
rs1231014464 246 dbSNP
rs754233121 256 dbSNP
rs911658408 259 dbSNP
rs1439169722 263 dbSNP
rs1317209845 264 dbSNP
rs531443689 270 dbSNP
rs541622149 271 dbSNP
rs985739739 274 dbSNP
rs931649457 275 dbSNP
rs113142191 276 dbSNP
rs978692368 278 dbSNP
rs967736533 280 dbSNP
rs112648887 281 dbSNP
rs970293083 282 dbSNP
rs1160983152 285 dbSNP
rs914444339 289 dbSNP
rs529132151 295 dbSNP
rs992668340 300 dbSNP
rs1174199137 301 dbSNP
rs956007609 313 dbSNP
rs1301810189 322 dbSNP
rs1373576387 326 dbSNP
rs1128801 331 dbSNP
rs1035119902 340 dbSNP
rs146054560 358 dbSNP
rs955382403 359 dbSNP
rs1028326855 364 dbSNP
rs187086208 365 dbSNP
rs1237020244 370 dbSNP
rs764538347 377 dbSNP
rs1458706935 387 dbSNP
rs1179191110 391 dbSNP
rs1038556236 396 dbSNP
rs1208909567 397 dbSNP
rs1194097799 401 dbSNP
rs1312440002 413 dbSNP
rs1279721842 415 dbSNP
rs1174705553 417 dbSNP
rs564506206 421 dbSNP
rs758845322 428 dbSNP
rs149552910 429 dbSNP
rs575324412 432 dbSNP
rs773848497 440 dbSNP
rs1375784499 441 dbSNP
rs1446492129 443 dbSNP
rs1309163256 448 dbSNP
rs555485680 455 dbSNP
rs1056736663 457 dbSNP
rs138223191 459 dbSNP
rs1379131838 460 dbSNP
rs1301202920 464 dbSNP
rs1447512742 465 dbSNP
rs182799322 467 dbSNP
rs1050123706 476 dbSNP
rs553355402 491 dbSNP
rs1214065733 492 dbSNP
rs1417631989 497 dbSNP
rs540147097 516 dbSNP
rs191843634 519 dbSNP
rs150416159 520 dbSNP
rs945949555 525 dbSNP
rs1167781211 529 dbSNP
rs1441474240 531 dbSNP
rs1461678501 532 dbSNP
rs1025204540 552 dbSNP
rs924497843 553 dbSNP
rs753836415 556 dbSNP
rs913165269 560 dbSNP
rs766516654 566 dbSNP
rs1180792844 577 dbSNP
rs1028361224 579 dbSNP
rs17128917 582 dbSNP
rs1216385637 583 dbSNP
rs959842138 587 dbSNP
rs1317484842 591 dbSNP
rs1214584547 593 dbSNP
rs1238810097 597 dbSNP
rs1274755889 614 dbSNP
rs1449661104 615 dbSNP
rs962801887 622 dbSNP
rs1487504696 642 dbSNP
rs1486835351 648 dbSNP
rs1017446377 665 dbSNP
rs774333070 672 dbSNP
rs1285767191 679 dbSNP
rs1475303978 685 dbSNP
rs1004348853 693 dbSNP
rs1241423480 698 dbSNP
rs1166661674 699 dbSNP
rs1420389099 701 dbSNP
rs927138954 708 dbSNP
rs887273862 709 dbSNP
rs1319278557 713 dbSNP
rs1311271078 715 dbSNP
rs1227782159 722 dbSNP
rs1380065901 723 dbSNP
rs1295339711 731 dbSNP
rs969879852 735 dbSNP
rs1027622846 739 dbSNP
rs568953077 741 dbSNP
rs995260614 742 dbSNP
rs1354585017 746 dbSNP
rs1035267580 750 dbSNP
rs1227509066 757 dbSNP
rs962247070 760 dbSNP
rs1318615366 764 dbSNP
rs1214393282 765 dbSNP
rs113523165 778 dbSNP
rs1359589602 792 dbSNP
rs1003831490 798 dbSNP
rs1009135483 803 dbSNP
rs576565267 804 dbSNP
rs1235366993 806 dbSNP
rs1472289629 817 dbSNP
rs1421384759 819 dbSNP
rs1409210780 830 dbSNP
rs1422004059 831 dbSNP
rs140853904 845 dbSNP
rs1348023705 847 dbSNP
rs1044089991 858 dbSNP
rs762744412 866 dbSNP
rs781472312 885 dbSNP
rs369008969 889 dbSNP
rs1447619160 893 dbSNP
rs535263702 895 dbSNP
rs566684082 896 dbSNP
rs1237781152 909 dbSNP
rs1285212649 909 dbSNP
rs1415404302 910 dbSNP
rs924489633 915 dbSNP
rs986673842 916 dbSNP
rs1348570831 926 dbSNP
rs769354501 934 dbSNP
rs921247854 935 dbSNP
rs975409686 937 dbSNP
rs1233751061 943 dbSNP
rs1217781930 948 dbSNP
rs1177225009 951 dbSNP
rs138104395 954 dbSNP
rs1435929279 955 dbSNP
rs1057058595 975 dbSNP
rs1400190050 989 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' agUG-GUAACGAUUUCACGUUAa 5'
            || |||| :|   ||||||| 
Target 5' uaACUCAUUUUU---GUGCAAUu 3'
1 - 20
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 64112.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 64112.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions Prostate Tissue
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRX1760597. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP_C ...

- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.).

Article - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al.
- Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000298894.4 | 3UTR | UAACUCAUUUUUGUGCAAUUCUCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000298894.4 | 3UTR | UAACUCAUUUUUGUGCAAUUCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000298894.4 | 3UTR | UAACUCAUUUUUGUGCAAUUCUCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM1065668
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_7
Location of target site ENST00000298894.4 | 3UTR | UAACUCAUUUUUGUGCAAUUCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells -0.644 4.6e-4 -0.586 1.6e-3 23 Click to see details
GSE19350 CNS germ cell tumors -0.552 3.1e-2 -0.566 2.8e-2 12 Click to see details
GSE38226 Liver fibrosis 0.413 3.1e-2 0.310 8.6e-2 21 Click to see details
GSE27834 Pluripotent stem cells -0.459 3.7e-2 -0.282 1.4e-1 16 Click to see details
GSE28260 Renal cortex and medulla -0.433 7.0e-2 -0.441 6.6e-2 13 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.679 1.0e-1 0.300 3.1e-1 5 Click to see details
GSE26953 Aortic valvular endothelial cells 0.262 1.1e-1 0.070 3.7e-1 24 Click to see details
GSE32688 Pancreatic cancer -0.189 1.5e-1 -0.344 2.7e-2 32 Click to see details
GSE14794 Lymphoblastoid cells -0.084 2.2e-1 -0.139 9.6e-2 90 Click to see details
GSE17498 Multiple myeloma 0.121 2.3e-1 0.020 4.5e-1 40 Click to see details
GSE21849 B cell lymphoma 0.14 2.3e-1 0.106 2.9e-1 29 Click to see details
GSE17306 Multiple myeloma -0.099 2.5e-1 0.321 1.2e-2 49 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.054 4.0e-1 -0.023 4.6e-1 25 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.016 4.7e-1 0.087 3.6e-1 20 Click to see details
GSE21687 Ependynoma primary tumors 0.006 4.8e-1 -0.084 2.5e-1 64 Click to see details
GSE28544 Breast cancer 0.003 4.9e-1 0.041 4.2e-1 24 Click to see details
GSE28544 Breast cancer 0.003 4.9e-1 0.041 4.2e-1 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
255 hsa-miR-367-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT055315 DUSP5 dual specificity phosphatase 5 2 8
MIRT055791 PLEKHA1 pleckstrin homology domain containing A1 2 12
MIRT057114 DDIT4 DNA damage inducible transcript 4 2 4
MIRT059663 GATAD2B GATA zinc finger domain containing 2B 2 2
MIRT059926 ZDHHC5 zinc finger DHHC-type containing 5 2 2
MIRT061610 BTG2 BTG anti-proliferation factor 2 2 6
MIRT066478 HMGA2 high mobility group AT-hook 2 2 2
MIRT069388 ZFYVE21 zinc finger FYVE-type containing 21 2 2
MIRT069972 GEMIN2 gem nuclear organelle associated protein 2 2 2
MIRT074764 CNEP1R1 CTD nuclear envelope phosphatase 1 regulatory subunit 1 2 2
MIRT076199 GID4 GID complex subunit 4 homolog 2 6
MIRT077512 UBE2Z ubiquitin conjugating enzyme E2 Z 2 4
MIRT077903 TOB1 transducer of ERBB2, 1 2 6
MIRT082250 MED29 mediator complex subunit 29 2 4
MIRT082434 CIC capicua transcriptional repressor 2 6
MIRT082474 PPP1R37 protein phosphatase 1 regulatory subunit 37 2 2
MIRT082778 ZNF264 zinc finger protein 264 2 2
MIRT084533 BCL2L11 BCL2 like 11 2 8
MIRT085309 UBXN4 UBX domain protein 4 2 8
MIRT086365 SSFA2 sperm specific antigen 2 2 8
MIRT087455 NF2 neurofibromin 2 2 2
MIRT088865 FOXN2 forkhead box N2 2 12
MIRT092185 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 2 6
MIRT092326 EDEM1 ER degradation enhancing alpha-mannosidase like protein 1 2 6
MIRT093533 GALNT7 polypeptide N-acetylgalactosaminyltransferase 7 2 6
MIRT096935 PAPD7 poly(A) RNA polymerase D7, non-canonical 2 8
MIRT097026 MAP1B microtubule associated protein 1B 2 4
MIRT099137 MYLIP myosin regulatory light chain interacting protein 2 6
MIRT099905 SOX4 SRY-box 4 2 12
MIRT102289 DNAJB9 DnaJ heat shock protein family (Hsp40) member B9 2 10
MIRT102507 KLHDC10 kelch domain containing 10 2 2
MIRT102891 INSIG1 insulin induced gene 1 2 2
MIRT109188 VMA21 VMA21, vacuolar ATPase assembly factor 2 4
MIRT124567 PRRC2B proline rich coiled-coil 2B 2 2
MIRT135568 SPRYD4 SPRY domain containing 4 2 2
MIRT161135 SLC25A36 solute carrier family 25 member 36 2 6
MIRT163995 KIAA1109 KIAA1109 2 4
MIRT164689 RNF4 ring finger protein 4 2 2
MIRT167705 HIVEP1 human immunodeficiency virus type I enhancer binding protein 1 2 8
MIRT178956 USP28 ubiquitin specific peptidase 28 2 2
MIRT185717 ARNTL2 aryl hydrocarbon receptor nuclear translocator like 2 2 2
MIRT186264 TCEB3 elongin A 2 2
MIRT186537 TWF1 twinfilin actin binding protein 1 2 4
MIRT186628 COX20 COX20, cytochrome c oxidase assembly factor 2 8
MIRT189373 TXLNA taxilin alpha 2 4
MIRT197013 EIF1 eukaryotic translation initiation factor 1 2 10
MIRT206437 YIPF4 Yip1 domain family member 4 2 2
MIRT211228 FGF2 fibroblast growth factor 2 2 10
MIRT214529 C5ORF24 chromosome 5 open reading frame 24 2 2
MIRT216034 IL6ST interleukin 6 signal transducer 2 10
MIRT218084 TULP4 tubby like protein 4 2 2
MIRT242418 CCDC113 coiled-coil domain containing 113 2 2
MIRT243162 SOX11 SRY-box 11 2 2
MIRT250943 CDK5R1 cyclin dependent kinase 5 regulatory subunit 1 2 4
MIRT253350 ZNF417 zinc finger protein 417 2 2
MIRT271968 ARF1 ADP ribosylation factor 1 2 2
MIRT273214 ZNF695 zinc finger protein 695 2 4
MIRT296114 SLC12A5 solute carrier family 12 member 5 2 2
MIRT301711 TEF TEF, PAR bZIP transcription factor 2 2
MIRT316477 ARID1B AT-rich interaction domain 1B 2 6
MIRT322174 CLN8 CLN8, transmembrane ER and ERGIC protein 2 4
MIRT341538 CNIH1 cornichon family AMPA receptor auxiliary protein 1 2 6
MIRT356062 SMARCA5 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 2 2
MIRT443579 PPIC peptidylprolyl isomerase C 2 2
MIRT448825 FKBP1A FK506 binding protein 1A 2 4
MIRT451494 FOPNL FGFR1OP N-terminal like 2 2
MIRT452694 MDM2 MDM2 proto-oncogene 2 2
MIRT453167 CNOT4 CCR4-NOT transcription complex subunit 4 2 6
MIRT454588 SLC33A1 solute carrier family 33 member 1 2 4
MIRT455794 TAF8 TATA-box binding protein associated factor 8 2 4
MIRT456010 CYP2C19 cytochrome P450 family 2 subfamily C member 19 2 2
MIRT456044 KIAA1586 KIAA1586 2 2
MIRT456763 TMEM239 transmembrane protein 239 2 4
MIRT458068 NLRP9 NLR family pyrin domain containing 9 2 2
MIRT459230 MRPS21 mitochondrial ribosomal protein S21 2 2
MIRT459534 MFF mitochondrial fission factor 2 6
MIRT459759 SNRPD1 small nuclear ribonucleoprotein D1 polypeptide 2 2
MIRT460236 TNFRSF13C TNF receptor superfamily member 13C 2 2
MIRT461104 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 2 2
MIRT462924 ZNRF3 zinc and ring finger 3 2 2
MIRT463476 ZC3HAV1L zinc finger CCCH-type containing, antiviral 1 like 2 2
MIRT463516 ZBTB8B zinc finger and BTB domain containing 8B 2 4
MIRT465503 TOR1B torsin family 1 member B 2 2
MIRT469525 RBFOX2 RNA binding protein, fox-1 homolog 2 2 8
MIRT470079 PTGES2 prostaglandin E synthase 2 2 2
MIRT471581 PARD6B par-6 family cell polarity regulator beta 2 2
MIRT473451 MCOLN2 mucolipin 2 2 8
MIRT475882 H3F3C H3 histone family member 3C 2 10
MIRT475915 H3F3B H3 histone family member 3B 2 8
MIRT476195 GOLGA8A golgin A8 family member A 2 10
MIRT476318 GM2A GM2 ganglioside activator 2 2
MIRT476676 FUT11 fucosyltransferase 11 2 10
MIRT478368 DDI2 DNA damage inducible 1 homolog 2 2 2
MIRT479545 CDC5L cell division cycle 5 like 2 2
MIRT481024 BAZ2B bromodomain adjacent to zinc finger domain 2B 2 2
MIRT491009 ATF7IP activating transcription factor 7 interacting protein 2 2
MIRT493168 MKNK2 MAP kinase interacting serine/threonine kinase 2 2 2
MIRT494345 CASKIN1 CASK interacting protein 1 2 2
MIRT499087 ZDHHC21 zinc finger DHHC-type containing 21 2 6
MIRT500029 ABCF2 ATP binding cassette subfamily F member 2 2 8
MIRT501298 RRN3 RRN3 homolog, RNA polymerase I transcription factor 2 4
MIRT503124 BCL11B B-cell CLL/lymphoma 11B 2 8
MIRT503301 GTF2A1 general transcription factor IIA subunit 1 2 6
MIRT504328 ASGR2 asialoglycoprotein receptor 2 2 6
MIRT504471 EID2B EP300 interacting inhibitor of differentiation 2B 2 2
MIRT504655 RPL9 ribosomal protein L9 2 6
MIRT505331 TMF1 TATA element modulatory factor 1 2 8
MIRT505732 SERTAD3 SERTA domain containing 3 2 4
MIRT505827 RSBN1 round spermatid basic protein 1 2 8
MIRT506004 PURG purine rich element binding protein G 2 8
MIRT506308 PCMTD1 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 2 6
MIRT506806 KLHL15 kelch like family member 15 2 6
MIRT507119 GOLGA8B golgin A8 family member B 2 6
MIRT507353 FAM129A family with sequence similarity 129 member A 2 6
MIRT507591 DDX3X DEAD-box helicase 3, X-linked 2 4
MIRT507674 CPEB4 cytoplasmic polyadenylation element binding protein 4 2 4
MIRT507703 CNOT2 CCR4-NOT transcription complex subunit 2 2 8
MIRT508012 BCAT1 branched chain amino acid transaminase 1 2 4
MIRT510439 ZIC5 Zic family member 5 2 6
MIRT510539 XKR7 XK related 7 2 4
MIRT510600 TPPP tubulin polymerization promoting protein 2 6
MIRT511060 NRAS NRAS proto-oncogene, GTPase 2 4
MIRT511855 GOLGA8J golgin A8 family member J 2 6
MIRT511865 GOLGA8I golgin A8 family member I, pseudogene 1 3
MIRT512570 CTDSPL CTD small phosphatase like 2 2
MIRT512708 ZNF134 zinc finger protein 134 2 6
MIRT513177 MOAP1 modulator of apoptosis 1 2 6
MIRT513783 PAWR pro-apoptotic WT1 regulator 2 6
MIRT515099 IRGQ immunity related GTPase Q 2 2
MIRT515481 INCENP inner centromere protein 2 4
MIRT517416 BMP8A bone morphogenetic protein 8a 2 2
MIRT518754 C1orf35 chromosome 1 open reading frame 35 2 2
MIRT519780 ZNF354B zinc finger protein 354B 2 4
MIRT519865 ZFP62 ZFP62 zinc finger protein 2 6
MIRT520510 TRAM2 translocation associated membrane protein 2 2 6
MIRT521068 SLC25A32 solute carrier family 25 member 32 2 6
MIRT526912 ZNF772 zinc finger protein 772 2 6
MIRT527134 GULP1 GULP, engulfment adaptor PTB domain containing 1 2 2
MIRT527867 SLC39A14 solute carrier family 39 member 14 2 2
MIRT528404 EIF4EBP2 eukaryotic translation initiation factor 4E binding protein 2 2 2
MIRT532956 ZNF24 zinc finger protein 24 2 4
MIRT533021 ZFC3H1 zinc finger C3H1-type containing 2 4
MIRT533191 WASL Wiskott-Aldrich syndrome like 2 6
MIRT534191 SLC7A11 solute carrier family 7 member 11 2 2
MIRT534961 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 2 4
MIRT536396 LCOR ligand dependent nuclear receptor corepressor 2 2
MIRT537046 GRAMD4 GRAM domain containing 4 2 2
MIRT537125 GOLGA3 golgin A3 2 4
MIRT537183 GFPT2 glutamine-fructose-6-phosphate transaminase 2 2 4
MIRT537652 ERGIC2 ERGIC and golgi 2 2 4
MIRT538632 CCSER2 coiled-coil serine rich protein 2 2 4
MIRT539231 ANP32E acidic nuclear phosphoprotein 32 family member E 2 6
MIRT540099 NPY4R neuropeptide Y receptor Y4 2 2
MIRT540998 ZNF460 zinc finger protein 460 2 4
MIRT541468 AURKA aurora kinase A 2 2
MIRT542680 SESN3 sestrin 3 2 2
MIRT542757 PRRG4 proline rich and Gla domain 4 2 2
MIRT542863 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 2 2
MIRT542925 HOXC8 homeobox C8 2 2
MIRT543747 SZRD1 SUZ RNA binding domain containing 1 2 2
MIRT544404 ZSCAN12 zinc finger and SCAN domain containing 12 2 2
MIRT544583 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 2 4
MIRT544662 MED19 mediator complex subunit 19 2 2
MIRT545251 GTF2E1 general transcription factor IIE subunit 1 2 2
MIRT545261 TRIM36 tripartite motif containing 36 2 4
MIRT545744 UHRF1BP1 UHRF1 binding protein 1 2 2
MIRT545999 WDR81 WD repeat domain 81 2 2
MIRT546038 VPS4B vacuolar protein sorting 4 homolog B 2 2
MIRT547170 PDZD8 PDZ domain containing 8 2 2
MIRT547273 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 2
MIRT547729 KIF5B kinesin family member 5B 2 2
MIRT548127 GATA6 GATA binding protein 6 2 2
MIRT548203 FNIP1 folliculin interacting protein 1 2 2
MIRT548756 CNNM4 cyclin and CBS domain divalent metal cation transport mediator 4 2 2
MIRT549641 ZNF75A zinc finger protein 75a 2 2
MIRT549684 ZNF598 zinc finger protein 598 2 2
MIRT550197 MRO maestro 2 2
MIRT550340 IPP intracisternal A particle-promoted polypeptide 2 2
MIRT550536 MYZAP myocardial zonula adherens protein 2 2
MIRT550975 TOR4A torsin family 4 member A 2 2
MIRT551221 CIDEC cell death inducing DFFA like effector c 2 2
MIRT551355 AGBL5 ATP/GTP binding protein like 5 2 2
MIRT551571 LETM1 leucine zipper and EF-hand containing transmembrane protein 1 2 2
MIRT552277 RAB3D RAB3D, member RAS oncogene family 2 2
MIRT552661 ZADH2 zinc binding alcohol dehydrogenase domain containing 2 2 2
MIRT553081 UCK2 uridine-cytidine kinase 2 2 2
MIRT553753 TBC1D8 TBC1 domain family member 8 2 2
MIRT554030 SPCS3 signal peptidase complex subunit 3 2 2
MIRT554099 SMU1 DNA replication regulator and spliceosomal factor 2 2
MIRT554155 SLX4 SLX4 structure-specific endonuclease subunit 2 2
MIRT554815 REL REL proto-oncogene, NF-kB subunit 2 2
MIRT555522 PMEPA1 prostate transmembrane protein, androgen induced 1 2 2
MIRT555597 PIP5K1C phosphatidylinositol-4-phosphate 5-kinase type 1 gamma 2 2
MIRT555632 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 2 4
MIRT555679 PGAM4 phosphoglycerate mutase family member 4 2 4
MIRT555827 PAX9 paired box 9 2 2
MIRT555868 PAIP1 poly(A) binding protein interacting protein 1 2 2
MIRT555939 NUP43 nucleoporin 43 2 2
MIRT555994 NFYB nuclear transcription factor Y subunit beta 2 2
MIRT556340 MAP2K4 mitogen-activated protein kinase kinase 4 2 2
MIRT556432 LONRF3 LON peptidase N-terminal domain and ring finger 3 2 2
MIRT556585 LHFPL2 LHFPL tetraspan subfamily member 2 2 4
MIRT556801 KIAA1958 KIAA1958 2 2
MIRT558047 EXOC5 exocyst complex component 5 2 2
MIRT558697 CLTA clathrin light chain A 2 2
MIRT559191 BMPR1A bone morphogenetic protein receptor type 1A 2 4
MIRT559639 AKAP10 A-kinase anchoring protein 10 2 2
MIRT559707 AEN apoptosis enhancing nuclease 2 2
MIRT560673 SRFBP1 serum response factor binding protein 1 2 2
MIRT560990 GPBP1L1 GC-rich promoter binding protein 1 like 1 2 2
MIRT562170 HOXA13 homeobox A13 2 2
MIRT562275 GNAQ G protein subunit alpha q 2 2
MIRT563624 ZNF277 zinc finger protein 277 2 2
MIRT563815 FMN1 formin 1 2 2
MIRT564096 TLR3 toll like receptor 3 2 2
MIRT565320 TMEM41A transmembrane protein 41A 2 2
MIRT565986 RNF44 ring finger protein 44 2 2
MIRT566047 REV3L REV3 like, DNA directed polymerase zeta catalytic subunit 2 2
MIRT568236 C11orf24 chromosome 11 open reading frame 24 2 2
MIRT568310 BAK1 BCL2 antagonist/killer 1 2 2
MIRT572376 ATOX1 antioxidant 1 copper chaperone 2 2
MIRT574822 CPEB3 cytoplasmic polyadenylation element binding protein 3 2 2
MIRT609212 PELP1 proline, glutamate and leucine rich protein 1 2 2
MIRT616217 RBM27 RNA binding motif protein 27 2 2
MIRT629087 FASLG Fas ligand 2 2
MIRT632124 FKBP9 FK506 binding protein 9 2 2
MIRT632576 POLQ DNA polymerase theta 2 2
MIRT634799 ENTHD1 ENTH domain containing 1 2 2
MIRT636553 ESRP1 epithelial splicing regulatory protein 1 2 2
MIRT640977 ORAI2 ORAI calcium release-activated calcium modulator 2 2 2
MIRT653875 SH2B3 SH2B adaptor protein 3 2 2
MIRT655598 OTUD7B OTU deubiquitinase 7B 2 2
MIRT659764 CCDC171 coiled-coil domain containing 171 2 2
MIRT660744 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT681037 AAED1 AhpC/TSA antioxidant enzyme domain containing 1 2 2
MIRT682305 RBM28 RNA binding motif protein 28 2 2
MIRT682573 EIF4EBP1 eukaryotic translation initiation factor 4E binding protein 1 2 2
MIRT686217 ZNF267 zinc finger protein 267 2 2
MIRT687209 PLXNA3 plexin A3 2 2
MIRT690630 LAX1 lymphocyte transmembrane adaptor 1 2 2
MIRT692419 AGMAT agmatinase 2 2
MIRT694437 MCF2L2 MCF.2 cell line derived transforming sequence-like 2 2 2
MIRT700725 PNO1 partner of NOB1 homolog 2 2
MIRT701549 NARF nuclear prelamin A recognition factor 2 2
MIRT704379 DAND5 DAN domain BMP antagonist family member 5 2 2
MIRT707935 PPP1R3D protein phosphatase 1 regulatory subunit 3D 2 2
MIRT709939 MRPS16 mitochondrial ribosomal protein S16 2 2
MIRT711371 MED7 mediator complex subunit 7 2 2
MIRT712327 PER2 period circadian clock 2 2 2
MIRT714515 SHE Src homology 2 domain containing E 2 2
MIRT715520 G2E3 G2/M-phase specific E3 ubiquitin protein ligase 2 2
MIRT724294 OSMR oncostatin M receptor 2 2
MIRT725358 MUC21 mucin 21, cell surface associated 2 2
MIRT732242 KLF4 Kruppel like factor 4 3 1
MIRT735384 SPAG5 sperm associated antigen 5 3 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-367 Medpor NULL NULL Microarray osteoblast-like cells line (MG-63) 18408260 2008 up-regulated
miR-367 Activin A NULL 229455 Quantitative real-time PCR Human embryonic stem (hES) cells 19885849 2010 up-regulated
miR-367 Mistletoe lectin-I NULL NULL Microarray colorectal cancer cells CLY cells 20955366 2011 down-regulated
miR-367 Doxorubicin approved 31703 Quantitative real-time PCR heart 22859947 2012 up-regulated
miR-367 Paclitaxel approved 36314 Microarray Ovarian cancer cell lines 24220856 2014 up-regulated
miR-367 Glucose NULL 5793 Quantitative real-time PCR endothelial cells 24394957 2014 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-367 Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-miR-367-3p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-367-3p Verapamil 2520 NSC272366 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-367-3p Siop Treatment Protocol sensitive High Nephroblastoma tissue
hsa-miR-367-3p Paclitaxel 36314 NSC125973 approved resistant High Pan-Cancer cell line (NCI-H460, NCI-H522, NCI-H322M, HOP62, A549, EKVX, MALME-3M, NCI-H226, HT-29, HCT-116, SE-620, HCT-15, HCC2998, COLO205, HS-578T, NCI/ADR-RES, OVCAR8, OVCAR4, ACHN, SN-12C, 786-O, CAKI-1, UO-31, TK-10, A498, SK-MEL-28, UACC-257, M14, UACC-62, SK
hsa-miR-367-3p Doxorubicin 31703 NSC123127 approved sensitive High Hepatocellular Carcinoma tissue and cell line (HepG2)
hsa-miR-367-3p Mitoxantrone 4212 NSC279836 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-367-3p Sorafenib 216239 NSC747971 approved sensitive Low Hepatocellular Carcinoma cell line (SKhep1, HA22T)
hsa-miR-367-3p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-367-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-367-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM36)
hsa-miR-367-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-367-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (SKOV3)
hsa-miR-367-3p Cisplatin 5460033 NSC119875 approved resistant cell line (IGROV-1)
hsa-miR-367-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)

Error report submission