>CDK2|NM_001798|3'UTR
   1 TAGCCTTCTTGAAGCCCCCAGCCCTAATCTCACCCTCTCCTCCAGTGTGGGCTTGACCAGGCTTGGCCTTGGGCTATTTG
  81 GACTCAGGTGGGCCCTCTGAACTTGCCTTAAACACTCACCTTCTAGTCTTGGCCAGCCAACTCTGGGAATACAGGGGTGA
 161 AAGGGGGGAACCAGTGAAAATGAAAGGAAGTTTCAGTATTAGATGCACTTAAGTTAGCCTCCACCACCCTTTCCCCCTTC
 241 TCTTAGTTATTGCTGAAGAGGGTTGGTATAAAAATAATTTTAAAAAAGCCTTCCTACACGTTAGATTTGCCGTACCAATC
 321 TCTGAATGCCCCATAATTATTATTTCCAGTGTTTGGGATGACCAGGATCCCAAGCCTCCTGCTGCCACAATGTTTATAAA
 401 GGCCAAATGATAGCGGGGGCTAAGTTGGTGCTTTTGAGAACCAAGTAAAACAAAACCACTGGGAGGAGTCTATTTTAAAG
 481 AATTCGGTTGAAAAAATAGATCCAATCAGTTTATACCCTAGTTAGTGTTTTGCCTCACCTAATAGGCTGGGAGACTGAAG
 561 ACTCAGCCCGGGTGGGGCTGCAGAAAAATGATTGGCCCCAGTCCCCTTGTTTGTCCCTTCTACAGGCATGAGGAATCTGG
 641 GAGGCCCTGAGACAGGGATTGTGCTTCATTCCAATCTATTGCTTCACCATGGCCTTATGAGGCAGGTGAGAGATGTTTGA
 721 ATTTTTCTCTTCCTTTTAGTATTCTTAGTTGTTCAGTTGCCAAGGATCCCTGATCCCATTTTCCTCTGACGTCCACCTCC
 801 TACCCCATAGGAGTTAGAAGTTAGGGTTTAGGCATCATTTTGAGAATGCTGACACTTTTTCAGGGCTGTGATTGAGTGAG
 881 GGCATGGGTAAAAATATTTCTTTAAAAGAAGGATGAACAATTATATTTATATTTCAGGTTATATCCAATAGTAGAGTTGG
 961 CTTTTTTTTTTTTTTTTTGGTCATAGTGGGTGGATTTGTTGCCATGTGCACCTTGGGGTTTTGTAATGACAGTGCTAAAA
1041 AAAAAAAGCATTTTTTTTTTATGATTTGTCTCTGTCACCCTTGTCCTTGAGTGCTCTTGCTATTAACGTTATTTGTAATT
1121 TAGTTTGTAGCTCATTAAAAAAATGTGCCTAGTTTTATAGTTCA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' gguucucuacaacCGGGAUUg 5' ||||||| Target 5' cttgaagcccccaGCCCTAAt 3'	8 - 28	140.00	-10.20
2	miRNA 3' ggUUCUCUA---CAACCGGGAUUg 5' :||: || | ||||||:| Target 5' atGAGGAATCTGGGAGGCCCTGAg 3'	628 - 651	135.00	-14.70
3	miRNA 3' gguucuCUACAACCGGGAUUg 5' || || |||:||| Target 5' ccctctGAACTT-GCCTTAAa 3'	93 - 112	130.00	-6.80

Mutant ID	Mutant Position	Mutant Source
COSN9752008	30	COSMIC
COSN31498983	44	COSMIC
COSN30103898	48	COSMIC
COSN30487649	69	COSMIC
COSN30456889	70	COSMIC
COSN31558636	81	COSMIC
COSN30481637	89	COSMIC
COSN17132223	99	COSMIC
COSN19615239	125	COSMIC
COSN16131057	166	COSMIC
COSN23873485	263	COSMIC
COSN25512808	283	COSMIC
COSN31534411	284	COSMIC
COSN7617174	314	COSMIC
COSN21074676	623	COSMIC
COSN24763360	642	COSMIC
COSN17115735	980	COSMIC
COSN27380789	1048	COSMIC
COSN20092587	1049	COSMIC
COSN20109709	1061	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs756431656	2	dbSNP
rs775746539	2	dbSNP
rs778384377	6	dbSNP
rs370764349	7	dbSNP
rs747730518	11	dbSNP
rs1278978846	12	dbSNP
rs769449368	13	dbSNP
rs1219396507	15	dbSNP
rs1261509520	17	dbSNP
rs771141097	19	dbSNP
rs772695055	20	dbSNP
rs964163575	20	dbSNP
rs199608364	22	dbSNP
rs1466798761	27	dbSNP
rs1431639436	32	dbSNP
rs1175510293	36	dbSNP
rs746075723	40	dbSNP
rs780438038	44	dbSNP
rs1271986641	45	dbSNP
rs375161401	45	dbSNP
rs150844112	52	dbSNP
rs762975567	53	dbSNP
rs1223534681	58	dbSNP
rs1374472181	62	dbSNP
rs979703308	68	dbSNP
rs967650927	70	dbSNP
rs1439323335	73	dbSNP
rs1404320278	79	dbSNP
rs1370429116	82	dbSNP
rs925120379	84	dbSNP
rs977611014	89	dbSNP
rs928895419	93	dbSNP
rs1343615095	98	dbSNP
rs556622666	136	dbSNP
rs1399948156	141	dbSNP
rs1038940533	160	dbSNP
rs923155837	164	dbSNP
rs1452430837	165	dbSNP
rs578201551	167	dbSNP
rs942131854	172	dbSNP
rs545329816	173	dbSNP
rs1191216119	175	dbSNP
rs933008347	178	dbSNP
rs1489274452	183	dbSNP
rs1047359802	194	dbSNP
rs78839552	197	dbSNP
rs929832700	203	dbSNP
rs1432466295	210	dbSNP
rs1288597568	223	dbSNP
rs1046975536	224	dbSNP
rs891061858	225	dbSNP
rs769212296	237	dbSNP
rs1039411746	263	dbSNP
rs1005953019	276	dbSNP
rs1038315728	283	dbSNP
rs899578509	284	dbSNP
rs1256534980	286	dbSNP
rs1288572961	289	dbSNP
rs1011777385	290	dbSNP
rs2069414	291	dbSNP
rs185176709	300	dbSNP
rs1035945646	301	dbSNP
rs998995647	302	dbSNP
rs1035872845	312	dbSNP
rs960255468	313	dbSNP
rs77800683	314	dbSNP
rs960307044	315	dbSNP
rs1010253129	319	dbSNP
rs1185640021	321	dbSNP
rs1488374788	336	dbSNP
rs1265823921	337	dbSNP
rs1440710705	347	dbSNP
rs1209126270	351	dbSNP
rs561025822	356	dbSNP
rs530962774	358	dbSNP
rs1485532712	363	dbSNP
rs969230220	376	dbSNP
rs1195914668	382	dbSNP
rs1257148130	383	dbSNP
rs776982553	390	dbSNP
rs1305908942	391	dbSNP
rs978864412	414	dbSNP
rs925140356	415	dbSNP
rs1294867428	416	dbSNP
rs1215398588	423	dbSNP
rs1342550761	428	dbSNP
rs964581296	436	dbSNP
rs1412741978	446	dbSNP
rs1023426698	452	dbSNP
rs543403721	458	dbSNP
rs187996196	472	dbSNP
rs1303415305	473	dbSNP
rs974527135	476	dbSNP
rs1191301621	477	dbSNP
rs963487367	481	dbSNP
rs973861186	487	dbSNP
rs1169075693	488	dbSNP
rs748196369	500	dbSNP
rs929767432	502	dbSNP
rs1475120417	506	dbSNP
rs923206733	517	dbSNP
rs933227582	532	dbSNP
rs1047411647	543	dbSNP
rs1466521051	556	dbSNP
rs1202714321	557	dbSNP
rs1479913848	569	dbSNP
rs912466712	570	dbSNP
rs2069415	571	dbSNP
rs1399452358	572	dbSNP
rs899464562	584	dbSNP
rs551359828	587	dbSNP
rs1298272793	593	dbSNP
rs773431735	594	dbSNP
rs1339494892	597	dbSNP
rs1397727330	601	dbSNP
rs941810548	602	dbSNP
rs1297507857	605	dbSNP
rs1465736728	607	dbSNP
rs1401830475	617	dbSNP
rs1173938221	619	dbSNP
rs1043177464	637	dbSNP
rs761006694	638	dbSNP
rs998963079	647	dbSNP
rs560314408	651	dbSNP
rs896067856	654	dbSNP
rs1013154765	660	dbSNP
rs766243858	665	dbSNP
rs905571241	674	dbSNP
rs139315029	676	dbSNP
rs1271345190	693	dbSNP
rs1001728800	697	dbSNP
rs1057291966	705	dbSNP
rs963669070	709	dbSNP
rs1265846626	717	dbSNP
rs1255980398	722	dbSNP
rs973446573	739	dbSNP
rs1026803957	743	dbSNP
rs1045431	745	dbSNP
rs950800908	748	dbSNP
rs982610992	750	dbSNP
rs1045435	752	dbSNP
rs150018903	755	dbSNP
rs1010474099	761	dbSNP
rs868118964	769	dbSNP
rs1404424794	772	dbSNP
rs537898436	773	dbSNP
rs1488100887	782	dbSNP
rs943862644	784	dbSNP
rs1164605127	786	dbSNP
rs549750817	791	dbSNP
rs901145357	800	dbSNP
rs571128080	805	dbSNP
rs921212331	809	dbSNP
rs192837653	810	dbSNP
rs1020334452	811	dbSNP
rs924344552	812	dbSNP
rs183769262	818	dbSNP
rs1000568856	822	dbSNP
rs188152093	824	dbSNP
rs1045019193	833	dbSNP
rs1240808127	843	dbSNP
rs964449692	850	dbSNP
rs1441435858	854	dbSNP
rs974579109	856	dbSNP
rs1435175854	857	dbSNP
rs1331154584	873	dbSNP
rs1325179976	876	dbSNP
rs536444370	878	dbSNP
rs923090725	886	dbSNP
rs145177569	890	dbSNP
rs1380163188	897	dbSNP
rs1360291564	916	dbSNP
rs899444565	921	dbSNP
rs1331349011	924	dbSNP
rs954668180	930	dbSNP
rs1294863902	947	dbSNP
rs1390981972	956	dbSNP
rs1387772739	961	dbSNP
rs1173441518	962	dbSNP
rs1217023325	962	dbSNP
rs1378485864	962	dbSNP
rs879239362	962	dbSNP
rs11554377	965	dbSNP
rs576139031	966	dbSNP
rs1278162122	975	dbSNP
rs1369494996	979	dbSNP
rs1242892761	980	dbSNP
rs201910075	981	dbSNP
rs1353000722	983	dbSNP
rs1214743942	984	dbSNP
rs1267521345	986	dbSNP
rs1276039318	987	dbSNP
rs967167646	988	dbSNP
rs979557623	992	dbSNP
rs925423154	999	dbSNP
rs1339389934	1002	dbSNP
rs1209065901	1003	dbSNP
rs1402298958	1005	dbSNP
rs868228798	1011	dbSNP
rs1334161636	1012	dbSNP
rs1415480005	1019	dbSNP
rs543506821	1023	dbSNP
rs1166183961	1024	dbSNP
rs1179100387	1031	dbSNP
rs1477638252	1035	dbSNP
rs1491418654	1035	dbSNP
rs1437342261	1036	dbSNP
rs1491105155	1036	dbSNP
rs1442873334	1037	dbSNP
rs1478712022	1037	dbSNP
rs36104085	1037	dbSNP
rs71074879	1037	dbSNP
rs373075561	1049	dbSNP
rs376138301	1050	dbSNP
rs1316723585	1051	dbSNP
rs34939741	1051	dbSNP
rs370805507	1051	dbSNP
rs796667871	1051	dbSNP
rs1220084721	1055	dbSNP
rs983324911	1061	dbSNP
rs1166285797	1062	dbSNP
rs1368723006	1064	dbSNP
rs1457074787	1065	dbSNP
rs1449432737	1066	dbSNP
rs1293334354	1069	dbSNP
rs1342745715	1103	dbSNP
rs1392689700	1105	dbSNP
rs907750219	1106	dbSNP
rs1019043679	1109	dbSNP
rs941707963	1112	dbSNP
rs1173173530	1118	dbSNP
rs975288607	1129	dbSNP
rs1411372413	1141	dbSNP
rs1181017415	1144	dbSNP
rs1332562652	1144	dbSNP
rs921164617	1150	dbSNP
rs1239177395	1153	dbSNP
rs1222205746	1164	dbSNP

- Cell, 2010

RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.

- Nature, 2013

Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.

- Genome research, 2016

DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.