pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4457 |
Genomic Coordinates | chr5: 1309310 - 1309377 |
Description | Homo sapiens miR-4457 stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | ||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4457 | |||||||||||||||||||||
Sequence | 43| UCACAAGGUAUUGACUGGCGUA |64 | |||||||||||||||||||||
Evidence | Experimental | |||||||||||||||||||||
Experiments | Illumina | |||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | HOXA5 | ||||||||||||||||||||
Synonyms | HOX1, HOX1.3, HOX1C | ||||||||||||||||||||
Description | homeobox A5 | ||||||||||||||||||||
Transcript | NM_019102 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on HOXA5 | |||||||||||||||||||||
3'UTR of HOXA5 (miRNA target sites are highlighted) |
>HOXA5|NM_019102|3'UTR 1 GTATCTGAGCGTTTAAAGTACTGAGCAGTATTAGCGGATCCCGCGTAGTGTCAGTACTAAGGTGACTTTCTGAAACTCCC 81 TTGTGTTCCTTCTGTGAAGAAGCCCTGTTCTCGTTGCCCTAATTCATCTTTTAATCATGAGCCTGTTTATTGCCATTATA 161 GCGCCTGTATAAGTAGATCTGCTTTCTGTTCATCTCTTTGTCCTGAATGGCTTTGTCTTGAAAAAAAATAGATGTTTTAA 241 CTTATTTATATGAAGCAAGCTGTGTTACTTGAAGTAACTATAACAAAAAAAGAAAAGAGAAAAAAAAACACACAAAAAGT 321 CCCCCTTCAATCTCGTTTAGTGCCAATGTTGTGTGTTGCACTCAAGTTGTTTAACTGTGCATGTGCGTGGAAGTGTTCCT 401 GTCTCAATAGCTCCAAGCTGTTAAAGATATTTTTATTCAAACTACCTATATTCCTTGTGTAATTAATGCTGTTGTAGAGG 481 TGACTTGATGAGACACAACTTGTTCGACGTGTAGTGACTAGTGACTCTGTGATGAAAACTGTGACTCCAAGCGGTGTGTC 561 CCTGCGTGCCTTTATAGGACCCTTTGCACGAACTCTGGAAGTGGCTCTTATAAGCGCAGCTTCAGTGATGTATGTTTTTG 641 TGAACAAAGTTACAAATATTGTCCAAGTCTGGCTGTTTTAAGCAAACTGTGATCAGCTTTTTTTTTTTTTTTTTTTTTTT 721 TGTATTTGTTTTTAAGGAAAAAATACTGACTGGAACAAAAAATAAACTTTCTATTGTAAGTTC Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Disease | 3202.0 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
CLIP-seq Support 1 for dataset GSM1065668 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_7 |
Location of target site | ENST00000222726.3 | 3UTR | AUAUUUUUAUUCAAACUACCUAUAUUC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23446348 / GSE43573 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
83 hsa-miR-4457 Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT098032 | SOBP | sine oculis binding protein homolog | 2 | 2 | ||||||||
MIRT202580 | PCMTD2 | protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2 | 2 | 6 | ||||||||
MIRT247137 | WEE1 | WEE1 G2 checkpoint kinase | 2 | 4 | ||||||||
MIRT349266 | PTBP1 | polypyrimidine tract binding protein 1 | 2 | 2 | ||||||||
MIRT363756 | EIF4EBP1 | eukaryotic translation initiation factor 4E binding protein 1 | 2 | 2 | ||||||||
MIRT443586 | FAM84B | family with sequence similarity 84 member B | 2 | 2 | ||||||||
MIRT452333 | EIF5AL1 | eukaryotic translation initiation factor 5A-like 1 | 2 | 2 | ||||||||
MIRT453864 | ZBTB40 | zinc finger and BTB domain containing 40 | 2 | 4 | ||||||||
MIRT471486 | PDE4D | phosphodiesterase 4D | 2 | 4 | ||||||||
MIRT476290 | GMFB | glia maturation factor beta | 2 | 8 | ||||||||
MIRT479897 | CCDC117 | coiled-coil domain containing 117 | 2 | 4 | ||||||||
MIRT484251 | ANK1 | ankyrin 1 | 2 | 2 | ||||||||
MIRT491473 | TMEM214 | transmembrane protein 214 | 2 | 2 | ||||||||
MIRT493804 | GAN | gigaxonin | 2 | 6 | ||||||||
MIRT499252 | VAV3 | vav guanine nucleotide exchange factor 3 | 2 | 4 | ||||||||
MIRT502271 | HNRNPA1 | heterogeneous nuclear ribonucleoprotein A1 | 2 | 4 | ||||||||
MIRT504651 | RPL9 | ribosomal protein L9 | 2 | 6 | ||||||||
MIRT505211 | UBN2 | ubinuclein 2 | 2 | 8 | ||||||||
MIRT508952 | SNRPB | small nuclear ribonucleoprotein polypeptides B and B1 | 2 | 4 | ||||||||
MIRT512691 | POP1 | POP1 homolog, ribonuclease P/MRP subunit | 2 | 2 | ||||||||
MIRT513320 | SCUBE3 | signal peptide, CUB domain and EGF like domain containing 3 | 2 | 2 | ||||||||
MIRT513870 | HOXA5 | homeobox A5 | 2 | 2 | ||||||||
MIRT517342 | ZNF529 | zinc finger protein 529 | 2 | 4 | ||||||||
MIRT518947 | LSG1 | large 60S subunit nuclear export GTPase 1 | 2 | 2 | ||||||||
MIRT520867 | SUGT1 | SGT1 homolog, MIS12 kinetochore complex assembly cochaperone | 2 | 2 | ||||||||
MIRT528325 | GIGYF2 | GRB10 interacting GYF protein 2 | 2 | 2 | ||||||||
MIRT531990 | SLCO1B3 | solute carrier organic anion transporter family member 1B3 | 2 | 2 | ||||||||
MIRT533298 | USP46 | ubiquitin specific peptidase 46 | 2 | 2 | ||||||||
MIRT545257 | TRIM36 | tripartite motif containing 36 | 2 | 4 | ||||||||
MIRT547038 | POGZ | pogo transposable element derived with ZNF domain | 2 | 2 | ||||||||
MIRT556103 | MOAP1 | modulator of apoptosis 1 | 2 | 2 | ||||||||
MIRT558321 | DR1 | down-regulator of transcription 1 | 2 | 2 | ||||||||
MIRT558521 | CSRNP3 | cysteine and serine rich nuclear protein 3 | 2 | 2 | ||||||||
MIRT560906 | TMED10 | transmembrane p24 trafficking protein 10 | 2 | 2 | ||||||||
MIRT568448 | ARPP19 | cAMP regulated phosphoprotein 19 | 2 | 2 | ||||||||
MIRT570586 | OTUD7B | OTU deubiquitinase 7B | 2 | 2 | ||||||||
MIRT572799 | SIGLEC14 | sialic acid binding Ig like lectin 14 | 2 | 2 | ||||||||
MIRT573863 | C9orf78 | chromosome 9 open reading frame 78 | 2 | 2 | ||||||||
MIRT575058 | P2ry1 | purinergic receptor P2Y, G-protein coupled 1 | 2 | 5 | ||||||||
MIRT609931 | SLC38A1 | solute carrier family 38 member 1 | 2 | 4 | ||||||||
MIRT610836 | ZNF585A | zinc finger protein 585A | 2 | 4 | ||||||||
MIRT611474 | P2RY1 | purinergic receptor P2Y1 | 2 | 7 | ||||||||
MIRT613569 | YY2 | YY2 transcription factor | 2 | 2 | ||||||||
MIRT618626 | GREB1 | growth regulation by estrogen in breast cancer 1 | 2 | 2 | ||||||||
MIRT620606 | SAP30 | Sin3A associated protein 30 | 2 | 2 | ||||||||
MIRT621017 | CLSTN3 | calsyntenin 3 | 2 | 4 | ||||||||
MIRT635314 | FAM179A | TOG array regulator of axonemal microtubules 2 | 2 | 2 | ||||||||
MIRT635919 | GLTSCR2 | NOP53 ribosome biogenesis factor | 2 | 2 | ||||||||
MIRT640598 | TM9SF4 | transmembrane 9 superfamily member 4 | 2 | 2 | ||||||||
MIRT641784 | YWHAB | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta | 2 | 4 | ||||||||
MIRT644067 | IQCE | IQ motif containing E | 2 | 2 | ||||||||
MIRT648288 | TRAPPC2L | trafficking protein particle complex 2 like | 2 | 2 | ||||||||
MIRT658085 | FOXR2 | forkhead box R2 | 2 | 2 | ||||||||
MIRT659077 | DEPTOR | DEP domain containing MTOR interacting protein | 2 | 2 | ||||||||
MIRT665307 | ZBTB37 | zinc finger and BTB domain containing 37 | 2 | 2 | ||||||||
MIRT665975 | SYTL4 | synaptotagmin like 4 | 2 | 2 | ||||||||
MIRT666302 | SLC25A25 | solute carrier family 25 member 25 | 2 | 2 | ||||||||
MIRT674906 | RASSF9 | Ras association domain family member 9 | 2 | 2 | ||||||||
MIRT680086 | THAP1 | THAP domain containing 1 | 2 | 2 | ||||||||
MIRT681488 | DIP2A | disco interacting protein 2 homolog A | 2 | 2 | ||||||||
MIRT691244 | DFNB59 | pejvakin | 2 | 2 | ||||||||
MIRT692362 | AGTRAP | angiotensin II receptor associated protein | 2 | 2 | ||||||||
MIRT693035 | MB21D1 | Mab-21 domain containing 1 | 2 | 2 | ||||||||
MIRT693837 | STAT5A | signal transducer and activator of transcription 5A | 2 | 2 | ||||||||
MIRT694479 | LRTOMT | leucine rich transmembrane and O-methyltransferase domain containing | 2 | 2 | ||||||||
MIRT696070 | ZNF264 | zinc finger protein 264 | 2 | 2 | ||||||||
MIRT696578 | TTC21B | tetratricopeptide repeat domain 21B | 2 | 2 | ||||||||
MIRT696760 | MTFMT | mitochondrial methionyl-tRNA formyltransferase | 2 | 2 | ||||||||
MIRT697307 | ZNF652 | zinc finger protein 652 | 2 | 2 | ||||||||
MIRT700152 | RNF115 | ring finger protein 115 | 2 | 2 | ||||||||
MIRT701056 | PARP2 | poly(ADP-ribose) polymerase 2 | 2 | 2 | ||||||||
MIRT701198 | OTUD3 | OTU deubiquitinase 3 | 2 | 2 | ||||||||
MIRT701335 | NSD1 | nuclear receptor binding SET domain protein 1 | 2 | 2 | ||||||||
MIRT702656 | ITGA3 | integrin subunit alpha 3 | 2 | 2 | ||||||||
MIRT703618 | FBXO45 | F-box protein 45 | 2 | 2 | ||||||||
MIRT704673 | CHTOP | chromatin target of PRMT1 | 2 | 2 | ||||||||
MIRT708894 | ZNF780A | zinc finger protein 780A | 2 | 2 | ||||||||
MIRT711620 | DGKH | diacylglycerol kinase eta | 2 | 2 | ||||||||
MIRT713745 | TMEM81 | transmembrane protein 81 | 2 | 2 | ||||||||
MIRT719712 | CD101 | CD101 molecule | 2 | 2 | ||||||||
MIRT720294 | DLGAP3 | DLG associated protein 3 | 2 | 2 | ||||||||
MIRT722606 | CCDC152 | coiled-coil domain containing 152 | 2 | 2 | ||||||||
MIRT724566 | ACSBG1 | acyl-CoA synthetase bubblegum family member 1 | 2 | 2 |
miRNA-Drug Associations | ||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|