miRTarBase - #MIRT513944


—
pre-miRNA Information
pre-miRNA hsa-mir-4653   
Genomic Coordinates chr7: 101159473 - 101159555
Description Homo sapiens miR-4653 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4653-5p
Sequence 10| UCUCUGAGCAAGGCUUAACACC |31
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs566953516 2 dbSNP
rs1307365749 4 dbSNP
rs1226652366 6 dbSNP
rs1216592229 12 dbSNP
rs1283699546 15 dbSNP
rs934609749 20 dbSNP
rs1377199291 21 dbSNP
rs1282994534 22 dbSNP
Putative Targets

Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
B8DF7B miR-4653 Predictive Biomarker (PRD) Transcriptomic Data . . . .
Gene Information
Gene Symbol DDX3X   
Synonyms CAP-Rf, DBX, DDX14, DDX3, HLP2, MRX102
Description DEAD-box helicase 3, X-linked
Transcript NM_001356   
Expression
Putative miRNA Targets on DDX3X
3'UTR of DDX3X
(miRNA target sites are highlighted)		 
>DDX3X|NM_001356|3'UTR
   1 GCCTGCTTTGCAGTAGGTCACCCTGCCAAACAAGCTAATATGGAAACCACATGTAACTTAGCCAGACTATACCTTGTGTA
  81 GCTTCAAGAACTCGCAGTACATTACCAGCTGTGATTCTCCACTGAAATTTTTTTTTTAAGGGAGCTCAAGGTCACAAGAA
 161 GAAATGAAAGGAACAATCAGCAGCCCTGTTCAGAAGGTGGTTTGAAGACTTCATTGCTGTAGTTTGGATTAACTCCCCTC
 241 CCGCCTACCCCCATCCCAAACTGCATTTATAATTTTGTGACTGAGGATCATTTGTTTGTTAATGTACTGTGCCTTTAACT
 321 TTAGACAACTTTTTATTTTGATGTCCTGTTGGCTCAGTAATGCTCAAGATATCAATTGTTTTGACAAAATAAATTTACTG
 401 AACTTGGGCTAAAATCAAACCTTGGCACACAGGTGTGATACAACTTAACAGGAATCATCGATTCATCCATAAATAATATA
 481 AGGAAAAACTTATGCGGTAGCCTGCATTAGGGCTTTTTGATACTTGCAGATTGGGGGAAAACAACAAATGTCTTGAAGCA
 561 TATTAATGGAATTAGTTTCTAATGTGGCAAACTGTATTAAGTTAAAGTTCTGATTTGCTCACTCTATCCTGGATAGGTAT
 641 TTAGAACCTGATAGTCTTTAAGCCATTCCAGTCATGATGAGGTGATGTATGAATACATGCATACATTCAAAGCACTGTTT
 721 TCAAAGTTAATGCAAGTAAATACAGCAATTCCTCTTTCAACGTTTAGGCAGATCATTAATTATGAGCTAGCCAAATGTGG
 801 GCATACTATTACAGGGAAAGTTTAAAGGTCTGATAACTTGAAATAGGTTTTTAGGAGAATTCATCTACTTAGACTTTTTA
 881 AATGCCTGCCATAAATGAAATTGAAATGGTAGAATGGCTGACCACAGCAATGACCAGCCCTCATTAGGGCCCTGGATGAT
 961 TTTTGGTCTAATAACGCATGCTAGTGTTGATGTTTTTTGGTCAAGAGGGTATGAACAGGAAGAATTAAATGCAGCAGGCT
1041 TTATTTTAAATGCCGATTCACATTACTCTGTTCAAGCTGCGTTGAGATGTTAAACTGGCTTACTATAGACTTCGTAAAAA
1121 TGGCTCCAGAAGAGTAACAAACTGAAATCTTTGAGATCACACAGGTTGGAAATATGTACATAACTGCACAAGGTGTCAAT
1201 TCTGCTCTACAGTGCAGTTTTAGTCAGTTTTAGTTGCATAGGTTTCCATTGTATTTATAGTCTGTTTATGCTAAATCTGG
1281 CCAAAGATGAGCATTGTCCACCACTAAAATGCCTCTGCCACTTTGAATTCTGTGCTAATTTTGTGGCCAGAATGCGGTGA
1361 TCAAAACGCTCCATCTTTTTACAGTGGCATAGGAAGACGGCAAAAATTTCCTAAAGTGCAATAGATTTTCAAGTGTATTG
1441 TGCCTTGTTCTAAAACTTTTATTAAGTAGGTGCACTTGACAGTATTGAGGTCATTTGTTATGGTGCTATTTCAATTAGTC
1521 TAGGTTTAGGCCCTTGTACATTTTGCCCATAACTTTTTACAAAGTACTTCTTTTATTGCACATTCAGAGAATTTTATATA
1601 TATGTCTTGTGTGCGTGTCCTTAAACTTCCAATCTTACTTTGTCTCTTGGAGATTGTTGAACGCAGCTTGTCTAGGAAGG
1681 GGATGGGACTAGATTCTAAAATTTATTTGGGACCATGGGAATGATAGTTGGGAAGAAAACTATTTGCACACGACAGATTT
1761 CTAGATACTTTTTGCTGCTAGTTTTATGTAATATTTATTGAACATTTTGACAAATATTTATTTTTGTAAGCCTAAAAGTG
1841 ATTCTTTGAAAGTTTAAAGAAACTTGACCAAAAGACAGTACAAAAACACTGGCACTTGAATGTTGAATGTCACCGTATGC
1921 GTGAAATTATATATTTCGGGGTAGTGTGAGCTTTTAATGTTTAAGTCATATTAAACTCTTAAGTCAAATTAAGCAGACCC
2001 GGCGTTGGCAGTGTAGCCATAACTTTCTGATGTTAGTAAAAACAAAATTGGCGACTTGAAATTAAATCATGCCAAGGTTT
2081 TGATACACTTGTCTTAAGATATTAATGAAACACTTCAAAACACTGATGTGAAGTGTCCAGATTCTCAGATGTTTGTTGTG
2161 TGGATTTTGTTTAGTTGTGTGTTTTTTTTTTTTTTTCAGTGAATGTCTGGCACATTGCAATCCTCAAACATGTGGTTATC
2241 TTTGTTGTATTGGCATAATCAGTGACTTGTACATTCAGCAATAGCATTTGAGCAAGTTTTATCAGCAAGCAATATTTTCA
2321 GTTAATAAGGTTTCAAAAATCATGTAAGGATTTAAACTTGCTGAATGTAAAGATTGAACCTCAAGTCACTGTAGCTTTAG
2401 TAATTGCTTATTGTATTAGTTTAGATGCTAGCACTGCATGTGCTGTGCATATTCTGATTTTATTAAAATAAAAAGTTGAA
2481 CTGCACAGTCTCCTTTGTTGTTGTCAATTGTGGTTTATTTTCAGAGGTGTAAATAAAGTGCTCTTGCCTGAAAAATTGTA
2561 AAATGTTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ccACAAUUCGGA-----ACGAGUCUcu 5'
            ||| |||: |     | ||||||  
Target 5' gaTGTGAAGTGTCCAGATTCTCAGAtg 3'
 2125 - 2151 136.00 -11.90
2 
miRNA  3' ccACAAUUCGGA-ACGAGUCUCu 5'
            |||  :|::| | :|||||| 
Target 5' atTGT--GGTTTATTTTCAGAGg 3'
 2507 - 2527 136.00 -10.40
3 
miRNA  3' ccacaauUCGGAACGAGUCUcu 5'
                 |||| ||:|||||  
Target 5' aatcagcAGCCCTGTTCAGAag 3'
 175 - 196 131.00 -15.70
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs761187616 2 dbSNP
rs746863718 3 dbSNP
rs768473702 4 dbSNP
rs776609516 7 dbSNP
rs1204081529 8 dbSNP
rs1348074660 14 dbSNP
rs748100931 21 dbSNP
rs769230915 22 dbSNP
rs1236954563 23 dbSNP
rs772742027 24 dbSNP
rs762467559 29 dbSNP
rs1349058942 32 dbSNP
rs1424227581 40 dbSNP
rs766101073 42 dbSNP
rs972463796 52 dbSNP
rs1169127900 54 dbSNP
rs754064835 56 dbSNP
rs952501851 81 dbSNP
rs1328229472 94 dbSNP
rs985040046 95 dbSNP
rs755187450 96 dbSNP
rs1383054324 102 dbSNP
rs1175831941 107 dbSNP
rs943507901 118 dbSNP
rs1300181162 127 dbSNP
rs1171639212 128 dbSNP
rs962482657 128 dbSNP
rs1242684681 138 dbSNP
rs1388757094 139 dbSNP
rs1191831062 147 dbSNP
rs1039183098 151 dbSNP
rs778745778 152 dbSNP
rs1259101086 161 dbSNP
rs923443460 162 dbSNP
rs933365420 165 dbSNP
rs764539353 166 dbSNP
rs1280101517 175 dbSNP
rs1053633235 177 dbSNP
rs1347355771 192 dbSNP
rs1342056503 197 dbSNP
rs939247104 198 dbSNP
rs1216762770 221 dbSNP
rs992871072 223 dbSNP
rs754205996 230 dbSNP
rs1415649893 241 dbSNP
rs1205924505 243 dbSNP
rs1012020929 244 dbSNP
rs372583916 252 dbSNP
rs1167270173 258 dbSNP
rs1474110199 277 dbSNP
rs1419423041 290 dbSNP
rs1041784596 291 dbSNP
rs1209653125 316 dbSNP
rs1485120176 323 dbSNP
rs905828369 329 dbSNP
rs1208440542 336 dbSNP
rs936191108 373 dbSNP
rs1001408656 374 dbSNP
rs141148280 384 dbSNP
rs1316089939 386 dbSNP
rs1295171475 399 dbSNP
rs1234032480 406 dbSNP
rs1355048552 410 dbSNP
rs1423538754 415 dbSNP
rs1478190157 436 dbSNP
rs1282711044 441 dbSNP
rs1172545984 445 dbSNP
rs1366957515 446 dbSNP
rs1039895211 453 dbSNP
rs1035452036 459 dbSNP
rs998833215 460 dbSNP
rs750738573 461 dbSNP
rs1056357 466 dbSNP
rs993854773 470 dbSNP
rs747950068 479 dbSNP
rs952397173 480 dbSNP
rs1204392224 481 dbSNP
rs1397898932 484 dbSNP
rs1456807873 487 dbSNP
rs1297512247 490 dbSNP
rs1275665342 494 dbSNP
rs1340989779 496 dbSNP
rs984225088 497 dbSNP
rs191078702 502 dbSNP
rs1225710948 503 dbSNP
rs183543802 516 dbSNP
rs1215839614 521 dbSNP
rs1309911956 524 dbSNP
rs1278700251 528 dbSNP
rs772040867 538 dbSNP
rs773176719 540 dbSNP
rs964925651 545 dbSNP
rs975005455 556 dbSNP
rs1460405668 580 dbSNP
rs1033916495 584 dbSNP
rs1160780260 585 dbSNP
rs777617499 587 dbSNP
rs960671126 591 dbSNP
rs1406857452 593 dbSNP
rs1178397139 595 dbSNP
rs1438303306 596 dbSNP
rs1255370095 598 dbSNP
rs747067311 599 dbSNP
rs1194820364 600 dbSNP
rs1468053596 602 dbSNP
rs1245093163 625 dbSNP
rs1218093395 634 dbSNP
rs992462951 642 dbSNP
rs12838867 647 dbSNP
rs1283892673 649 dbSNP
rs1237677834 659 dbSNP
rs923410846 660 dbSNP
rs917260646 666 dbSNP
rs933499622 675 dbSNP
rs945996989 682 dbSNP
rs28364818 693 dbSNP
rs977414349 695 dbSNP
rs1056358 714 dbSNP
rs1364826739 717 dbSNP
rs775642389 718 dbSNP
rs754909334 720 dbSNP
rs189047420 722 dbSNP
rs1161240185 733 dbSNP
rs913342647 741 dbSNP
rs1344233505 744 dbSNP
rs192439219 746 dbSNP
rs1418196022 749 dbSNP
rs770374177 750 dbSNP
rs1174774836 758 dbSNP
rs370210510 759 dbSNP
rs150291427 761 dbSNP
rs937228791 762 dbSNP
rs1188388874 770 dbSNP
rs1262661204 775 dbSNP
rs1056992853 776 dbSNP
rs1486500970 781 dbSNP
rs759161501 784 dbSNP
rs1280820902 809 dbSNP
rs1254214422 811 dbSNP
rs1233343628 812 dbSNP
rs1423294486 814 dbSNP
rs1164511172 818 dbSNP
rs994435964 821 dbSNP
rs1214578256 829 dbSNP
rs770595846 831 dbSNP
rs769385297 833 dbSNP
rs772848431 838 dbSNP
rs934261141 841 dbSNP
rs1416281268 842 dbSNP
rs1051748158 847 dbSNP
rs1313850389 849 dbSNP
rs774766683 869 dbSNP
rs776206800 880 dbSNP
rs1003873359 887 dbSNP
rs1429134732 898 dbSNP
rs1361127563 904 dbSNP
rs1432857432 929 dbSNP
rs1037982553 936 dbSNP
rs1191726249 941 dbSNP
rs1476291761 944 dbSNP
rs1258545901 946 dbSNP
rs1199657920 949 dbSNP
rs898278507 969 dbSNP
rs1252943624 976 dbSNP
rs1001879814 977 dbSNP
rs1300989799 982 dbSNP
rs1306376509 988 dbSNP
rs1275726222 1007 dbSNP
rs184422133 1020 dbSNP
rs1355677530 1029 dbSNP
rs1292364226 1035 dbSNP
rs770503392 1036 dbSNP
rs1395739193 1053 dbSNP
rs1400529378 1053 dbSNP
rs188053707 1055 dbSNP
rs1462971011 1056 dbSNP
rs1400264049 1059 dbSNP
rs1168594661 1063 dbSNP
rs1316727676 1065 dbSNP
rs1418762091 1066 dbSNP
rs758990835 1066 dbSNP
rs1350972903 1076 dbSNP
rs764675036 1082 dbSNP
rs1421784852 1107 dbSNP
rs1252448891 1111 dbSNP
rs966617551 1114 dbSNP
rs1238454753 1118 dbSNP
rs1457248666 1125 dbSNP
rs1256149144 1132 dbSNP
rs977445435 1141 dbSNP
rs1215008588 1143 dbSNP
rs925932716 1154 dbSNP
rs1264435519 1155 dbSNP
rs1285703279 1156 dbSNP
rs1317862541 1158 dbSNP
rs1218617373 1162 dbSNP
rs1271314799 1163 dbSNP
rs1339031638 1164 dbSNP
rs957456713 1176 dbSNP
rs1236216499 1181 dbSNP
rs750904417 1188 dbSNP
rs761286900 1200 dbSNP
rs921448167 1202 dbSNP
rs777316498 1203 dbSNP
rs144966805 1210 dbSNP
rs1159553230 1212 dbSNP
rs1051267844 1214 dbSNP
rs773809766 1215 dbSNP
rs1195434209 1222 dbSNP
rs908822334 1227 dbSNP
rs1266088065 1243 dbSNP
rs1207592176 1249 dbSNP
rs940263723 1258 dbSNP
rs1261007980 1263 dbSNP
rs764737853 1263 dbSNP
rs752012524 1265 dbSNP
rs1402223957 1266 dbSNP
rs1038012318 1269 dbSNP
rs1477104618 1279 dbSNP
rs1443796906 1287 dbSNP
rs762261667 1289 dbSNP
rs1322951376 1291 dbSNP
rs1385223672 1306 dbSNP
rs1387415525 1316 dbSNP
rs1289675436 1322 dbSNP
rs1001964578 1325 dbSNP
rs766527316 1332 dbSNP
rs1378279923 1338 dbSNP
rs5963957 1339 dbSNP
rs1338065735 1344 dbSNP
rs750762642 1348 dbSNP
rs1377052415 1350 dbSNP
rs1445631205 1354 dbSNP
rs755214981 1357 dbSNP
rs896229208 1358 dbSNP
rs765441946 1363 dbSNP
rs1013879402 1364 dbSNP
rs763165535 1369 dbSNP
rs1277123651 1372 dbSNP
rs1284281935 1389 dbSNP
rs1237018292 1390 dbSNP
rs1312074178 1393 dbSNP
rs1346307635 1399 dbSNP
rs966648040 1400 dbSNP
rs1328293693 1404 dbSNP
rs1204422229 1430 dbSNP
rs768052807 1455 dbSNP
rs1399665379 1456 dbSNP
rs1265125033 1457 dbSNP
rs750774419 1459 dbSNP
rs1033012566 1460 dbSNP
rs1435167324 1461 dbSNP
rs1401404636 1462 dbSNP
rs957322741 1467 dbSNP
rs1476080456 1476 dbSNP
rs1198318500 1483 dbSNP
rs1233665628 1488 dbSNP
rs766544623 1515 dbSNP
rs1476621875 1516 dbSNP
rs1471044263 1521 dbSNP
rs1259249406 1523 dbSNP
rs1213454767 1530 dbSNP
rs975429362 1532 dbSNP
rs1278470517 1558 dbSNP
rs1189189198 1562 dbSNP
rs1424396370 1563 dbSNP
rs1341516122 1565 dbSNP
rs1480697833 1565 dbSNP
rs1178458916 1570 dbSNP
rs1218146846 1586 dbSNP
rs780315155 1589 dbSNP
rs1295422189 1590 dbSNP
rs1397559593 1595 dbSNP
rs1464635469 1598 dbSNP
rs921385613 1601 dbSNP
rs1329207075 1603 dbSNP
rs955465927 1603 dbSNP
rs1355852126 1604 dbSNP
rs987403766 1607 dbSNP
rs191556194 1609 dbSNP
rs1273403070 1610 dbSNP
rs1169323377 1611 dbSNP
rs1367309661 1616 dbSNP
rs1419480709 1617 dbSNP
rs908687069 1631 dbSNP
rs1473304674 1634 dbSNP
rs1224718275 1639 dbSNP
rs1285739322 1647 dbSNP
rs940294830 1649 dbSNP
rs755064861 1657 dbSNP
rs1259335126 1663 dbSNP
rs1198019387 1671 dbSNP
rs1273994778 1684 dbSNP
rs1275228800 1694 dbSNP
rs1439722700 1698 dbSNP
rs758067575 1715 dbSNP
rs781079886 1739 dbSNP
rs752699164 1741 dbSNP
rs1219142762 1743 dbSNP
rs1282187881 1744 dbSNP
rs755892218 1746 dbSNP
rs937707942 1747 dbSNP
rs1054796685 1748 dbSNP
rs1421382643 1751 dbSNP
rs1477212035 1752 dbSNP
rs1396065129 1757 dbSNP
rs754009150 1767 dbSNP
rs896250715 1769 dbSNP
rs949152601 1814 dbSNP
rs1161816279 1815 dbSNP
rs1411247556 1815 dbSNP
rs1442006822 1837 dbSNP
rs1167931443 1856 dbSNP
rs1421246939 1875 dbSNP
rs1042259619 1897 dbSNP
rs746905097 1908 dbSNP
rs1456468480 1921 dbSNP
rs1254933570 1926 dbSNP
rs1403287060 1930 dbSNP
rs902325961 1932 dbSNP
rs1288068646 1938 dbSNP
rs1225189619 1939 dbSNP
rs1354161625 1946 dbSNP
rs757222373 1963 dbSNP
rs1032293764 1965 dbSNP
rs1293584333 1979 dbSNP
rs1373154570 1979 dbSNP
rs1435205657 1993 dbSNP
rs780661126 2005 dbSNP
rs1219175866 2014 dbSNP
rs143157550 2023 dbSNP
rs1319885604 2024 dbSNP
rs1421844874 2027 dbSNP
rs1365411949 2032 dbSNP
rs1405933685 2034 dbSNP
rs997275515 2050 dbSNP
rs1028310821 2051 dbSNP
rs745431132 2053 dbSNP
rs1427934263 2054 dbSNP
rs1191839083 2084 dbSNP
rs1488198721 2087 dbSNP
rs749041943 2088 dbSNP
rs184335138 2100 dbSNP
rs986879731 2106 dbSNP
rs1226808944 2111 dbSNP
rs1285010983 2118 dbSNP
rs1270808165 2119 dbSNP
rs1349952545 2129 dbSNP
rs1301978236 2138 dbSNP
rs1218060905 2139 dbSNP
rs1341527904 2140 dbSNP
rs1015716120 2144 dbSNP
rs778479330 2153 dbSNP
rs974204784 2154 dbSNP
rs879175688 2155 dbSNP
rs920217454 2161 dbSNP
rs1224354767 2169 dbSNP
rs1260954973 2173 dbSNP
rs1177439884 2174 dbSNP
rs1423187461 2176 dbSNP
rs1425058200 2176 dbSNP
rs1432613395 2176 dbSNP
rs1478259866 2180 dbSNP
rs1487898852 2180 dbSNP
rs1193769456 2181 dbSNP
rs1275915491 2182 dbSNP
rs1304619885 2182 dbSNP
rs1339439427 2182 dbSNP
rs1491236593 2182 dbSNP
rs201921813 2182 dbSNP
rs745349949 2182 dbSNP
rs745437857 2182 dbSNP
rs1398473587 2183 dbSNP
rs201313897 2183 dbSNP
rs771773583 2184 dbSNP
rs1465956341 2185 dbSNP
rs1471514984 2187 dbSNP
rs1172895256 2196 dbSNP
rs1162351215 2197 dbSNP
rs866735665 2198 dbSNP
rs769484966 2199 dbSNP
rs1165804525 2201 dbSNP
rs188774286 2204 dbSNP
rs1425284066 2214 dbSNP
rs1256634640 2217 dbSNP
rs1359224895 2221 dbSNP
rs1382198766 2230 dbSNP
rs1240020679 2240 dbSNP
rs1198652508 2245 dbSNP
rs762349811 2267 dbSNP
rs181503639 2270 dbSNP
rs1445909834 2272 dbSNP
rs1321986986 2279 dbSNP
rs772277504 2291 dbSNP
rs917563452 2296 dbSNP
rs1333959339 2300 dbSNP
rs1314639250 2303 dbSNP
rs1383729009 2304 dbSNP
rs14554 2313 dbSNP
rs1283670483 2323 dbSNP
rs1369328336 2334 dbSNP
rs949178489 2339 dbSNP
rs1421837483 2340 dbSNP
rs1205703952 2342 dbSNP
rs1042124013 2367 dbSNP
rs902255490 2369 dbSNP
rs773582897 2373 dbSNP
rs1456898193 2376 dbSNP
rs763252865 2381 dbSNP
rs708452 2389 dbSNP
rs1211169031 2390 dbSNP
rs1488597996 2390 dbSNP
rs766604206 2392 dbSNP
rs751771731 2409 dbSNP
rs1244440369 2411 dbSNP
rs1053597919 2412 dbSNP
rs1243394799 2416 dbSNP
rs1312039890 2424 dbSNP
rs1064198 2434 dbSNP
rs900446674 2446 dbSNP
rs996079824 2448 dbSNP
rs3209046 2455 dbSNP
rs1329380276 2464 dbSNP
rs878952279 2467 dbSNP
rs1388665300 2470 dbSNP
rs1391636539 2471 dbSNP
rs1446035893 2473 dbSNP
rs1028759725 2475 dbSNP
rs1456150414 2475 dbSNP
rs1381971534 2481 dbSNP
rs1438979404 2484 dbSNP
rs185737091 2484 dbSNP
rs767643733 2487 dbSNP
rs1200372174 2493 dbSNP
rs1378471289 2493 dbSNP
rs1433273788 2494 dbSNP
rs1266159951 2495 dbSNP
rs752787065 2495 dbSNP
rs1489950380 2497 dbSNP
rs1378910915 2501 dbSNP
rs1288563214 2503 dbSNP
rs891087653 2510 dbSNP
rs1008275330 2511 dbSNP
rs1015666690 2518 dbSNP
rs961438951 2530 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545215. RNA binding protein: AGO4. Condition:Control PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 1654.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ccACAAUUCGGAACGAGUCUCu 5'
            | |||   |   :|||||| 
Target 5' ucUUUUAUUGCACAUUCAGAGa 3'
 		24 - 45
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 1654.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 1654.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM4903833
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_a
Location of target site NM_001193416 | 3UTR | CACAUUCAGAGAAUUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM4903835
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_c
Location of target site NM_001356 | 3UTR | CAUUCAGAGAAUUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM4903836
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_a
Location of target site NM_001356 | 3UTR | UUUUAUUGCACAUUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000399959.2 | 3UTR | UACUUCUUUUAUUGCACAUUCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000399959.2 | 3UTR | UACUUCUUUUAUUGCACAUUCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM545215
Method / RBP PAR-CLIP / AGO4
Cell line / Condition HEK293 / Control
Location of target site ENST00000399959.2 | 3UTR | UACUUCUUUUAUUGCACAUUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000399959.2 | 3UTR | ACAUUUUGCCCAUAACUUUUUACAAAGUACUUCUUUUAUUGCACAUUCAGAGAAUUUUAUAUAUAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000399959.2 | 3UTR | UACUUCUUUUAUUGCACAUUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 9 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000399959.2 | 3UTR | UUGUACAUUUUGCCCAUAACUUUUUACAAAGUACUUCUUUUAUUGCACAUUCAGAGAAUUUUAUAUAUAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 10 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000399959.2 | 3UTR | CCCAUAACUUUUUACAAAGUACUUCUUUUAUUGCACAUUCAGAGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 11 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000399959.2 | 3UTR | CCCAUAACUUUUUACAAAGUACUUCUUUUAUUGCACAUUCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
CLIP-seq Support 12 for dataset GSM1065668
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_7
Location of target site ENST00000399959.2 | 3UTR | UACUUCUUUUAUUGCACAUUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
78 hsa-miR-4653-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT118186 ZNF544 zinc finger protein 544 2 2
MIRT332935 PRKAB2 protein kinase AMP-activated non-catalytic subunit beta 2 2 2
MIRT442166 ARL10 ADP ribosylation factor like GTPase 10 2 2
MIRT442387 CLVS2 clavesin 2 2 2
MIRT442595 SIX1 SIX homeobox 1 2 2
MIRT448014 HLA-DOA major histocompatibility complex, class II, DO alpha 2 2
MIRT448061 MMP15 matrix metallopeptidase 15 2 2
MIRT489017 C1QTNF6 C1q and TNF related 6 2 2
MIRT494456 BTG2 BTG anti-proliferation factor 2 2 2
MIRT495650 SLC35B2 solute carrier family 35 member B2 2 2
MIRT504016 ACSL6 acyl-CoA synthetase long chain family member 6 2 2
MIRT506777 KLHL15 kelch like family member 15 2 4
MIRT507229 FOXN2 forkhead box N2 2 4
MIRT512550 MFN2 mitofusin 2 2 6
MIRT512842 A1CF APOBEC1 complementation factor 2 6
MIRT513944 DDX3X DEAD-box helicase 3, X-linked 2 8
MIRT516103 GADL1 glutamate decarboxylase like 1 2 4
MIRT519831 ZFP69B ZFP69 zinc finger protein B 2 4
MIRT523210 HIST1H3E histone cluster 1 H3 family member e 2 2
MIRT525008 ACTN4 actinin alpha 4 2 6
MIRT528858 PKP1 plakophilin 1 2 2
MIRT529062 ZNF675 zinc finger protein 675 2 2
MIRT531719 TARS threonyl-tRNA synthetase 2 2
MIRT534039 STK4 serine/threonine kinase 4 2 2
MIRT543848 APIP APAF1 interacting protein 2 2
MIRT545866 ZNF264 zinc finger protein 264 2 4
MIRT556037 MXD1 MAX dimerization protein 1 2 2
MIRT557081 HOXB3 homeobox B3 2 2
MIRT561345 ZBTB18 zinc finger and BTB domain containing 18 2 2
MIRT562705 ZNF415 zinc finger protein 415 2 2
MIRT563223 ZNF286A zinc finger protein 286A 2 2
MIRT563860 ZNF616 zinc finger protein 616 2 4
MIRT563879 PAGR1 PAXIP1 associated glutamate rich protein 1 2 2
MIRT564652 ZNF487P zinc finger protein 487 1 1
MIRT566595 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 2
MIRT570878 ZFP1 ZFP1 zinc finger protein 2 2
MIRT573067 TRIB1 tribbles pseudokinase 1 2 2
MIRT573941 ZNF708 zinc finger protein 708 2 2
MIRT575966 Slfn5 schlafen 5 2 5
MIRT607293 CD300E CD300e molecule 2 4
MIRT608187 ERBB2 erb-b2 receptor tyrosine kinase 2 2 2
MIRT609537 ADPRH ADP-ribosylarginine hydrolase 2 2
MIRT610152 PRMT8 protein arginine methyltransferase 8 2 4
MIRT611571 SLFN5 schlafen family member 5 2 7
MIRT613335 AGO2 argonaute 2, RISC catalytic component 2 4
MIRT616560 ZNF512B zinc finger protein 512B 2 2
MIRT617240 SPATS2 spermatogenesis associated serine rich 2 2 2
MIRT618011 SLC9A3R2 SLC9A3 regulator 2 2 2
MIRT618478 IL17REL interleukin 17 receptor E like 2 2
MIRT619099 IFI44L interferon induced protein 44 like 2 2
MIRT622265 SH3TC2 SH3 domain and tetratricopeptide repeats 2 2 2
MIRT623080 NME6 NME/NM23 nucleoside diphosphate kinase 6 2 2
MIRT625621 LILRB2 leukocyte immunoglobulin like receptor B2 2 2
MIRT627844 PLEKHA6 pleckstrin homology domain containing A6 2 2
MIRT630459 GMPS guanine monophosphate synthase 2 2
MIRT630524 BAZ2A bromodomain adjacent to zinc finger domain 2A 2 4
MIRT631502 TAF8 TATA-box binding protein associated factor 8 2 2
MIRT634537 MRPS17 mitochondrial ribosomal protein S17 2 2
MIRT638807 DCTN3 dynactin subunit 3 2 2
MIRT641303 SLAMF1 signaling lymphocytic activation molecule family member 1 2 2
MIRT648347 PPP1R16B protein phosphatase 1 regulatory subunit 16B 2 2
MIRT649705 ZNF175 zinc finger protein 175 2 2
MIRT652554 TLX1 T-cell leukemia homeobox 1 2 2
MIRT655564 P2RX7 purinergic receptor P2X 7 2 2
MIRT659065 DEPTOR DEP domain containing MTOR interacting protein 2 2
MIRT660341 BCAT1 branched chain amino acid transaminase 1 2 2
MIRT664330 RAB8A RAB8A, member RAS oncogene family 2 2
MIRT688934 ATXN7L3B ataxin 7 like 3B 2 2
MIRT689971 ZNF185 zinc finger protein 185 with LIM domain 2 2
MIRT699514 SKIL SKI like proto-oncogene 2 2
MIRT699975 RREB1 ras responsive element binding protein 1 2 2
MIRT702676 IRS2 insulin receptor substrate 2 2 2
MIRT709357 ULK2 unc-51 like autophagy activating kinase 2 2 2
MIRT709837 PAQR7 progestin and adipoQ receptor family member 7 2 2
MIRT718716 ANKRD18A ankyrin repeat domain 18A 2 2
MIRT718879 PDIA3 protein disulfide isomerase family A member 3 2 2
MIRT724105 TMEM199 transmembrane protein 199 2 2
MIRT724763 PSG4 pregnancy specific beta-1-glycoprotein 4 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4653 Paclitaxel 36314 NSC125973 approved sensitive High Nasopharyngeal Cancer cell line (CNE-1)
hsa-mir-4653 Paclitaxel 36314 NSC125973 approved sensitive High Nasopharyngeal Cancer cell line (CNE-1)
hsa-mir-4653 Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-4653-5p Gefitinib 123631 NSC715055 approved resistant cell line (PC9)

Error report submission