miRTarBase - #MIRT514287


—
pre-miRNA Information
pre-miRNA hsa-mir-4265   
Genomic Coordinates chr2: 109141490 - 109141588
Description Homo sapiens miR-4265 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4265
Sequence 71| CUGUGGGCUCAGCUCUGGG |89
Evidence Experimental
Experiments SOLiD
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs547651740 6 dbSNP
rs1455791249 7 dbSNP
rs4676066 12 dbSNP
rs1186905902 15 dbSNP
rs1293703157 18 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol FXYD5   
Synonyms DYSAD, HSPC113, IWU1, KCT1, OIT2, PRO6241, RIC
Description FXYD domain containing ion transport regulator 5
Transcript NM_001164605   
Other Transcripts NM_014164 , NM_144779   
Expression
Putative miRNA Targets on FXYD5
3'UTR of FXYD5
(miRNA target sites are highlighted)		 
>FXYD5|NM_001164605|3'UTR
   1 GTCCATCAGAAACAGGAGCTGACAACCTGCTGGGCACCCGAAGACCAAGCCCCCTGCCAGCTCACCGTGCCCAGCCTCCT
  81 GCATCCCCTCGAAGAGCCTGGCCAGAGAGGGAAGACACAGATGATGAAGCTGGAGCCAGGGCTGCCGGTCCGAGTCTCCT
 161 ACCTCCCCCAACCCTGCCCGCCCCTGAAGGCTACCTGGCGCCTTGGGGGCTGTCCCTCAAGTTATCTCCTCTGCTAAGAC
 241 AAAAAGTAAAGCACTGTGGTCTTTGCCCCAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gggucucGAC--UCGGGUGuc 5'
                 |||  |||:|||  
Target 5' aagccccCTGCCAGCTCACcg 3'
 47 - 67 114.00 -14.40
2 
miRNA  3' ggGUCUCGACUCGGGUGuc 5'
            ||   ||  ||||:|  
Target 5' ccCAACCCT--GCCCGCcc 3'
 167 - 183 105.00 -12.80
3 
miRNA  3' ggGUC-UCG-ACUCGGGUGUc 5'
            ||| | |  ||||: ||| 
Target 5' atCAGAAACAGGAGCTGACAa 3'
 5 - 25 105.00 -13.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31575884 18 COSMIC
COSN18742271 29 COSMIC
COSN13798767 30 COSMIC
COSN30137599 36 COSMIC
COSN30487434 39 COSMIC
COSN18716374 52 COSMIC
COSN31603322 54 COSMIC
COSN26565130 68 COSMIC
COSN31575877 95 COSMIC
COSN30161627 102 COSMIC
COSN30511331 118 COSMIC
COSN28681722 153 COSMIC
COSN31610356 169 COSMIC
COSN1214668 262 COSMIC
COSN21827350 262 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs371459976 4 dbSNP
rs201779969 8 dbSNP
rs1293501539 11 dbSNP
rs971157066 24 dbSNP
rs775039510 27 dbSNP
rs1046294 29 dbSNP
rs374136501 30 dbSNP
rs755659670 32 dbSNP
rs955891262 40 dbSNP
rs766072565 41 dbSNP
rs1482305672 47 dbSNP
rs948930279 51 dbSNP
rs1418703614 53 dbSNP
rs914454686 59 dbSNP
rs780748625 61 dbSNP
rs1045959828 67 dbSNP
rs559369154 68 dbSNP
rs953931465 76 dbSNP
rs1194456342 77 dbSNP
rs929436805 80 dbSNP
rs533690554 92 dbSNP
rs887851547 96 dbSNP
rs985273587 103 dbSNP
rs1006260810 104 dbSNP
rs1211442801 110 dbSNP
rs1356742070 115 dbSNP
rs368699970 115 dbSNP
rs1225218607 116 dbSNP
rs574000332 121 dbSNP
rs1219346950 124 dbSNP
rs1278353318 125 dbSNP
rs1018005245 136 dbSNP
rs1403718636 139 dbSNP
rs944793305 147 dbSNP
rs1465443861 148 dbSNP
rs1407467244 151 dbSNP
rs143873147 152 dbSNP
rs3458 153 dbSNP
rs146882632 157 dbSNP
rs1426400996 166 dbSNP
rs1171498275 168 dbSNP
rs1182826432 170 dbSNP
rs1267078744 173 dbSNP
rs1049350335 179 dbSNP
rs140736585 180 dbSNP
rs765508688 181 dbSNP
rs1044588558 184 dbSNP
rs1031452143 185 dbSNP
rs957343157 187 dbSNP
rs570020111 198 dbSNP
rs193021834 200 dbSNP
rs1031837723 201 dbSNP
rs955757669 204 dbSNP
rs1276072851 216 dbSNP
rs1457323614 219 dbSNP
rs915565551 229 dbSNP
rs1011644916 232 dbSNP
rs1046345 235 dbSNP
rs1343106924 237 dbSNP
rs749039799 251 dbSNP
rs1444959116 254 dbSNP
rs928832719 255 dbSNP
rs929498451 265 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 53827.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gggucucgacucgGGUGUc 5'
                       ||||| 
Target 5' -------------CCACAc 3'
 		1 - 6
2 
miRNA  3' gggucucgacucGGGU-GUC---- 5'
                      |||| ||     
Target 5' cacaccuauaacCCCAGCACUUUG 3'
 		2 - 25
Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000588699.1 | 3UTR | CCACACCUAUAACCCCAGCACUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
47 hsa-miR-4265 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT061451 NEK7 NIMA related kinase 7 2 2
MIRT121365 RNF4 ring finger protein 4 2 2
MIRT184855 FLVCR1 feline leukemia virus subgroup C cellular receptor 1 2 2
MIRT458214 SHMT2 serine hydroxymethyltransferase 2 2 2
MIRT468493 SESN2 sestrin 2 2 2
MIRT470574 POTEM POTE ankyrin domain family member M 2 2
MIRT470604 POTEG POTE ankyrin domain family member G 2 2
MIRT470897 PLIN3 perilipin 3 2 2
MIRT484480 SLC9A1 solute carrier family 9 member A1 2 2
MIRT486669 WDR81 WD repeat domain 81 2 2
MIRT490907 STRN4 striatin 4 2 2
MIRT493426 KCNK3 potassium two pore domain channel subfamily K member 3 2 2
MIRT504168 FAM127B retrotransposon Gag like 8A 2 2
MIRT510345 ZNF703 zinc finger protein 703 2 6
MIRT514287 FXYD5 FXYD domain containing ion transport regulator 5 2 2
MIRT520125 WSB1 WD repeat and SOCS box containing 1 2 2
MIRT522065 ORAI2 ORAI calcium release-activated calcium modulator 2 2 2
MIRT530484 FADS6 fatty acid desaturase 6 2 2
MIRT536055 MCFD2 multiple coagulation factor deficiency 2 2 2
MIRT546050 VMA21 VMA21, vacuolar ATPase assembly factor 2 4
MIRT549084 C5orf51 chromosome 5 open reading frame 51 2 4
MIRT551250 NLRP9 NLR family pyrin domain containing 9 2 2
MIRT559432 ARSJ arylsulfatase family member J 2 2
MIRT565560 SMAD5 SMAD family member 5 2 2
MIRT566348 POLDIP2 DNA polymerase delta interacting protein 2 2 2
MIRT572109 DNAJC24 DnaJ heat shock protein family (Hsp40) member C24 2 2
MIRT572646 ID4 inhibitor of DNA binding 4, HLH protein 2 2
MIRT608936 SATB1 SATB homeobox 1 2 2
MIRT610608 ARHGAP18 Rho GTPase activating protein 18 2 2
MIRT612582 SYNGAP1 synaptic Ras GTPase activating protein 1 2 4
MIRT628951 UBE2D4 ubiquitin conjugating enzyme E2 D4 (putative) 2 2
MIRT631030 ZNF878 zinc finger protein 878 2 2
MIRT633020 DNAL1 dynein axonemal light chain 1 2 2
MIRT633252 ZNF581 zinc finger protein 581 2 2
MIRT637165 TMEM50A transmembrane protein 50A 2 2
MIRT637264 KLHL12 kelch like family member 12 2 2
MIRT641366 RABGEF1 RAB guanine nucleotide exchange factor 1 2 2
MIRT653808 SIN3A SIN3 transcription regulator family member A 2 2
MIRT663202 DARS2 aspartyl-tRNA synthetase 2, mitochondrial 2 2
MIRT694269 ZNF529 zinc finger protein 529 2 4
MIRT708318 NT5C 5', 3'-nucleotidase, cytosolic 2 2
MIRT710038 POLL DNA polymerase lambda 2 2
MIRT717092 PXDC1 PX domain containing 1 2 2
MIRT721739 SDK2 sidekick cell adhesion molecule 2 2 2
MIRT721877 TMPRSS6 transmembrane protease, serine 6 2 2
MIRT723340 SCRT1 scratch family transcriptional repressor 1 2 2
MIRT725561 CPT1A carnitine palmitoyltransferase 1A 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4265 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-4265 Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)

Error report submission