>PSMG2|NM_020232|3'UTR
   1 TCTAATTTCTGTTTTATACCTTATACCCAAAACACTTACTACCAACACAGCTGTTAAACATTCTATACAAAAAAATTGTA
  81 TGATCTGGTATTAGGAAATTACTTTCACAGTAAATATCAAAGAAAAAAGATTAAGGGTCTCTTTGCCATGCTTTTCATCA
 161 TATGCACCAAATGTAAATTTTGTACAATAAAATTTTATTTCCTAAGTAAAAAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' acUUUACGUUU-GGACGUUUUGa 5' |||||:||| ::||:| ||: Target 5' ccAAATGTAAATTTTGTACAATa 3'	167 - 189	116.00	-7.60
2	miRNA 3' acuuuacGUUUGGACGUUUUGa 5' || | |||: |||| Target 5' ctaccaaCACAGCTGTTAAACa 3'	39 - 60	111.00	-6.40

Mutant ID	Mutant Position	Mutant Source
COSN20043843	29	COSMIC
COSN31574240	33	COSMIC
COSN15812755	59	COSMIC
COSN1203532	76	COSMIC
COSN31549654	76	COSMIC
COSN30498212	90	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs763296049	4	dbSNP
rs374794817	10	dbSNP
rs1299630143	12	dbSNP
rs1350767837	17	dbSNP
rs1222550369	21	dbSNP
rs1400720805	25	dbSNP
rs1284112036	27	dbSNP
rs754939856	28	dbSNP
rs778362474	29	dbSNP
rs747705923	31	dbSNP
rs771698286	32	dbSNP
rs766642262	34	dbSNP
rs1192814113	35	dbSNP
rs772805697	40	dbSNP
rs746675667	44	dbSNP
rs367766905	47	dbSNP
rs11537901	60	dbSNP
rs569176002	63	dbSNP
rs1227576045	64	dbSNP
rs539767017	66	dbSNP
rs557683960	76	dbSNP
rs572912172	79	dbSNP
rs76346542	81	dbSNP
rs1210349048	87	dbSNP
rs904081890	89	dbSNP
rs1294679833	90	dbSNP
rs1442049645	99	dbSNP
rs138774345	106	dbSNP
rs1331214515	120	dbSNP
rs1052915387	126	dbSNP
rs1183649452	130	dbSNP
rs1405696251	138	dbSNP
rs1174514548	140	dbSNP
rs1481490371	144	dbSNP
rs1252105744	148	dbSNP
rs901092602	149	dbSNP
rs1176586010	155	dbSNP
rs1472021816	162	dbSNP
rs1468480084	166	dbSNP
rs555556042	171	dbSNP
rs1039191567	174	dbSNP
rs901614047	181	dbSNP
rs574111198	182	dbSNP
rs1025973124	202	dbSNP
rs544042587	204	dbSNP
rs1163151730	209	dbSNP
rs1223716163	210	dbSNP

- Cell, 2010

RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.

- Nature, 2013

Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.