miRTarBase - #MIRT514651


—
pre-miRNA Information
pre-miRNA hsa-mir-1246   
Genomic Coordinates chr2: 176600980 - 176601052
Synonyms MIRN1246, hsa-mir-1246, MIR1246
Description Homo sapiens miR-1246 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-1246
Sequence 11| AAUGGAUUUUUGGAGCAGG |29
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1489969781 2 dbSNP
rs757265617 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CRADD   
Synonyms MRT34, RAIDD
Description CASP2 and RIPK1 domain containing adaptor with death domain
Transcript NM_003805   
Expression
Putative miRNA Targets on CRADD
3'UTR of CRADD
(miRNA target sites are highlighted)		 
>CRADD|NM_003805|3'UTR
   1 TGGTGCCTCCAGCAACCGCTGGGGAGTGTGTCCCTGAGTCATGTGGGCTGAATCCTGACTTTCACTCAGAGCAGGTGGTT
  81 TTTTGTGTAGGTTTGTTTTTTATTTTTGATGATCTTCAGATGGAAGGAGAAAACAGGGTTTCCACTAGACATTACTTGAA
 161 AGGCCAGATTACTCAGCAGATCTCCCATGTTGGCTCAACAATTCTTTGTTTTTAATTGCTTGAAGATTGCATTGTTGTAA
 241 TTGTTCAGTTTTTAAATGTGTAATGGCATTTTAATAGACTAGTAAATCACAGTGGTTCAAAATATATATCCATATATATA
 321 TATATCCATATATATATCTCATGTCATCACATTACAGGCAGGTGTCTCATATGTAAAACATTTACCTGAATGTTGTCTGA
 401 GGACTGAACTGTGGACTTTACTATTCATAATGATAAAATAATAAAATGCGAATTACTATATATAATGTGCCTCACTCATG
 481 AGAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ggACGAGGUUU----U-UAGGUAa 5'
            || |:||||    | |||||| 
Target 5' agTGGTTCAAAATATATATCCATa 3'
 291 - 314 127.00 -10.50
2 
miRNA  3' ggaCGAGGUUUUUAGGUAa 5'
             ||| ||| |||:| | 
Target 5' ttgGCT-CAACAATTCTTt 3'
 190 - 207 111.00 -6.02
3 
miRNA  3' ggACGAGGUUUUUAGGUAa 5'
            ||||: ||:| | ||| 
Target 5' atTGCTTGAAGATTGCATt 3'
 215 - 233 105.00 -10.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN13425504 18 COSMIC
COSN30179499 19 COSMIC
COSN31506413 22 COSMIC
COSN30472294 23 COSMIC
COSN31510277 24 COSMIC
COSN30146566 33 COSMIC
COSN30502423 85 COSMIC
COSN30494786 90 COSMIC
COSN30153362 112 COSMIC
COSN21198402 193 COSMIC
COSN7387641 474 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1318796299 1 dbSNP
rs1248468347 6 dbSNP
rs778400680 7 dbSNP
rs1380056364 10 dbSNP
rs749851833 11 dbSNP
rs1360141314 12 dbSNP
rs1333864146 14 dbSNP
rs771595851 16 dbSNP
rs188043096 18 dbSNP
rs575782009 19 dbSNP
rs1388946499 21 dbSNP
rs1449559941 21 dbSNP
rs950627087 23 dbSNP
rs980998062 24 dbSNP
rs772181339 43 dbSNP
rs1237894103 50 dbSNP
rs1209122271 64 dbSNP
rs920085798 75 dbSNP
rs982366717 78 dbSNP
rs1205708259 79 dbSNP
rs548581936 79 dbSNP
rs931421166 82 dbSNP
rs568744889 86 dbSNP
rs1282866976 88 dbSNP
rs1047125439 92 dbSNP
rs908564636 98 dbSNP
rs1380132598 111 dbSNP
rs1284045720 113 dbSNP
rs147660640 126 dbSNP
rs550987757 128 dbSNP
rs1356583441 131 dbSNP
rs1041363921 136 dbSNP
rs990932149 139 dbSNP
rs1369430779 145 dbSNP
rs1166151741 146 dbSNP
rs1253219076 150 dbSNP
rs915321429 159 dbSNP
rs1414060075 172 dbSNP
rs899712695 179 dbSNP
rs142345247 181 dbSNP
rs1471693429 187 dbSNP
rs978048349 193 dbSNP
rs1042932732 194 dbSNP
rs1193353673 197 dbSNP
rs771084618 202 dbSNP
rs1223823229 205 dbSNP
rs1322616634 213 dbSNP
rs1471410300 225 dbSNP
rs11277246 235 dbSNP
rs904335954 244 dbSNP
rs1455680893 251 dbSNP
rs1409804362 258 dbSNP
rs764652310 264 dbSNP
rs547493054 267 dbSNP
rs1395431544 270 dbSNP
rs1461146988 278 dbSNP
rs1475096451 285 dbSNP
rs775748568 295 dbSNP
rs1031396205 298 dbSNP
rs765539348 302 dbSNP
rs1337324599 304 dbSNP
rs959711901 304 dbSNP
rs1163635614 306 dbSNP
rs1013880832 311 dbSNP
rs143488494 312 dbSNP
rs898919353 312 dbSNP
rs994497543 315 dbSNP
rs1159597747 317 dbSNP
rs1025924297 319 dbSNP
rs1249514983 322 dbSNP
rs1023047162 323 dbSNP
rs1192793752 328 dbSNP
rs1488851081 329 dbSNP
rs143283653 332 dbSNP
rs1219678265 336 dbSNP
rs1269208955 341 dbSNP
rs1331462781 341 dbSNP
rs981413458 351 dbSNP
rs1348612005 356 dbSNP
rs1327769433 358 dbSNP
rs1304066026 363 dbSNP
rs1387781608 375 dbSNP
rs886379646 380 dbSNP
rs1027138845 382 dbSNP
rs1433911558 391 dbSNP
rs1390343915 406 dbSNP
rs1035320814 411 dbSNP
rs1321054313 413 dbSNP
rs1456521371 415 dbSNP
rs1409408290 420 dbSNP
rs1273303029 424 dbSNP
rs1178180480 427 dbSNP
rs952855879 428 dbSNP
rs757691861 430 dbSNP
rs959243302 433 dbSNP
rs990613228 449 dbSNP
rs374161520 450 dbSNP
rs114892834 451 dbSNP
rs908595685 459 dbSNP
rs1424614256 461 dbSNP
rs1189522827 464 dbSNP
rs779170673 480 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 8738.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000542893.2 | 3UTR | AUAUAUAUCCAUAUAUAUAUAUAUCCAUAUAUAUAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE32688 Pancreatic cancer -0.362 2.1e-2 -0.454 4.5e-3 32 Click to see details
GSE42095 Differentiated embryonic stem cells -0.388 3.4e-2 -0.425 2.2e-2 23 Click to see details
GSE28544 Breast cancer -0.159 2.3e-1 0.017 4.7e-1 24 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.103 3.1e-1 -0.068 3.7e-1 25 Click to see details
GSE38226 Liver fibrosis 0.038 4.4e-1 -0.291 1.0e-1 21 Click to see details
GSE26953 Aortic valvular endothelial cells -0.014 4.7e-1 -0.074 3.7e-1 24 Click to see details
GSE28260 Renal cortex and medulla 0.015 4.8e-1 -0.060 4.2e-1 13 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
HNSC -0.667 0.07 -0.600 0.1 6 Click to see details
HNSC -0.667 0.07 -0.600 0.1 6 Click to see details
HNSC -0.667 0.07 -0.600 0.1 6 Click to see details
52 hsa-miR-1246 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT053774 DYRK1A dual specificity tyrosine phosphorylation regulated kinase 1A 4 1
MIRT196431 TAOK1 TAO kinase 1 2 6
MIRT444394 ZNF480 zinc finger protein 480 2 2
MIRT447596 MSH3 mutS homolog 3 2 2
MIRT454049 TMBIM4 transmembrane BAX inhibitor motif containing 4 2 2
MIRT458257 ZNF85 zinc finger protein 85 2 2
MIRT461493 KIAA1009 centrosomal protein 162 1 1
MIRT474057 LMNB2 lamin B2 2 2
MIRT479231 CKS2 CDC28 protein kinase regulatory subunit 2 2 6
MIRT485663 CHD7 chromodomain helicase DNA binding protein 7 2 2
MIRT485735 CALM2 calmodulin 2 2 2
MIRT498809 SRRT serrate, RNA effector molecule 2 8
MIRT501190 SKIL SKI like proto-oncogene 2 2
MIRT502619 DGS2 DiGeorge syndrome/velocardiofacial syndrome complex 2 2 6
MIRT502665 CTC1 CST telomere replication complex component 1 2 13
MIRT512313 ADCY9 adenylate cyclase 9 2 6
MIRT513756 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 2 2
MIRT514651 CRADD CASP2 and RIPK1 domain containing adaptor with death domain 2 2
MIRT514865 SHOX2 short stature homeobox 2 2 2
MIRT527109 ARHGAP15 Rho GTPase activating protein 15 2 2
MIRT527145 GPATCH11 G-patch domain containing 11 2 2
MIRT528507 HTR7 5-hydroxytryptamine receptor 7 2 4
MIRT532109 RRP8 ribosomal RNA processing 8 2 2
MIRT534601 RORA RAR related orphan receptor A 2 2
MIRT538906 BRI3BP BRI3 binding protein 2 4
MIRT544541 GDE1 glycerophosphodiester phosphodiesterase 1 2 2
MIRT547430 MED4 mediator complex subunit 4 2 2
MIRT553029 USP48 ubiquitin specific peptidase 48 2 2
MIRT555136 PTPRD protein tyrosine phosphatase, receptor type D 2 2
MIRT562091 KIAA0895 KIAA0895 2 2
MIRT562584 CBX3 chromobox 3 2 4
MIRT563747 ZNF763 zinc finger protein 763 2 2
MIRT573310 AKR7A2 aldo-keto reductase family 7 member A2 2 2
MIRT687232 PLAGL2 PLAG1 like zinc finger 2 2 2
MIRT704465 CREBRF CREB3 regulatory factor 2 2
MIRT718817 PYGO1 pygopus family PHD finger 1 2 2
MIRT731194 NFIB nuclear factor I B 2 1
MIRT732503 SPRED2 sprouty related EVH1 domain containing 2 3 0
MIRT733489 MIF macrophage migration inhibitory factor 2 0
MIRT734071 SRSF1 serine and arginine rich splicing factor 1 2 0
MIRT734733 AR androgen receptor 3 0
MIRT734755 GLS2 glutaminase 2 2 0
MIRT735248 CFTR cystic fibrosis transmembrane conductance regulator 8 1
MIRT736017 ELAVL1 ELAV like RNA binding protein 1 2 0
MIRT736329 DNAH3 dynein axonemal heavy chain 3 2 0
MIRT737381 CCNG2 cyclin G2 2 0
MIRT755524 FOXA2 forkhead box A2 3 1
MIRT755713 DIXDC1 DIX domain containing 1 2 1
MIRT755714 WNT9A Wnt family member 9A 2 1
MIRT755715 RAC2 Rac family small GTPase 2 2 1
MIRT755716 FRAT2 FRAT2, WNT signaling pathway regulator 2 1
MIRT756132 ACE2 angiotensin I converting enzyme 2 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-1 Anthocyanin NULL 145858 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Caffeic acid NULL 689043 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Catechin approved 9064 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-1 Curcumin NULL 969516 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Ferulic acid NULL 445858 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Hesperidin NULL 10621 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-1 Quercetin NULL 5280343 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 up-regulated
miR-1 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 down-regulated
miR-1 Trichostatin A (TSA) NULL 444732 Quantitative real-time PCR myocardial differentiation of mouse ES cells 19521018 2009 down-regulated
miR-1 Sulfonyl-hydrazone-1 (SHZ) NULL NULL Quantitative real-time PCR Murine broblast-derived Induced pluripotent stem cells 21445862 2011 up-regulated
miR-1 Cocaine NULL 446220 Next-generation sequencing ventral striatum 21708909 2011 up-regulated
miR-1 Atorvastatin approved 60823 Quantitative real-time PCR Cardiomyocyte 23860036 2013 down-regualted
miR-1 Glucose NULL 5793 Quantitative real-time PCR endothelial cells 24394957 2014 down-regulated
miR-1 Docosahexaenoic acid NULL 445580 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-1 Palmitic acid approved 985 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-1 17beta-estradiol (E2) approved 5757 Microarray MCF-7AKT breast cancer cells 19528081 2009 down-regulated
miR-1 Essential amino acids (EAA) NULL NULL Quantitative real-time PCR skeletal muscle of young adults 19828686 2009 up-regulated
miR-1 Hydrogen peroxide (H2O2) NULL 784 Quantitative real-time PCR Human umbilical vein endothelial cells 21527937 2011 down-regulated
miR-1 Trichostatin A (TSA) NULL 444732 Microarray apoptosis-resistant breast cancer cells 21971930 2011 up-regulated
miR-1 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-1 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miR-1 Bicalutamide approved 2375 Microarray prostate 22674191 2012 up-regulated
miR-1 Arsenic trioxide approved 14888 Quantitative real-time PCR cardia 22889704 2012 up-regulated
miR-1 Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-1 Quinidine approved 441074 Quantitative real-time PCR myocardial infarction (MI) rats 19775284 2009 up-regulated
miR-1 Tanshinone IIA NULL 164676 Quantitative real-time PCR myocardial infarction (MI) rats 19775284 2009 down-regulated
miR-1 Tanshinone IIA NULL 164676 Quantitative real-time PCR post-infarction rat cardiomyocytes 21220930 2011 down-regulated
miR-1 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 down-regulated
miR-1 Dexamethasone approved 5743 Microarray adrenals and granulosa cells 24205079 2014 up-regulated
miR-1 Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 up-regulated
miR-1 Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 down-regulated
miR-1 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 up-regulated
miR-1246 Hydroxycamptothecin (HCPT) NULL 97226 Microarray human Tenon's fibroblasts (HTFs) 24681041 2014 up-regulated
miR-1246 Ascorbate approved 54670067 Microarray Metastatic melanoma cell lines 25202679 2014 up-regualted
miR-1246 5-Fluorouracil approved 3385 Microarray MCF-7 breast cancer cells 21506117 2011 up-regulated
miR-1246 Marine fungal metabolite 1386A NULL NULL Microarray MCF-7 breast cancer cells. 22159329 2012 down-regulated
miR-1246 Trastuzumab approved NULL Microarray BT474 cells 22384020 2012 up-regulated
miR-1246 Trastuzumab approved NULL Microarray SKBR3 cells. 22384020 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-1246 Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (BGC823)
hsa-miR-1246 Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-1246 Gemcitabine 60750 NSC613327 approved resistant High Bladder Cancer cell line (RT4, J82,TCCSUP, UM-UC-3,RT112,CUBIII)
hsa-miR-1246 Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (HT-29)
hsa-miR-1246 Paclitaxel 36314 NSC125973 approved resistant High Lung Adenocarcinoma cell line (A549)
hsa-miR-1246 Doxorubicin 31703 NSC123127 approved resistant High Gastric Cancer cell line (SGC7901)
hsa-miR-1246 Vincristine 5978 approved resistant High Gastric Cancer cell line (SGC7901)
hsa-miR-1246 Fluorouracil 3385 NSC19893 approved resistant Low Pancreatic Cancer cell line (MIA-PaCa-2, PANC-1)
hsa-miR-1246 Gemcitabine 60750 NSC613327 approved resistant Low Pancreatic Cancer cell line (MIA-PaCa-2, PANC-1)
hsa-miR-1246 Platinum-based doublet chemotherapy sensitive High Lung Adenocarcinoma tissue
hsa-miR-1246 Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Ductal Adenocarcinoma cell line (BxPC-3)
hsa-miR-1246 Bortezomib 387447 NSC681239 approved resistant High Multiple Myeloma cell line
hsa-miR-1246 Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-1246 Mitoxantrone 4212 NSC279836 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-1246 Docetaxel 148124 NSC628503 approved resistant Low Breast Cancer cell line (MDA-MB-231, MCF-7)
hsa-miR-1246 Cisplatin 5460033 NSC119875 approved resistant Low Hepatocellular Carcinoma cell line (Hep3B, Huh-7)
hsa-miR-1246 Fluorouracil 3385 NSC19893 approved resistant Low Hepatocellular Carcinoma cell line (Hep3B, Huh-7)
hsa-miR-1246 Sorafenib 216239 NSC747971 approved resistant Low Hepatocellular Carcinoma cell line (Hep3B, Huh-7)
hsa-miR-1246 Aromatase Inhibitor sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-1246 Docetaxel 148124 NSC628503 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-1246 Epirubicin 41867 NSC256942 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-1246 Vinorelbine 44424639 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-1246 Cisplatin 5460033 NSC119875 approved resistant High Gallbladder Cancer cell line (GBC-SD, NOZ)
hsa-miR-1246 Plx-4720 24180719 NSC757438 resistant Low Melanoma cell line (A375P, SK-MEL-2)
hsa-miR-1246 Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-1246 Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-1246 Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-1246 Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-1246 Paclitaxel 36314 NSC125973 approved resistant High Breast Cancer cell line (BCap37, Bads-200, Bats-72)
hsa-miR-1246 Gemcitabine 60750 NSC613327 approved resistant Low Breast Cancer cell line (MDA-MB-231)
hsa-miR-1246 Docetaxel 148124 NSC628503 approved resistant Low Breast Cancer cell line (MDA-MB-231)
hsa-miR-1246 Epirubicin 41867 NSC256942 approved resistant Low Breast Cancer cell line (MDA-MB-231)
hsa-miR-1246 Cisplatin 5460033 NSC119875 approved resistant Low Oral Cancer cell line (SAS, GNM, OC3, Fadu)
hsa-miR-1246 Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (M14) (1uM)
hsa-miR-1246 Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (M14) (2uM)
hsa-miR-1246 Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (M14) (1uM)
hsa-miR-1246 Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (M14) (200nM)
hsa-miR-1246 Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (M14) (50nM)
hsa-miR-1246 Trametinib 11707110 NSC758246 approved sensitive High Melanoma cell line (M14) (50nM)
hsa-miR-1246 Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (WM266) (200nM)
hsa-miR-1246 Trametinib 11707110 NSC758246 approved sensitive High Melanoma cell line (WM266) (200nM)
hsa-miR-1246 Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (M14) (2uM)
hsa-miR-1246 Trametinib 11707110 NSC758246 approved sensitive High Melanoma cell line (M14) (200nM)
hsa-miR-1246 Paclitaxel 36314 NSC125973 approved resistant Low Ovarian Cancer cell line (HeyA8, SKOV3, A2780, THP-1)
hsa-miR-1246 Cisplatin 5460033 NSC119875 approved resistant Low Tongue Squamous Cell Carcinoma cell line (CAL-27)
hsa-miR-1246 Fluorouracil 3385 NSC19893 approved resistant Low Colorectal Cancer cell line (HCT-116, HCT-8)
hsa-miR-1246 Oxaliplatin 6857599 NSC266046 approved resistant Low Colorectal Cancer cell line (HCT-116, HCT-8)
hsa-miR-1246 Erlotinib 176870 NSC718781 approved sensitive High Head And Neck Squamous Cell Carcinoma cell line (HN6)
hsa-miR-1246 Paclitaxel 36314 NSC125973 approved resistant High Endometrial Serous Carcinoma cell line (USPC1)
hsa-miR-1246 Paclitaxel 36314 NSC125973 approved resistant High Breast Cancer cell line (BCap37)
hsa-miR-1246 Trastuzumab resistant Low HER2-Positive Breast Cancer tissue
hsa-miR-1246 Temozolomide 5394 NSC362856 approved sensitive Low Glioblastoma cell line (U87)
hsa-miR-1246 Doxorubicin 31703 NSC123127 approved resistant Low Leukemia cell line (K562/ADM and HL-60/RS)
hsa-miR-1246 Fluorouracil 3385 NSC19893 approved resistant Low Melanoma cell line (A375)
hsa-miR-1246 Docetaxel 148124 NSC628503 approved sensitive Low Breast Cancer tissue and cell line (MCF-7, MDA-MB-231, MDA-MB-468, SKBR3)
hsa-miR-1246 Antiepileptic Drug resistant High Pediatric Epilepsy tissue
hsa-mir-1246 Vincristine 5978 approved resistant cell line (W1)
hsa-mir-1246 Cisplatin 5460033 NSC119875 approved resistant cell line (KYSE)
hsa-mir-1246 Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-mir-1246 Cisplatin 5460033 NSC119875 approved resistant cell line (BGC-823)
hsa-mir-1246 Decitabine 451668 approved sensitive tissue (esopheageal cancer)
hsa-miR-1246 Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-1246 Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-1246 Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-1246 Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-1246 Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (total RNA)
hsa-miR-1246 Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-1246 Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-1246 Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM47)
hsa-miR-1246 Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM17)
hsa-miR-1246 Vemurafenib 42611257 NSC761431 approved resistant cell line (LM11)
hsa-miR-1246 Vemurafenib 42611257 NSC761431 approved resistant cell line (LM36)
hsa-miR-1246 Paclitaxel 36314 NSC125973 approved sensitive cell line (HS578T)
hsa-miR-1246 Doxorubicin 31703 NSC123127 approved sensitive cell line (HS578T)
hsa-miR-1246 Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-1246 4-Hydroxytamoxifen+Tamoxifen sensitive cell line (LY2)
hsa-miR-1246 Ethanol+Tamoxifen sensitive cell line (LY2)
hsa-miR-1246 Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-miR-1246 Doxorubicin 31703 NSC123127 approved resistant cell line (K562)
hsa-miR-1246 Platinum-based doublet chemotherapy sensitive tissue (lung adenocarcinoma)
hsa-miR-1246 Cisplatin 5460033 NSC119875 approved resistant cell line (IGROV-1)
hsa-miR-1246 Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-1246 Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR3)
hsa-miR-1246 Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)
hsa-miR-1246 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-1246 Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide resistant cell line (Bads-200)
hsa-miR-1246 Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide/Methotrexate/Gemcitabine resistant cell line (Bats-72)
hsa-miR-1246 Cisplatin 5460033 NSC119875 approved sensitive cell line (OVSAHO)
hsa-miR-1246 Cisplatin 5460033 NSC119875 approved resistant cell line (TOV-112D)

Error report submission