miRTarBase - #MIRT515040


—
pre-miRNA Information
pre-miRNA hsa-mir-4421   
Genomic Coordinates chr1: 51059837 - 51059905
Description Homo sapiens miR-4421 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4421
Sequence 43| ACCUGUCUGUGGAAAGGAGCUA |64
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1222858590 1 dbSNP
rs1334405255 19 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol EBNA1BP2   
Synonyms EBP2, NOBP, P40
Description EBNA1 binding protein 2
Transcript NM_001159936   
Other Transcripts NM_006824   
Expression
Putative miRNA Targets on EBNA1BP2
3'UTR of EBNA1BP2
(miRNA target sites are highlighted)		 
>EBNA1BP2|NM_001159936|3'UTR
   1 ATAGCATCTTTGAATACAAAGAACCAAGAAAAAGGAATGAAGACTCGCAATTTCACGACACACTTTGATCCCTTCTGTTG
  81 GTGTCATGTTGTAAACATTTCTTTCAATAAACTAAAGAAAAATTATTAAAGGAACACATACCTTTGGTTAAATAGTCTAG
 161 ACTAAAAGATTGAGAAGTTACTTTCCATTGCTATCTATTGATAATTTAGACATTGAGTTCAAATTGCCTTCATTTTATGA
 241 TAAATAATGATTTAACTGACACCTTCTCAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' auCGA-GGAAAGGU-----GUCUGUcca 5'
            ||| :|| |: |     :|||||   
Target 5' ttGCTATCTATTGATAATTTAGACAttg 3'
 188 - 215 108.00 -5.42
2 
miRNA  3' aucgaGGAAAGGUGUCUGUCca 5'
               |||||   :| |:||  
Target 5' acataCCTTTGGTTAAATAGtc 3'
 136 - 157 89.00 -5.40
3 
miRNA  3' auCG-AGGAA---AGGUGUCU--GUCCa 5'
            || ||:||   | || |||  || | 
Target 5' taGCATCTTTGAATACAAAGAACCAAGa 3'
 2 - 29 88.00 -10.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26974451 1 COSMIC
COSN30112015 21 COSMIC
COSN31580451 28 COSMIC
COSN31490841 39 COSMIC
COSN31612726 47 COSMIC
COSN1446023 55 COSMIC
COSN508027 63 COSMIC
COSN30549661 68 COSMIC
COSN30177889 72 COSMIC
COSN30144507 108 COSMIC
COSN30106933 113 COSMIC
COSN30171826 172 COSMIC
COSN31575276 174 COSMIC
COSN1446022 197 COSMIC
COSN30161921 199 COSMIC
COSN30531976 244 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1220639621 1 dbSNP
rs1377902758 4 dbSNP
rs199606135 13 dbSNP
rs1284437349 17 dbSNP
rs1449566784 26 dbSNP
rs908257273 31 dbSNP
rs984043527 34 dbSNP
rs1358148663 36 dbSNP
rs1239902838 37 dbSNP
rs1476097343 39 dbSNP
rs1297472237 40 dbSNP
rs751184199 46 dbSNP
rs765848305 47 dbSNP
rs542006638 49 dbSNP
rs567573095 54 dbSNP
rs185502846 56 dbSNP
rs1036032642 57 dbSNP
rs1442555307 58 dbSNP
rs1165301238 59 dbSNP
rs1365957234 72 dbSNP
rs952227518 86 dbSNP
rs763954033 105 dbSNP
rs1063395 137 dbSNP
rs940586037 141 dbSNP
rs145925598 142 dbSNP
rs970069669 147 dbSNP
rs1382236392 151 dbSNP
rs545800914 154 dbSNP
rs1804822 157 dbSNP
rs1360580931 158 dbSNP
rs956339820 169 dbSNP
rs1223764661 174 dbSNP
rs1282713694 177 dbSNP
rs769298575 187 dbSNP
rs981899006 237 dbSNP
rs557448428 238 dbSNP
rs796932781 248 dbSNP
rs913230408 249 dbSNP
rs1459976739 253 dbSNP
rs1185014986 254 dbSNP
rs1162946199 255 dbSNP
rs1438796005 258 dbSNP
rs1471999463 262 dbSNP
rs1370599707 263 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 10969.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000431635.2 | 3UTR | ACAGGGUUUCACCACGUUGGCCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
151 hsa-miR-4421 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT293805 FEM1A fem-1 homolog A 2 2
MIRT468824 RSRC2 arginine and serine rich coiled-coil 2 2 6
MIRT470326 PPP6R1 protein phosphatase 6 regulatory subunit 1 2 2
MIRT474293 LAMTOR3 late endosomal/lysosomal adaptor, MAPK and MTOR activator 3 2 2
MIRT480821 BLCAP bladder cancer associated protein 2 10
MIRT496455 N6AMT1 N-6 adenine-specific DNA methyltransferase 1 2 2
MIRT500021 ABCF2 ATP binding cassette subfamily F member 2 2 8
MIRT508622 PLA2G2C phospholipase A2 group IIC 2 2
MIRT514258 S1PR2 sphingosine-1-phosphate receptor 2 2 2
MIRT514574 MAPKAPK5 mitogen-activated protein kinase-activated protein kinase 5 2 4
MIRT515040 EBNA1BP2 EBNA1 binding protein 2 2 2
MIRT515686 TFPI tissue factor pathway inhibitor 2 2
MIRT517385 METTL7A methyltransferase like 7A 2 4
MIRT519320 TIMELESS timeless circadian clock 2 2
MIRT519728 ZNF460 zinc finger protein 460 2 2
MIRT520243 USP9X ubiquitin specific peptidase 9, X-linked 2 4
MIRT520266 URGCP upregulator of cell proliferation 2 2
MIRT523695 FHL2 four and a half LIM domains 2 2 4
MIRT525357 HPR haptoglobin-related protein 2 2
MIRT530203 ALX1 ALX homeobox 1 2 2
MIRT530217 UGDH UDP-glucose 6-dehydrogenase 2 2
MIRT539888 IRGQ immunity related GTPase Q 2 2
MIRT540203 ARHGAP18 Rho GTPase activating protein 18 2 2
MIRT540544 MYO1H myosin IH 2 2
MIRT540946 SLC25A43 solute carrier family 25 member 43 2 2
MIRT541928 ORC1 origin recognition complex subunit 1 2 4
MIRT542086 IKZF3 IKAROS family zinc finger 3 2 2
MIRT542191 FUT1 fucosyltransferase 1 (H blood group) 2 6
MIRT542342 LIMD1 LIM domains containing 1 2 2
MIRT542499 WDR13 WD repeat domain 13 2 2
MIRT542571 ZNF280B zinc finger protein 280B 2 2
MIRT542706 RPS15A ribosomal protein S15a 2 2
MIRT542902 HSBP1 heat shock factor binding protein 1 2 2
MIRT557044 HOXB3 homeobox B3 2 2
MIRT559285 AURKA aurora kinase A 2 2
MIRT563692 RPS26 ribosomal protein S26 2 2
MIRT564324 CCNT1 cyclin T1 2 2
MIRT573774 PRKAG1 protein kinase AMP-activated non-catalytic subunit gamma 1 2 2
MIRT576319 Zfp703 zinc finger protein 703 1 1
MIRT576660 Fam216a family with sequence similarity 216, member A 2 2
MIRT609117 ZNF703 zinc finger protein 703 2 7
MIRT609183 DPY19L3 dpy-19 like C-mannosyltransferase 3 2 4
MIRT610539 FAM46A family with sequence similarity 46 member A 2 4
MIRT611598 JAKMIP3 Janus kinase and microtubule interacting protein 3 2 4
MIRT618036 CTU1 cytosolic thiouridylase subunit 1 2 2
MIRT622442 RNF217 ring finger protein 217 2 2
MIRT622562 PTPN3 protein tyrosine phosphatase, non-receptor type 3 2 2
MIRT623831 GATSL2 cytosolic arginine sensor for mTORC1 subunit 2 2 2
MIRT624397 CD3D CD3d molecule 2 2
MIRT627578 SLC24A4 solute carrier family 24 member 4 2 2
MIRT627862 PITPNM3 PITPNM family member 3 2 2
MIRT631108 SLC15A2 solute carrier family 15 member 2 2 2
MIRT631115 ATCAY ATCAY, caytaxin 2 2
MIRT631204 ZNF724P zinc finger protein 724 2 2
MIRT631454 DLEU1 deleted in lymphocytic leukemia 1 (non-protein coding) 2 2
MIRT632347 SWSAP1 SWIM-type zinc finger 7 associated protein 1 2 2
MIRT633901 FGF10 fibroblast growth factor 10 2 2
MIRT634398 PLSCR1 phospholipid scramblase 1 2 2
MIRT634924 CHMP1B charged multivesicular body protein 1B 2 2
MIRT635867 SLC11A2 solute carrier family 11 member 2 2 2
MIRT636633 CHAF1B chromatin assembly factor 1 subunit B 2 2
MIRT637153 PCDHA6 protocadherin alpha 6 2 2
MIRT640789 GRIK3 glutamate ionotropic receptor kainate type subunit 3 2 2
MIRT645416 FAM110A family with sequence similarity 110 member A 2 2
MIRT645530 ZWINT ZW10 interacting kinetochore protein 2 2
MIRT647100 GNL3L G protein nucleolar 3 like 2 2
MIRT649262 IMPA2 inositol monophosphatase 2 2 2
MIRT650491 UFM1 ubiquitin fold modifier 1 2 2
MIRT650795 GSR glutathione-disulfide reductase 2 2
MIRT651039 ZNF652 zinc finger protein 652 2 2
MIRT654018 SCN2B sodium voltage-gated channel beta subunit 2 2 2
MIRT655523 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 2 2
MIRT657308 HOXA9 homeobox A9 2 2
MIRT657789 GK5 glycerol kinase 5 (putative) 2 4
MIRT659400 CORO2A coronin 2A 2 2
MIRT659992 C2CD2L C2CD2 like 2 2
MIRT661391 RHCG Rh family C glycoprotein 2 2
MIRT662013 ZNF445 zinc finger protein 445 2 2
MIRT664012 LOH12CR1 BLOC-1 related complex subunit 5 2 2
MIRT664052 KIAA1551 KIAA1551 2 2
MIRT667065 PAOX polyamine oxidase 2 2
MIRT669160 CCNG1 cyclin G1 2 2
MIRT669650 ACSBG1 acyl-CoA synthetase bubblegum family member 1 2 2
MIRT673233 KLHDC8A kelch domain containing 8A 2 2
MIRT680480 ATP1B4 ATPase Na+/K+ transporting family member beta 4 2 2
MIRT683571 CARD8 caspase recruitment domain family member 8 2 2
MIRT683816 CBS cystathionine-beta-synthase 2 2
MIRT684555 ZNF708 zinc finger protein 708 2 2
MIRT685418 ACAD8 acyl-CoA dehydrogenase family member 8 2 2
MIRT686046 SLC5A5 solute carrier family 5 member 5 2 2
MIRT686135 B4GALT7 beta-1,4-galactosyltransferase 7 2 2
MIRT686799 SOX12 SRY-box 12 2 2
MIRT687477 NHLRC2 NHL repeat containing 2 2 2
MIRT687951 HHIP hedgehog interacting protein 2 2
MIRT688178 FRRS1 ferric chelate reductase 1 2 2
MIRT688300 FAM208A family with sequence similarity 208 member A 2 2
MIRT688895 C1GALT1 core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase 1 2 2
MIRT689199 ZNF574 zinc finger protein 574 2 2
MIRT690854 PVR poliovirus receptor 2 2
MIRT691258 ICOSLG inducible T-cell costimulator ligand 2 2
MIRT692923 EXOSC2 exosome component 2 2 2
MIRT693625 CENPL centromere protein L 2 2
MIRT694994 GGA2 golgi associated, gamma adaptin ear containing, ARF binding protein 2 2 2
MIRT695368 PHAX phosphorylated adaptor for RNA export 2 2
MIRT696626 WDR77 WD repeat domain 77 2 2
MIRT696686 APOC3 apolipoprotein C3 2 2
MIRT697364 ZNF394 zinc finger protein 394 2 2
MIRT697609 XIAP X-linked inhibitor of apoptosis 2 2
MIRT697733 USP6NL USP6 N-terminal like 2 2
MIRT697785 UBXN7 UBX domain protein 7 2 2
MIRT698357 TMEM127 transmembrane protein 127 2 2
MIRT698484 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 2 2
MIRT699855 SAR1B secretion associated Ras related GTPase 1B 2 2
MIRT704344 DCAF16 DDB1 and CUL4 associated factor 16 2 2
MIRT704595 CLN8 CLN8, transmembrane ER and ERGIC protein 2 2
MIRT705845 AHCY adenosylhomocysteinase 2 2
MIRT706305 NT5C2 5'-nucleotidase, cytosolic II 2 2
MIRT707090 TIMM50 translocase of inner mitochondrial membrane 50 2 2
MIRT707138 TRA2B transformer 2 beta homolog 2 2
MIRT707150 C17orf105 chromosome 17 open reading frame 105 2 2
MIRT707240 H6PD hexose-6-phosphate dehydrogenase/glucose 1-dehydrogenase 2 2
MIRT707352 XPNPEP3 X-prolyl aminopeptidase 3 2 2
MIRT707456 PPFIBP1 PPFIA binding protein 1 2 2
MIRT707499 AXL AXL receptor tyrosine kinase 2 2
MIRT707643 CRIPT CXXC repeat containing interactor of PDZ3 domain 2 2
MIRT707696 FAM118A family with sequence similarity 118 member A 2 2
MIRT707711 CDC6 cell division cycle 6 2 2
MIRT707822 TMEM170A transmembrane protein 170A 2 2
MIRT707963 PDK3 pyruvate dehydrogenase kinase 3 2 2
MIRT708002 NUDT4 nudix hydrolase 4 2 2
MIRT708031 MRPS14 mitochondrial ribosomal protein S14 2 2
MIRT708065 LIX1L limb and CNS expressed 1 like 2 2
MIRT708197 ANP32E acidic nuclear phosphoprotein 32 family member E 2 2
MIRT708206 AHSA2 activator of HSP90 ATPase homolog 2 2 2
MIRT711531 TRIP11 thyroid hormone receptor interactor 11 2 2
MIRT712637 RNF103-CHMP3 RNF103-CHMP3 readthrough 2 2
MIRT713697 CYB5R4 cytochrome b5 reductase 4 2 2
MIRT714244 WIPF2 WAS/WASL interacting protein family member 2 2 2
MIRT714397 FBXO31 F-box protein 31 2 2
MIRT714626 KIAA1143 KIAA1143 2 2
MIRT714911 CHMP3 charged multivesicular body protein 3 2 2
MIRT715568 EPHB4 EPH receptor B4 2 2
MIRT715846 SZT2 SZT2, KICSTOR complex subunit 2 2
MIRT716321 SIGLEC10 sialic acid binding Ig like lectin 10 2 2
MIRT718142 PALM paralemmin 2 2
MIRT720737 ELOVL7 ELOVL fatty acid elongase 7 2 2
MIRT722174 MRPS15 mitochondrial ribosomal protein S15 2 2
MIRT723223 FMNL3 formin like 3 2 2
MIRT723518 SIGLEC8 sialic acid binding Ig like lectin 8 2 2
MIRT724796 C1D C1D nuclear receptor corepressor 2 2
MIRT725280 OSTM1 osteopetrosis associated transmembrane protein 1 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4421 Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-4421 Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-4421 Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-4421 Docetaxel+Cisplatin+5-Fluorouracil sensitive tissue (hypopharyngeal squamous cell carcinoma)

Error report submission