pre-miRNA Information
pre-miRNA hsa-mir-3689d-1   
Genomic Coordinates chr9: 134849609 - 134849682
Description Homo sapiens miR-3689d-1 stem-loop
Comment None
RNA Secondary Structure
pre-miRNA hsa-mir-3689d-2   
Genomic Coordinates chr9: 134850277 - 134850356
Description Homo sapiens miR-3689d-2 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3689d
Sequence 2| GGGAGGUGUGAUCUCACACUCG |23
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs551722268 8 dbSNP
rs143142996 8 dbSNP
rs1236297052 12 dbSNP
rs573148947 14 dbSNP
rs1210004979 14 dbSNP
rs1217460444 14 dbSNP
rs762590109 18 dbSNP
rs574332265 18 dbSNP
rs1164353021 21 dbSNP
rs963741171 21 dbSNP
rs1177416877 22 dbSNP
rs765777344 22 dbSNP
Putative Targets

Gene Information
Gene Symbol ZNF799   
Synonyms HIT-40, ZNF842
Description zinc finger protein 799
Transcript NM_001080821   
Expression
Putative miRNA Targets on ZNF799
3'UTR of ZNF799
(miRNA target sites are highlighted)
>ZNF799|NM_001080821|3'UTR
   1 CATTCTCTCTAAATGTATGGAATGTGGGAAAGCATTTATTAATTTTATTTCATTTCAGATACTTGTACGAAACACATTGG
  81 AGATAGACCCTGTGAATGTAAGCACTTGGTAAAACCTTAAGTAATTTCAGTTTCTTTCCAGTACAGTCATCCCTTGATAC
 161 CTGCTGGGTATTGGTTCCAGCACTCCGTGAGCCATGTCCAGTCCCTTTTATAAAATGACATATTTGTATGTAACTTACCC
 241 ACATCCTCTTGTATACTCTCAATTATGTCTAGATTACTTAAAATACCTCATGCATTGTAAAAGCTATGCAAATAGTTGTT
 321 CTATTGTATTGTTTAGGGACTCATGATAAGGAAAAGAGTCTATGTATTTTCAGTATAGATGCAGTAATTGTCAGCCTATC
 401 AACATAGTATAGTCAGCCAGAACATTAAAGTTTCTTTGTTTCAACTCTCACA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' gcucACACUCUA-GUGUGGAGGg 5'
              ||| |  | | ||| ||| 
Target 5' tgtaTGTAACTTACCCACATCCt 3'
225 - 247 118.00 -10.44
2
miRNA  3' gcucACA-CUCUAG-------UGUGGAGgg 5'
              |||  ||||:       |:|||||  
Target 5' attaTGTCTAGATTACTTAAAATACCTCat 3'
262 - 291 114.00 -11.91
3
miRNA  3' gcucaCACUCUAGUGUGGAGGg 5'
               |||||  | ||: ||| 
Target 5' actccGTGAG--C-CATGTCCa 3'
182 - 200 104.00 -11.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30572745 3 COSMIC
COSN31499041 10 COSMIC
COSN30520419 29 COSMIC
COSN30464614 88 COSMIC
COSN30117710 89 COSMIC
COSN30516732 108 COSMIC
COSN31506271 128 COSMIC
COSN31529145 134 COSMIC
COSN30140704 142 COSMIC
COSN9846027 144 COSMIC
COSN20067067 152 COSMIC
COSN22556660 156 COSMIC
COSN19619319 186 COSMIC
COSN7354016 199 COSMIC
COSN30544603 201 COSMIC
COSN31522092 225 COSMIC
COSN30125995 297 COSMIC
COSN27775316 336 COSMIC
COSN30529393 338 COSMIC
COSN5849365 434 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs761249646 5 dbSNP
rs1372841878 15 dbSNP
rs1256878343 17 dbSNP
rs1215945360 20 dbSNP
rs981155550 27 dbSNP
rs1351663493 28 dbSNP
rs374519272 33 dbSNP
rs1229475271 34 dbSNP
rs1242260922 45 dbSNP
rs1361760033 46 dbSNP
rs1276999404 54 dbSNP
rs566306408 59 dbSNP
rs1023208637 63 dbSNP
rs995631402 66 dbSNP
rs898667703 68 dbSNP
rs1388489332 72 dbSNP
rs1015595095 73 dbSNP
rs1448320855 75 dbSNP
rs1004716024 76 dbSNP
rs1464872483 77 dbSNP
rs1419792082 89 dbSNP
rs558433918 102 dbSNP
rs1403578106 110 dbSNP
rs371544329 114 dbSNP
rs996885947 120 dbSNP
rs569525141 124 dbSNP
rs1435899783 129 dbSNP
rs546110669 130 dbSNP
rs1300167772 140 dbSNP
rs532337597 150 dbSNP
rs879650353 152 dbSNP
rs1453640489 156 dbSNP
rs1345426514 163 dbSNP
rs563325908 164 dbSNP
rs1266164963 170 dbSNP
rs529489045 177 dbSNP
rs1188581369 181 dbSNP
rs201936838 186 dbSNP
rs1052833359 187 dbSNP
rs934389086 189 dbSNP
rs1378621107 195 dbSNP
rs1471142660 198 dbSNP
rs201019469 199 dbSNP
rs568592164 220 dbSNP
rs706546 222 dbSNP
rs969790771 228 dbSNP
rs1388876333 230 dbSNP
rs1386470955 241 dbSNP
rs547074774 245 dbSNP
rs1302208830 252 dbSNP
rs185267882 256 dbSNP
rs761114549 258 dbSNP
rs1282563742 262 dbSNP
rs543438120 265 dbSNP
rs1400527903 267 dbSNP
rs1328313707 272 dbSNP
rs1208839235 283 dbSNP
rs1261917927 292 dbSNP
rs916126989 297 dbSNP
rs1295783780 303 dbSNP
rs180986673 306 dbSNP
rs1402504564 308 dbSNP
rs1473177757 315 dbSNP
rs1161889744 321 dbSNP
rs1366837085 323 dbSNP
rs1457467491 326 dbSNP
rs1294402949 327 dbSNP
rs962821030 334 dbSNP
rs1134428 340 dbSNP
rs533109128 342 dbSNP
rs1004406489 344 dbSNP
rs574832887 345 dbSNP
rs1349817270 349 dbSNP
rs562419467 351 dbSNP
rs1427638466 356 dbSNP
rs1199405206 360 dbSNP
rs1319470656 362 dbSNP
rs1243415221 363 dbSNP
rs955628535 364 dbSNP
rs1490718579 366 dbSNP
rs1478423408 376 dbSNP
rs1251611993 382 dbSNP
rs1483568801 383 dbSNP
rs1179533319 384 dbSNP
rs1265479377 388 dbSNP
rs1213774800 391 dbSNP
rs1029782591 392 dbSNP
rs997252323 395 dbSNP
rs1165493987 404 dbSNP
rs397839868 409 dbSNP
rs573466052 412 dbSNP
rs190938698 419 dbSNP
rs1321238088 425 dbSNP
rs1168169861 433 dbSNP
rs1369759489 442 dbSNP
rs368382295 442 dbSNP
rs1011517273 444 dbSNP
rs555083048 445 dbSNP
rs893081776 446 dbSNP
rs1376810042 450 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 90576.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' gcucacacucuaGUGUGGAGGg 5'
                      | ||||||| 
Target 5' ---acugcaaccCCCACCUCCc 3'
1 - 19
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 90576.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' gcucacacucuaGUGUGGAGGg 5'
                      | ||||||| 
Target 5' cucacugcaaccCCCACCUCCc 3'
1 - 22
Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000419318.1 | 3UTR | ACUGCAACCCCCACCUCCCG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000419318.1 | 3UTR | CUCACUGCAACCCCCACCUCCCGGGUUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
231 hsa-miR-3689d Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT059166 TXNIP thioredoxin interacting protein 2 4
MIRT080699 KIAA1468 KIAA1468 2 2
MIRT218770 CDKN1A cyclin dependent kinase inhibitor 1A 2 2
MIRT278059 KHNYN KH and NYN domain containing 2 2
MIRT345933 EIF4A1 eukaryotic translation initiation factor 4A1 2 2
MIRT366238 VMA21 VMA21, vacuolar ATPase assembly factor 2 2
MIRT449689 CNNM2 cyclin and CBS domain divalent metal cation transport mediator 2 2 2
MIRT451149 C19orf53 chromosome 19 open reading frame 53 2 2
MIRT451266 NDUFA11 NADH:ubiquinone oxidoreductase subunit A11 2 2
MIRT451375 C19orf43 telomerase RNA component interacting RNase 2 2
MIRT451570 CIAPIN1 cytokine induced apoptosis inhibitor 1 2 2
MIRT451585 HIRIP3 HIRA interacting protein 3 2 2
MIRT451614 MEIS3P1 Meis homeobox 3 pseudogene 1 2 2
MIRT451763 ZNF611 zinc finger protein 611 2 6
MIRT452383 LY6E lymphocyte antigen 6 family member E 2 4
MIRT452573 ZFP69B ZFP69 zinc finger protein B 2 2
MIRT452735 PTGES3L prostaglandin E synthase 3 like 2 6
MIRT452867 LAX1 lymphocyte transmembrane adaptor 1 2 2
MIRT452975 CABP4 calcium binding protein 4 2 2
MIRT453215 CERS1 ceramide synthase 1 2 2
MIRT453259 PARP11 poly(ADP-ribose) polymerase family member 11 2 2
MIRT453449 GLG1 golgi glycoprotein 1 2 2
MIRT453479 PITPNM3 PITPNM family member 3 2 2
MIRT453663 CD207 CD207 molecule 2 6
MIRT453724 RAP1GDS1 Rap1 GTPase-GDP dissociation stimulator 1 2 2
MIRT453760 RANGAP1 Ran GTPase activating protein 1 2 2
MIRT454181 AP1S3 adaptor related protein complex 1 sigma 3 subunit 2 6
MIRT454330 PPARA peroxisome proliferator activated receptor alpha 2 2
MIRT454338 CDKL1 cyclin dependent kinase like 1 2 2
MIRT454427 GTF2F1 general transcription factor IIF subunit 1 2 2
MIRT454665 FBXL18 F-box and leucine rich repeat protein 18 2 2
MIRT454825 POLR2J3 RNA polymerase II subunit J3 2 2
MIRT455130 TBC1D25 TBC1 domain family member 25 2 2
MIRT455166 SUV39H1 suppressor of variegation 3-9 homolog 1 2 2
MIRT455416 RXRB retinoid X receptor beta 2 2
MIRT455668 GLO1 glyoxalase I 2 2
MIRT455999 CYP2C19 cytochrome P450 family 2 subfamily C member 19 2 2
MIRT456446 TMEM81 transmembrane protein 81 2 2
MIRT456642 NOS1AP nitric oxide synthase 1 adaptor protein 2 2
MIRT456728 TMEM239 transmembrane protein 239 2 2
MIRT457131 ASPH aspartate beta-hydroxylase 2 2
MIRT457157 MXRA7 matrix remodeling associated 7 2 2
MIRT457358 POFUT2 protein O-fucosyltransferase 2 2 2
MIRT457458 UNC119B unc-119 lipid binding chaperone B 2 2
MIRT457619 UPK3BL uroplakin 3B like 1 2 2
MIRT457692 ZNF587 zinc finger protein 587 2 2
MIRT457727 SMOX spermine oxidase 2 2
MIRT457788 VWA1 von Willebrand factor A domain containing 1 2 2
MIRT457875 THEM6 thioesterase superfamily member 6 2 4
MIRT457909 ZNF212 zinc finger protein 212 2 2
MIRT458395 ABCF1 ATP binding cassette subfamily F member 1 2 2
MIRT458496 MARVELD2 MARVEL domain containing 2 2 2
MIRT458544 CYP2B6 cytochrome P450 family 2 subfamily B member 6 2 2
MIRT458577 TCOF1 treacle ribosome biogenesis factor 1 2 2
MIRT458732 CES2 carboxylesterase 2 2 2
MIRT458814 ZNF843 zinc finger protein 843 2 2
MIRT458931 SAMD4B sterile alpha motif domain containing 4B 2 2
MIRT459341 ZNF17 zinc finger protein 17 2 2
MIRT459365 MPLKIP M-phase specific PLK1 interacting protein 2 6
MIRT459572 NLGN2 neuroligin 2 2 2
MIRT460015 DTX3L deltex E3 ubiquitin ligase 3L 2 4
MIRT460144 ASB16 ankyrin repeat and SOCS box containing 16 2 2
MIRT460653 IGFBP4 insulin like growth factor binding protein 4 2 2
MIRT460798 VPS33A VPS33A, CORVET/HOPS core subunit 2 2
MIRT461058 KCNK6 potassium two pore domain channel subfamily K member 6 2 4
MIRT461458 SLC19A3 solute carrier family 19 member 3 2 2
MIRT461572 SCO1 SCO1, cytochrome c oxidase assembly protein 2 4
MIRT461927 TNFSF14 TNF superfamily member 14 2 2
MIRT461953 C3 complement C3 2 2
MIRT462278 KRR1 KRR1, small subunit processome component homolog 2 2
MIRT462744 EFNB1 ephrin B1 2 2
MIRT463136 ZNF451 zinc finger protein 451 2 4
MIRT463566 ZBTB39 zinc finger and BTB domain containing 39 2 6
MIRT463866 WNT7B Wnt family member 7B 2 2
MIRT464326 UST uronyl 2-sulfotransferase 2 2
MIRT464796 UBE2F ubiquitin conjugating enzyme E2 F (putative) 2 2
MIRT465034 TTC39C tetratricopeptide repeat domain 39C 2 2
MIRT466207 TMED10 transmembrane p24 trafficking protein 10 2 2
MIRT467007 SSBP2 single stranded DNA binding protein 2 2 2
MIRT467029 SRSF1 serine and arginine rich splicing factor 1 2 4
MIRT468001 SKI SKI proto-oncogene 2 2
MIRT468031 SIKE1 suppressor of IKBKE 1 2 6
MIRT468575 SERBP1 SERPINE1 mRNA binding protein 1 2 6
MIRT468834 RRM2 ribonucleotide reductase regulatory subunit M2 2 2
MIRT468970 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 2
MIRT469450 REL REL proto-oncogene, NF-kB subunit 2 6
MIRT470888 PLXND1 plexin D1 2 2
MIRT470953 PKM pyruvate kinase, muscle 2 2
MIRT471828 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 2
MIRT472590 NACC1 nucleus accumbens associated 1 2 2
MIRT472805 MTMR12 myotubularin related protein 12 2 2
MIRT472818 MTMR10 myotubularin related protein 10 2 6
MIRT472914 MSN moesin 2 2
MIRT474558 KLHDC3 kelch domain containing 3 2 2
MIRT474716 KIF13A kinesin family member 13A 2 6
MIRT475279 TOR1AIP2 torsin 1A interacting protein 2 2 2
MIRT475300 IFNLR1 interferon lambda receptor 1 2 2
MIRT475759 HDLBP high density lipoprotein binding protein 2 2
MIRT475786 HDGF heparin binding growth factor 2 2
MIRT475933 GXYLT2 glucoside xylosyltransferase 2 2 8
MIRT476212 GNS glucosamine (N-acetyl)-6-sulfatase 2 2
MIRT476238 GNPNAT1 glucosamine-phosphate N-acetyltransferase 1 2 4
MIRT476799 FNDC3B fibronectin type III domain containing 3B 2 2
MIRT477988 DNAL1 dynein axonemal light chain 1 2 2
MIRT478317 DDN dendrin 2 2
MIRT479257 CHSY1 chondroitin sulfate synthase 1 2 2
MIRT479344 CEP97 centrosomal protein 97 2 2
MIRT479522 CDCA4 cell division cycle associated 4 2 2
MIRT479906 CCDC117 coiled-coil domain containing 117 2 6
MIRT481147 AVL9 AVL9 cell migration associated 2 6
MIRT481735 APH1A aph-1 homolog A, gamma-secretase subunit 2 2
MIRT482089 ALG8 ALG8, alpha-1,3-glucosyltransferase 2 2
MIRT482389 AEN apoptosis enhancing nuclease 2 2
MIRT483093 TFPI tissue factor pathway inhibitor 2 2
MIRT484246 ANK1 ankyrin 1 2 2
MIRT484342 EPN1 epsin 1 2 4
MIRT489141 C5orf38 chromosome 5 open reading frame 38 2 2
MIRT489163 MRPL12 mitochondrial ribosomal protein L12 2 4
MIRT489547 SOX11 SRY-box 11 2 4
MIRT489780 GRINA glutamate ionotropic receptor NMDA type subunit associated protein 1 2 2
MIRT489799 KRT80 keratin 80 2 6
MIRT490535 KIAA1715 lunapark, ER junction formation factor 2 2
MIRT492198 SOCS1 suppressor of cytokine signaling 1 2 2
MIRT492283 SHISA6 shisa family member 6 2 4
MIRT501059 SMARCAD1 SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 2 4
MIRT501094 SLC5A6 solute carrier family 5 member 6 2 4
MIRT503870 CBS cystathionine-beta-synthase 2 2
MIRT507981 BCL2L13 BCL2 like 13 2 4
MIRT508125 AMD1 adenosylmethionine decarboxylase 1 2 2
MIRT508205 SLC35E1 solute carrier family 35 member E1 2 2
MIRT508385 SPTBN2 spectrin beta, non-erythrocytic 2 2 4
MIRT510308 PDRG1 p53 and DNA damage regulated 1 2 2
MIRT510462 ZDHHC18 zinc finger DHHC-type containing 18 2 2
MIRT512227 ATXN3 ataxin 3 2 8
MIRT512665 STEAP3 STEAP3 metalloreductase 2 2
MIRT514184 PGPEP1 pyroglutamyl-peptidase I 2 2
MIRT515053 EBNA1BP2 EBNA1 binding protein 2 2 2
MIRT515138 ZNF799 zinc finger protein 799 2 4
MIRT515452 ZNF747 zinc finger protein 747 2 2
MIRT515791 COL4A3BP collagen type IV alpha 3 binding protein 2 2
MIRT515905 AGTPBP1 ATP/GTP binding protein 1 2 2
MIRT516129 MRPS16 mitochondrial ribosomal protein S16 2 6
MIRT516679 ZNF860 zinc finger protein 860 2 4
MIRT516750 ZNF100 zinc finger protein 100 2 2
MIRT516971 OR7D2 olfactory receptor family 7 subfamily D member 2 2 2
MIRT517491 NPAP1 nuclear pore associated protein 1 2 2
MIRT517774 PROM2 prominin 2 2 2
MIRT517938 ZNF431 zinc finger protein 431 2 4
MIRT518386 ZNF250 zinc finger protein 250 2 2
MIRT520621 TMEM41B transmembrane protein 41B 2 2
MIRT521028 SLC30A5 solute carrier family 30 member 5 2 2
MIRT521454 RAD51 RAD51 recombinase 2 2
MIRT521564 PTPLB 3-hydroxyacyl-CoA dehydratase 2 1 1
MIRT521581 PTBP2 polypyrimidine tract binding protein 2 2 2
MIRT522263 NKRF NFKB repressing factor 2 2
MIRT522410 MXI1 MAX interactor 1, dimerization protein 2 2
MIRT522543 MED28 mediator complex subunit 28 2 6
MIRT522915 KCNE3 potassium voltage-gated channel subfamily E regulatory subunit 3 2 2
MIRT523029 IGF1 insulin like growth factor 1 2 2
MIRT523854 ESPL1 extra spindle pole bodies like 1, separase 2 4
MIRT524184 DFFA DNA fragmentation factor subunit alpha 2 2
MIRT524520 CDK19 cyclin dependent kinase 19 2 2
MIRT524674 C12orf5 TP53 induced glycolysis regulatory phosphatase 2 2
MIRT530257 ZNF620 zinc finger protein 620 2 2
MIRT540691 BMP3 bone morphogenetic protein 3 2 2
MIRT540976 C17orf85 nuclear cap binding subunit 3 2 2
MIRT545505 NAP1L1 nucleosome assembly protein 1 like 1 2 2
MIRT545631 GGCX gamma-glutamyl carboxylase 2 2
MIRT547358 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 2 2
MIRT550701 MPL MPL proto-oncogene, thrombopoietin receptor 2 4
MIRT550717 PMPCA peptidase, mitochondrial processing alpha subunit 2 4
MIRT551203 NCR3LG1 natural killer cell cytotoxicity receptor 3 ligand 1 2 2
MIRT553999 SRGAP1 SLIT-ROBO Rho GTPase activating protein 1 2 4
MIRT561081 LLPH LLP homolog, long-term synaptic facilitation 2 2
MIRT563523 TAF8 TATA-box binding protein associated factor 8 2 2
MIRT564463 SLC35E2 solute carrier family 35 member E2 2 2
MIRT565233 TRAF6 TNF receptor associated factor 6 2 2
MIRT566618 NKAP NFKB activating protein 2 2
MIRT569527 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 2 2
MIRT569639 QPCT glutaminyl-peptide cyclotransferase 2 2
MIRT570253 SSPN sarcospan 2 2
MIRT570570 OTUD7B OTU deubiquitinase 7B 2 2
MIRT570621 MTF2 metal response element binding transcription factor 2 2 2
MIRT571098 ISLR2 immunoglobulin superfamily containing leucine rich repeat 2 2 2
MIRT575196 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 2 2
MIRT575554 Cd99 CD99 antigen 2 2
MIRT575634 Gnl3l guanine nucleotide binding protein-like 3 (nucleolar)-like 2 2
MIRT608267 NOP14 NOP14 nucleolar protein 2 2
MIRT609314 FXYD6 FXYD domain containing ion transport regulator 6 2 2
MIRT627670 RPL28 ribosomal protein L28 2 2
MIRT631185 TSPAN14 tetraspanin 14 2 2
MIRT631964 YIPF5 Yip1 domain family member 5 2 2
MIRT632885 GINM1 glycoprotein integral membrane 1 2 2
MIRT642618 CDKN3 cyclin dependent kinase inhibitor 3 2 2
MIRT645609 TSPAN6 tetraspanin 6 2 2
MIRT662227 PGBD4 piggyBac transposable element derived 4 2 2
MIRT662329 MYLK3 myosin light chain kinase 3 2 2
MIRT662725 LRRC3C leucine rich repeat containing 3C 2 2
MIRT665520 USP14 ubiquitin specific peptidase 14 2 2
MIRT666634 RBMS2 RNA binding motif single stranded interacting protein 2 2 2
MIRT668969 CNBP CCHC-type zinc finger nucleic acid binding protein 2 2
MIRT670925 DESI1 desumoylating isopeptidase 1 2 2
MIRT673939 ZNF500 zinc finger protein 500 2 2
MIRT674675 PLCE1 phospholipase C epsilon 1 2 2
MIRT675230 MAK male germ cell associated kinase 2 2
MIRT680864 MACC1 MACC1, MET transcriptional regulator 2 2
MIRT681047 ZDBF2 zinc finger DBF-type containing 2 2 2
MIRT681105 CEP57L1 centrosomal protein 57 like 1 2 2
MIRT683553 HAVCR1 hepatitis A virus cellular receptor 1 2 2
MIRT684508 C1orf174 chromosome 1 open reading frame 174 2 2
MIRT684812 BRIX1 BRX1, biogenesis of ribosomes 2 2
MIRT685981 CCDC77 coiled-coil domain containing 77 2 2
MIRT686709 TBC1D19 TBC1 domain family member 19 2 2
MIRT686867 SLC25A32 solute carrier family 25 member 32 2 2
MIRT688908 C11orf84 chromosome 11 open reading frame 84 2 2
MIRT691208 KLHL30 kelch like family member 30 2 2
MIRT692298 CNNM3 cyclin and CBS domain divalent metal cation transport mediator 3 2 2
MIRT694380 MTA1 metastasis associated 1 2 2
MIRT696497 COX6B1 cytochrome c oxidase subunit 6B1 2 2
MIRT700686 POLR3D RNA polymerase III subunit D 2 2
MIRT701088 PAPOLG poly(A) polymerase gamma 2 2
MIRT703373 GAPVD1 GTPase activating protein and VPS9 domains 1 2 2
MIRT706189 SAR1B secretion associated Ras related GTPase 1B 2 2
MIRT706648 SMIM19 small integral membrane protein 19 2 2
MIRT709466 KRTAP19-1 keratin associated protein 19-1 2 2
MIRT709699 DMWD DM1 locus, WD repeat containing 2 2
MIRT710693 LYRM4 LYR motif containing 4 2 2
MIRT713457 DNAJC11 DnaJ heat shock protein family (Hsp40) member C11 2 2
MIRT722409 RARS2 arginyl-tRNA synthetase 2, mitochondrial 2 2
MIRT725391 MAP3K9 mitogen-activated protein kinase kinase kinase 9 2 2
MIRT725548 DNMT3A DNA methyltransferase 3 alpha 2 2

Error report submission