pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-3689d-1 |
Genomic Coordinates | chr9: 134849609 - 134849682 |
Description | Homo sapiens miR-3689d-1 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
pre-miRNA | hsa-mir-3689d-2 |
Genomic Coordinates | chr9: 134850277 - 134850356 |
Description | Homo sapiens miR-3689d-2 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | ||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-3689d | |||||||||||||||||||||||||||||||||||||||
Sequence | 2| GGGAGGUGUGAUCUCACACUCG |23 | |||||||||||||||||||||||||||||||||||||||
Evidence | Experimental | |||||||||||||||||||||||||||||||||||||||
Experiments | Illumina | |||||||||||||||||||||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | ZNF799 | ||||||||||||||||||||
Synonyms | HIT-40, ZNF842 | ||||||||||||||||||||
Description | zinc finger protein 799 | ||||||||||||||||||||
Transcript | NM_001080821 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on ZNF799 | |||||||||||||||||||||
3'UTR of ZNF799 (miRNA target sites are highlighted) |
>ZNF799|NM_001080821|3'UTR 1 CATTCTCTCTAAATGTATGGAATGTGGGAAAGCATTTATTAATTTTATTTCATTTCAGATACTTGTACGAAACACATTGG 81 AGATAGACCCTGTGAATGTAAGCACTTGGTAAAACCTTAAGTAATTTCAGTTTCTTTCCAGTACAGTCATCCCTTGATAC 161 CTGCTGGGTATTGGTTCCAGCACTCCGTGAGCCATGTCCAGTCCCTTTTATAAAATGACATATTTGTATGTAACTTACCC 241 ACATCCTCTTGTATACTCTCAATTATGTCTAGATTACTTAAAATACCTCATGCATTGTAAAAGCTATGCAAATAGTTGTT 321 CTATTGTATTGTTTAGGGACTCATGATAAGGAAAAGAGTCTATGTATTTTCAGTATAGATGCAGTAATTGTCAGCCTATC 401 AACATAGTATAGTCAGCCAGAACATTAAAGTTTCTTTGTTTCAACTCTCACA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293 | ||||||
Disease | 90576.0 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293 | ||||||
Disease | 90576.0 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
CLIP-seq Support 1 for dataset GSM714644 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repA |
Location of target site | ENST00000419318.1 | 3UTR | ACUGCAACCCCCACCUCCCG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM1065667 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_6 |
Location of target site | ENST00000419318.1 | 3UTR | CUCACUGCAACCCCCACCUCCCGGGUUC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23446348 / GSE43573 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
231 hsa-miR-3689d Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT059166 | TXNIP | thioredoxin interacting protein | ![]() |
![]() |
2 | 4 | ||||||
MIRT080699 | KIAA1468 | KIAA1468 | ![]() |
![]() |
2 | 2 | ||||||
MIRT218770 | CDKN1A | cyclin dependent kinase inhibitor 1A | ![]() |
![]() |
2 | 2 | ||||||
MIRT278059 | KHNYN | KH and NYN domain containing | ![]() |
![]() |
2 | 2 | ||||||
MIRT345933 | EIF4A1 | eukaryotic translation initiation factor 4A1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT366238 | VMA21 | VMA21, vacuolar ATPase assembly factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT449689 | CNNM2 | cyclin and CBS domain divalent metal cation transport mediator 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT451149 | C19orf53 | chromosome 19 open reading frame 53 | ![]() |
![]() |
2 | 2 | ||||||
MIRT451266 | NDUFA11 | NADH:ubiquinone oxidoreductase subunit A11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT451375 | C19orf43 | telomerase RNA component interacting RNase | ![]() |
![]() |
2 | 2 | ||||||
MIRT451570 | CIAPIN1 | cytokine induced apoptosis inhibitor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT451585 | HIRIP3 | HIRA interacting protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT451614 | MEIS3P1 | Meis homeobox 3 pseudogene 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT451763 | ZNF611 | zinc finger protein 611 | ![]() |
![]() |
2 | 6 | ||||||
MIRT452383 | LY6E | lymphocyte antigen 6 family member E | ![]() |
![]() |
2 | 4 | ||||||
MIRT452573 | ZFP69B | ZFP69 zinc finger protein B | ![]() |
![]() |
2 | 2 | ||||||
MIRT452735 | PTGES3L | prostaglandin E synthase 3 like | ![]() |
![]() |
2 | 6 | ||||||
MIRT452867 | LAX1 | lymphocyte transmembrane adaptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT452975 | CABP4 | calcium binding protein 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT453215 | CERS1 | ceramide synthase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT453259 | PARP11 | poly(ADP-ribose) polymerase family member 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT453449 | GLG1 | golgi glycoprotein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT453479 | PITPNM3 | PITPNM family member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT453663 | CD207 | CD207 molecule | ![]() |
![]() |
2 | 6 | ||||||
MIRT453724 | RAP1GDS1 | Rap1 GTPase-GDP dissociation stimulator 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT453760 | RANGAP1 | Ran GTPase activating protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT454181 | AP1S3 | adaptor related protein complex 1 sigma 3 subunit | ![]() |
![]() |
2 | 6 | ||||||
MIRT454330 | PPARA | peroxisome proliferator activated receptor alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT454338 | CDKL1 | cyclin dependent kinase like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT454427 | GTF2F1 | general transcription factor IIF subunit 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT454665 | FBXL18 | F-box and leucine rich repeat protein 18 | ![]() |
![]() |
2 | 2 | ||||||
MIRT454825 | POLR2J3 | RNA polymerase II subunit J3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT455130 | TBC1D25 | TBC1 domain family member 25 | ![]() |
![]() |
2 | 2 | ||||||
MIRT455166 | SUV39H1 | suppressor of variegation 3-9 homolog 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT455416 | RXRB | retinoid X receptor beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT455668 | GLO1 | glyoxalase I | ![]() |
![]() |
2 | 2 | ||||||
MIRT455999 | CYP2C19 | cytochrome P450 family 2 subfamily C member 19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT456446 | TMEM81 | transmembrane protein 81 | ![]() |
![]() |
2 | 2 | ||||||
MIRT456642 | NOS1AP | nitric oxide synthase 1 adaptor protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT456728 | TMEM239 | transmembrane protein 239 | ![]() |
![]() |
2 | 2 | ||||||
MIRT457131 | ASPH | aspartate beta-hydroxylase | ![]() |
![]() |
2 | 2 | ||||||
MIRT457157 | MXRA7 | matrix remodeling associated 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT457358 | POFUT2 | protein O-fucosyltransferase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT457458 | UNC119B | unc-119 lipid binding chaperone B | ![]() |
![]() |
2 | 2 | ||||||
MIRT457619 | UPK3BL | uroplakin 3B like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT457692 | ZNF587 | zinc finger protein 587 | ![]() |
![]() |
2 | 2 | ||||||
MIRT457727 | SMOX | spermine oxidase | ![]() |
![]() |
2 | 2 | ||||||
MIRT457788 | VWA1 | von Willebrand factor A domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT457875 | THEM6 | thioesterase superfamily member 6 | ![]() |
![]() |
2 | 4 | ||||||
MIRT457909 | ZNF212 | zinc finger protein 212 | ![]() |
![]() |
2 | 2 | ||||||
MIRT458395 | ABCF1 | ATP binding cassette subfamily F member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT458496 | MARVELD2 | MARVEL domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT458544 | CYP2B6 | cytochrome P450 family 2 subfamily B member 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT458577 | TCOF1 | treacle ribosome biogenesis factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT458732 | CES2 | carboxylesterase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT458814 | ZNF843 | zinc finger protein 843 | ![]() |
![]() |
2 | 2 | ||||||
MIRT458931 | SAMD4B | sterile alpha motif domain containing 4B | ![]() |
![]() |
2 | 2 | ||||||
MIRT459341 | ZNF17 | zinc finger protein 17 | ![]() |
![]() |
2 | 2 | ||||||
MIRT459365 | MPLKIP | M-phase specific PLK1 interacting protein | ![]() |
![]() |
2 | 6 | ||||||
MIRT459572 | NLGN2 | neuroligin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT460015 | DTX3L | deltex E3 ubiquitin ligase 3L | ![]() |
![]() |
2 | 4 | ||||||
MIRT460144 | ASB16 | ankyrin repeat and SOCS box containing 16 | ![]() |
![]() |
2 | 2 | ||||||
MIRT460653 | IGFBP4 | insulin like growth factor binding protein 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT460798 | VPS33A | VPS33A, CORVET/HOPS core subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT461058 | KCNK6 | potassium two pore domain channel subfamily K member 6 | ![]() |
![]() |
2 | 4 | ||||||
MIRT461458 | SLC19A3 | solute carrier family 19 member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT461572 | SCO1 | SCO1, cytochrome c oxidase assembly protein | ![]() |
![]() |
2 | 4 | ||||||
MIRT461927 | TNFSF14 | TNF superfamily member 14 | ![]() |
![]() |
2 | 2 | ||||||
MIRT461953 | C3 | complement C3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT462278 | KRR1 | KRR1, small subunit processome component homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT462744 | EFNB1 | ephrin B1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT463136 | ZNF451 | zinc finger protein 451 | ![]() |
![]() |
2 | 4 | ||||||
MIRT463566 | ZBTB39 | zinc finger and BTB domain containing 39 | ![]() |
![]() |
2 | 6 | ||||||
MIRT463866 | WNT7B | Wnt family member 7B | ![]() |
![]() |
2 | 2 | ||||||
MIRT464326 | UST | uronyl 2-sulfotransferase | ![]() |
![]() |
2 | 2 | ||||||
MIRT464796 | UBE2F | ubiquitin conjugating enzyme E2 F (putative) | ![]() |
![]() |
2 | 2 | ||||||
MIRT465034 | TTC39C | tetratricopeptide repeat domain 39C | ![]() |
![]() |
2 | 2 | ||||||
MIRT466207 | TMED10 | transmembrane p24 trafficking protein 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT467007 | SSBP2 | single stranded DNA binding protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT467029 | SRSF1 | serine and arginine rich splicing factor 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT468001 | SKI | SKI proto-oncogene | ![]() |
![]() |
2 | 2 | ||||||
MIRT468031 | SIKE1 | suppressor of IKBKE 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT468575 | SERBP1 | SERPINE1 mRNA binding protein 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT468834 | RRM2 | ribonucleotide reductase regulatory subunit M2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT468970 | RPRD2 | regulation of nuclear pre-mRNA domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT469450 | REL | REL proto-oncogene, NF-kB subunit | ![]() |
![]() |
2 | 6 | ||||||
MIRT470888 | PLXND1 | plexin D1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT470953 | PKM | pyruvate kinase, muscle | ![]() |
![]() |
2 | 2 | ||||||
MIRT471828 | NUFIP2 | NUFIP2, FMR1 interacting protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT472590 | NACC1 | nucleus accumbens associated 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT472805 | MTMR12 | myotubularin related protein 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT472818 | MTMR10 | myotubularin related protein 10 | ![]() |
![]() |
2 | 6 | ||||||
MIRT472914 | MSN | moesin | ![]() |
![]() |
2 | 2 | ||||||
MIRT474558 | KLHDC3 | kelch domain containing 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT474716 | KIF13A | kinesin family member 13A | ![]() |
![]() |
2 | 6 | ||||||
MIRT475279 | TOR1AIP2 | torsin 1A interacting protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT475300 | IFNLR1 | interferon lambda receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT475759 | HDLBP | high density lipoprotein binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT475786 | HDGF | heparin binding growth factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT475933 | GXYLT2 | glucoside xylosyltransferase 2 | ![]() |
![]() |
2 | 8 | ||||||
MIRT476212 | GNS | glucosamine (N-acetyl)-6-sulfatase | ![]() |
![]() |
2 | 2 | ||||||
MIRT476238 | GNPNAT1 | glucosamine-phosphate N-acetyltransferase 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT476799 | FNDC3B | fibronectin type III domain containing 3B | ![]() |
![]() |
2 | 2 | ||||||
MIRT477988 | DNAL1 | dynein axonemal light chain 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT478317 | DDN | dendrin | ![]() |
![]() |
2 | 2 | ||||||
MIRT479257 | CHSY1 | chondroitin sulfate synthase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT479344 | CEP97 | centrosomal protein 97 | ![]() |
![]() |
2 | 2 | ||||||
MIRT479522 | CDCA4 | cell division cycle associated 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT479906 | CCDC117 | coiled-coil domain containing 117 | ![]() |
![]() |
2 | 6 | ||||||
MIRT481147 | AVL9 | AVL9 cell migration associated | ![]() |
![]() |
2 | 6 | ||||||
MIRT481735 | APH1A | aph-1 homolog A, gamma-secretase subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT482089 | ALG8 | ALG8, alpha-1,3-glucosyltransferase | ![]() |
![]() |
2 | 2 | ||||||
MIRT482389 | AEN | apoptosis enhancing nuclease | ![]() |
![]() |
2 | 2 | ||||||
MIRT483093 | TFPI | tissue factor pathway inhibitor | ![]() |
![]() |
2 | 2 | ||||||
MIRT484246 | ANK1 | ankyrin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT484342 | EPN1 | epsin 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT489141 | C5orf38 | chromosome 5 open reading frame 38 | ![]() |
![]() |
2 | 2 | ||||||
MIRT489163 | MRPL12 | mitochondrial ribosomal protein L12 | ![]() |
![]() |
2 | 4 | ||||||
MIRT489547 | SOX11 | SRY-box 11 | ![]() |
![]() |
2 | 4 | ||||||
MIRT489780 | GRINA | glutamate ionotropic receptor NMDA type subunit associated protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT489799 | KRT80 | keratin 80 | ![]() |
![]() |
2 | 6 | ||||||
MIRT490535 | KIAA1715 | lunapark, ER junction formation factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT492198 | SOCS1 | suppressor of cytokine signaling 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT492283 | SHISA6 | shisa family member 6 | ![]() |
![]() |
2 | 4 | ||||||
MIRT501059 | SMARCAD1 | SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT501094 | SLC5A6 | solute carrier family 5 member 6 | ![]() |
![]() |
2 | 4 | ||||||
MIRT503870 | CBS | cystathionine-beta-synthase | ![]() |
![]() |
2 | 2 | ||||||
MIRT507981 | BCL2L13 | BCL2 like 13 | ![]() |
![]() |
2 | 4 | ||||||
MIRT508125 | AMD1 | adenosylmethionine decarboxylase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT508205 | SLC35E1 | solute carrier family 35 member E1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT508385 | SPTBN2 | spectrin beta, non-erythrocytic 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT510308 | PDRG1 | p53 and DNA damage regulated 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT510462 | ZDHHC18 | zinc finger DHHC-type containing 18 | ![]() |
![]() |
2 | 2 | ||||||
MIRT512227 | ATXN3 | ataxin 3 | ![]() |
![]() |
2 | 8 | ||||||
MIRT512665 | STEAP3 | STEAP3 metalloreductase | ![]() |
![]() |
2 | 2 | ||||||
MIRT514184 | PGPEP1 | pyroglutamyl-peptidase I | ![]() |
![]() |
2 | 2 | ||||||
MIRT515053 | EBNA1BP2 | EBNA1 binding protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT515138 | ZNF799 | zinc finger protein 799 | ![]() |
![]() |
2 | 4 | ||||||
MIRT515452 | ZNF747 | zinc finger protein 747 | ![]() |
![]() |
2 | 2 | ||||||
MIRT515791 | COL4A3BP | collagen type IV alpha 3 binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT515905 | AGTPBP1 | ATP/GTP binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT516129 | MRPS16 | mitochondrial ribosomal protein S16 | ![]() |
![]() |
2 | 6 | ||||||
MIRT516679 | ZNF860 | zinc finger protein 860 | ![]() |
![]() |
2 | 4 | ||||||
MIRT516750 | ZNF100 | zinc finger protein 100 | ![]() |
![]() |
2 | 2 | ||||||
MIRT516971 | OR7D2 | olfactory receptor family 7 subfamily D member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT517491 | NPAP1 | nuclear pore associated protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT517774 | PROM2 | prominin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT517938 | ZNF431 | zinc finger protein 431 | ![]() |
![]() |
2 | 4 | ||||||
MIRT518386 | ZNF250 | zinc finger protein 250 | ![]() |
![]() |
2 | 2 | ||||||
MIRT520621 | TMEM41B | transmembrane protein 41B | ![]() |
![]() |
2 | 2 | ||||||
MIRT521028 | SLC30A5 | solute carrier family 30 member 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT521454 | RAD51 | RAD51 recombinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT521564 | PTPLB | 3-hydroxyacyl-CoA dehydratase 2 | ![]() |
1 | 1 | |||||||
MIRT521581 | PTBP2 | polypyrimidine tract binding protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT522263 | NKRF | NFKB repressing factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT522410 | MXI1 | MAX interactor 1, dimerization protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT522543 | MED28 | mediator complex subunit 28 | ![]() |
![]() |
2 | 6 | ||||||
MIRT522915 | KCNE3 | potassium voltage-gated channel subfamily E regulatory subunit 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT523029 | IGF1 | insulin like growth factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT523854 | ESPL1 | extra spindle pole bodies like 1, separase | ![]() |
![]() |
2 | 4 | ||||||
MIRT524184 | DFFA | DNA fragmentation factor subunit alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT524520 | CDK19 | cyclin dependent kinase 19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT524674 | C12orf5 | TP53 induced glycolysis regulatory phosphatase | ![]() |
![]() |
2 | 2 | ||||||
MIRT530257 | ZNF620 | zinc finger protein 620 | ![]() |
![]() |
2 | 2 | ||||||
MIRT540691 | BMP3 | bone morphogenetic protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT540976 | C17orf85 | nuclear cap binding subunit 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT545505 | NAP1L1 | nucleosome assembly protein 1 like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT545631 | GGCX | gamma-glutamyl carboxylase | ![]() |
![]() |
2 | 2 | ||||||
MIRT547358 | NAA30 | N(alpha)-acetyltransferase 30, NatC catalytic subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT550701 | MPL | MPL proto-oncogene, thrombopoietin receptor | ![]() |
![]() |
2 | 4 | ||||||
MIRT550717 | PMPCA | peptidase, mitochondrial processing alpha subunit | ![]() |
![]() |
2 | 4 | ||||||
MIRT551203 | NCR3LG1 | natural killer cell cytotoxicity receptor 3 ligand 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT553999 | SRGAP1 | SLIT-ROBO Rho GTPase activating protein 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT561081 | LLPH | LLP homolog, long-term synaptic facilitation | ![]() |
![]() |
2 | 2 | ||||||
MIRT563523 | TAF8 | TATA-box binding protein associated factor 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT564463 | SLC35E2 | solute carrier family 35 member E2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT565233 | TRAF6 | TNF receptor associated factor 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT566618 | NKAP | NFKB activating protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT569527 | AP5Z1 | adaptor related protein complex 5 zeta 1 subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT569639 | QPCT | glutaminyl-peptide cyclotransferase | ![]() |
![]() |
2 | 2 | ||||||
MIRT570253 | SSPN | sarcospan | ![]() |
![]() |
2 | 2 | ||||||
MIRT570570 | OTUD7B | OTU deubiquitinase 7B | ![]() |
![]() |
2 | 2 | ||||||
MIRT570621 | MTF2 | metal response element binding transcription factor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT571098 | ISLR2 | immunoglobulin superfamily containing leucine rich repeat 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT575196 | Entpd4 | ectonucleoside triphosphate diphosphohydrolase 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT575554 | Cd99 | CD99 antigen | ![]() |
![]() |
2 | 2 | ||||||
MIRT575634 | Gnl3l | guanine nucleotide binding protein-like 3 (nucleolar)-like | ![]() |
![]() |
2 | 2 | ||||||
MIRT608267 | NOP14 | NOP14 nucleolar protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT609314 | FXYD6 | FXYD domain containing ion transport regulator 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT627670 | RPL28 | ribosomal protein L28 | ![]() |
![]() |
2 | 2 | ||||||
MIRT631185 | TSPAN14 | tetraspanin 14 | ![]() |
![]() |
2 | 2 | ||||||
MIRT631964 | YIPF5 | Yip1 domain family member 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT632885 | GINM1 | glycoprotein integral membrane 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT642618 | CDKN3 | cyclin dependent kinase inhibitor 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT645609 | TSPAN6 | tetraspanin 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT662227 | PGBD4 | piggyBac transposable element derived 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT662329 | MYLK3 | myosin light chain kinase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT662725 | LRRC3C | leucine rich repeat containing 3C | ![]() |
![]() |
2 | 2 | ||||||
MIRT665520 | USP14 | ubiquitin specific peptidase 14 | ![]() |
![]() |
2 | 2 | ||||||
MIRT666634 | RBMS2 | RNA binding motif single stranded interacting protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT668969 | CNBP | CCHC-type zinc finger nucleic acid binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT670925 | DESI1 | desumoylating isopeptidase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT673939 | ZNF500 | zinc finger protein 500 | ![]() |
![]() |
2 | 2 | ||||||
MIRT674675 | PLCE1 | phospholipase C epsilon 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT675230 | MAK | male germ cell associated kinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT680864 | MACC1 | MACC1, MET transcriptional regulator | ![]() |
![]() |
2 | 2 | ||||||
MIRT681047 | ZDBF2 | zinc finger DBF-type containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT681105 | CEP57L1 | centrosomal protein 57 like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT683553 | HAVCR1 | hepatitis A virus cellular receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT684508 | C1orf174 | chromosome 1 open reading frame 174 | ![]() |
![]() |
2 | 2 | ||||||
MIRT684812 | BRIX1 | BRX1, biogenesis of ribosomes | ![]() |
![]() |
2 | 2 | ||||||
MIRT685981 | CCDC77 | coiled-coil domain containing 77 | ![]() |
![]() |
2 | 2 | ||||||
MIRT686709 | TBC1D19 | TBC1 domain family member 19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT686867 | SLC25A32 | solute carrier family 25 member 32 | ![]() |
![]() |
2 | 2 | ||||||
MIRT688908 | C11orf84 | chromosome 11 open reading frame 84 | ![]() |
![]() |
2 | 2 | ||||||
MIRT691208 | KLHL30 | kelch like family member 30 | ![]() |
![]() |
2 | 2 | ||||||
MIRT692298 | CNNM3 | cyclin and CBS domain divalent metal cation transport mediator 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT694380 | MTA1 | metastasis associated 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT696497 | COX6B1 | cytochrome c oxidase subunit 6B1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT700686 | POLR3D | RNA polymerase III subunit D | ![]() |
![]() |
2 | 2 | ||||||
MIRT701088 | PAPOLG | poly(A) polymerase gamma | ![]() |
![]() |
2 | 2 | ||||||
MIRT703373 | GAPVD1 | GTPase activating protein and VPS9 domains 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT706189 | SAR1B | secretion associated Ras related GTPase 1B | ![]() |
![]() |
2 | 2 | ||||||
MIRT706648 | SMIM19 | small integral membrane protein 19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT709466 | KRTAP19-1 | keratin associated protein 19-1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT709699 | DMWD | DM1 locus, WD repeat containing | ![]() |
![]() |
2 | 2 | ||||||
MIRT710693 | LYRM4 | LYR motif containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT713457 | DNAJC11 | DnaJ heat shock protein family (Hsp40) member C11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT722409 | RARS2 | arginyl-tRNA synthetase 2, mitochondrial | ![]() |
![]() |
2 | 2 | ||||||
MIRT725391 | MAP3K9 | mitogen-activated protein kinase kinase kinase 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT725548 | DNMT3A | DNA methyltransferase 3 alpha | ![]() |
![]() |
2 | 2 |