pre-miRNA Information
pre-miRNA hsa-mir-6751   
Genomic Coordinates chr11: 65129916 - 65129978
Description Homo sapiens miR-6751 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-6751-3p
Sequence 43| ACUGAGCCUCUCUCUCUCCAG |63
Evidence Experimental
Experiments Meta-analysis
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSM6795708 8 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs749989972 2 dbSNP
rs1266150108 3 dbSNP
rs1488089412 6 dbSNP
rs1259846893 8 dbSNP
rs3802937 10 dbSNP
rs371083440 12 dbSNP
rs1264909843 13 dbSNP
rs751042478 14 dbSNP
rs757551063 19 dbSNP
Putative Targets

Gene Information
Gene Symbol C15orf38-AP3S2
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' gaccucUCUCUCUCCGAGUCa 5'
                | |  | ||||||| 
Target 5' ------ACACUGUGGCUCAGg 3'
1 - 15
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 100526783.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000398333.3 | 3UTR | ACACUGUGGCUCAGGCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000398333.3 | 3UTR | ACACUGUGGCUCAGGCUGG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000398333.3 | 3UTR | ACACUGUGGCUCAGGCUGG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
77 hsa-miR-6751-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT130738 GATAD2B GATA zinc finger domain containing 2B 2 4
MIRT134924 CCND2 cyclin D2 2 2
MIRT273034 ZBTB18 zinc finger and BTB domain containing 18 2 2
MIRT276645 KPNA3 karyopherin subunit alpha 3 2 6
MIRT446531 OAS2 2'-5'-oligoadenylate synthetase 2 2 2
MIRT456268 TDRKH tudor and KH domain containing 2 12
MIRT494454 BTG2 BTG anti-proliferation factor 2 2 2
MIRT494965 USP46 ubiquitin specific peptidase 46 2 2
MIRT496689 KREMEN1 kringle containing transmembrane protein 1 2 2
MIRT496697 RGS11 regulator of G protein signaling 11 2 2
MIRT504376 IRF4 interferon regulatory factor 4 2 6
MIRT510980 PFN2 profilin 2 2 6
MIRT512548 MFN2 mitofusin 2 2 6
MIRT513639 TP53INP2 tumor protein p53 inducible nuclear protein 2 2 2
MIRT514016 CAMSAP1 calmodulin regulated spectrin associated protein 1 2 4
MIRT514074 MTRNR2L6 MT-RNR2-like 6 2 2
MIRT515300 C15orf38-AP3S2 C15orf38-AP3S2 readthrough 2 4
MIRT517285 AP3S2 adaptor related protein complex 3 sigma 2 subunit 2 4
MIRT519075 KCNK6 potassium two pore domain channel subfamily K member 6 2 2
MIRT520779 TCF23 transcription factor 23 2 2
MIRT522485 MFSD9 major facilitator superfamily domain containing 9 2 2
MIRT528856 PKP1 plakophilin 1 2 2
MIRT529081 PATE2 prostate and testis expressed 2 2 2
MIRT531209 PLA2G4D phospholipase A2 group IVD 2 2
MIRT533988 TAB3 TGF-beta activated kinase 1 and MAP3K7 binding protein 3 2 2
MIRT537024 GRIN2B glutamate ionotropic receptor NMDA type subunit 2B 2 2
MIRT537498 FAM168B family with sequence similarity 168 member B 2 2
MIRT553125 UBE2Z ubiquitin conjugating enzyme E2 Z 2 2
MIRT555591 PIP5K1C phosphatidylinositol-4-phosphate 5-kinase type 1 gamma 2 2
MIRT556370 LUZP1 leucine zipper protein 1 2 2
MIRT569745 C2orf71 chromosome 2 open reading frame 71 2 2
MIRT570149 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 2
MIRT571243 FADS6 fatty acid desaturase 6 2 2
MIRT573065 TRIB1 tribbles pseudokinase 1 2 2
MIRT575533 Map4 microtubule-associated protein 4 2 2
MIRT575777 Tnfrsf10b tumor necrosis factor receptor superfamily, member 10b 2 2
MIRT616558 ZNF512B zinc finger protein 512B 2 2
MIRT624851 ABI2 abl interactor 2 2 2
MIRT630078 GRWD1 glutamate rich WD repeat containing 1 2 2
MIRT631479 KLHL21 kelch like family member 21 2 2
MIRT632173 CCL22 C-C motif chemokine ligand 22 2 2
MIRT638397 QSOX2 quiescin sulfhydryl oxidase 2 2 4
MIRT641192 ISG20L2 interferon stimulated exonuclease gene 20 like 2 2 2
MIRT642562 TEX9 testis expressed 9 2 2
MIRT642935 KRTAP5-9 keratin associated protein 5-9 2 2
MIRT649703 ZNF175 zinc finger protein 175 2 2
MIRT650437 CPXM2 carboxypeptidase X, M14 family member 2 2 2
MIRT652113 TRUB2 TruB pseudouridine synthase family member 2 2 2
MIRT652273 TOMM20 translocase of outer mitochondrial membrane 20 2 2
MIRT655215 PFKM phosphofructokinase, muscle 2 2
MIRT682778 ZNF852 zinc finger protein 852 2 2
MIRT683001 MUC20 mucin 20, cell surface associated 2 2
MIRT684320 GTF3C4 general transcription factor IIIC subunit 4 2 2
MIRT689435 CYB561 cytochrome b561 2 2
MIRT693847 ZNF107 zinc finger protein 107 2 2
MIRT696715 TAX1BP3 Tax1 binding protein 3 2 2
MIRT698597 TEX261 testis expressed 261 2 2
MIRT699973 RREB1 ras responsive element binding protein 1 2 2
MIRT703310 GFPT1 glutamine--fructose-6-phosphate transaminase 1 2 2
MIRT706796 RAI1 retinoic acid induced 1 2 2
MIRT709004 CD109 CD109 molecule 2 2
MIRT709181 TBC1D10B TBC1 domain family member 10B 2 2
MIRT709835 PAQR7 progestin and adipoQ receptor family member 7 2 2
MIRT711627 CORO1C coronin 1C 2 2
MIRT712634 RNF103-CHMP3 RNF103-CHMP3 readthrough 2 2
MIRT713694 CYB5R4 cytochrome b5 reductase 4 2 2
MIRT713752 SLC9A8 solute carrier family 9 member A8 2 2
MIRT714908 CHMP3 charged multivesicular body protein 3 2 2
MIRT716371 CBLL1 Cbl proto-oncogene like 1 2 2
MIRT718303 XPOT exportin for tRNA 2 2
MIRT718713 ANKRD18A ankyrin repeat domain 18A 2 2
MIRT718740 ATP9A ATPase phospholipid transporting 9A (putative) 2 2
MIRT719441 NPTX2 neuronal pentraxin 2 2 2
MIRT720896 OTUD4 OTU deubiquitinase 4 2 2
MIRT722448 RXFP4 relaxin/insulin like family peptide receptor 4 2 2
MIRT723882 VKORC1 vitamin K epoxide reductase complex subunit 1 2 2
MIRT724586 SYNJ2BP synaptojanin 2 binding protein 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-6751 Cisplatin 5460033 NSC119875 approved sensitive Low Ovarian Cancer cell line (A2780)
hsa-mir-6751 Triptolide 107985 NSC163062 sensitive Low Ovarian Cancer cell line (A2780)

Error report submission