pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4677 |
Genomic Coordinates | chr1: 243346176 - 243346255 |
Description | Homo sapiens miR-4677 stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4677-5p | |||||||||
Sequence | 13| UUGUUCUUUGGUCUUUCAGCCA |34 | |||||||||
Evidence | Experimental | |||||||||
Experiments | Illumina | DRVs in miRNA |
|
|||||||
SNPs in miRNA |
|
|||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | ARHGAP21 | ||||||||||||||||||||
Synonyms | ARHGAP10 | ||||||||||||||||||||
Description | Rho GTPase activating protein 21 | ||||||||||||||||||||
Transcript | NM_020824 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on ARHGAP21 | |||||||||||||||||||||
3'UTR of ARHGAP21 (miRNA target sites are highlighted) |
>ARHGAP21|NM_020824|3'UTR 1 ACTGGGGGTATGTCCACTCTAGCAAGTAAAAAAACTACTGTTACACGTTCCAGTAACTCTGTCAATATTTTCTTGTATCA 81 GAATTGTTATTATGCAGCCTTCATTTGGGCTGGTTTCATCATTTTGCACTGTGAAATAGCTTTACAGTGCATTACTACAG 161 CCAGAAGAACATATATATATATATATATATTTAAAAATATATCGGATAGTTGTATACAAATGAGCAAGGTATTTGTTGCA 241 ACTTACTACATAGCATATACCCAAAATCACTGAAGAAAATCGCTGGCATCAGTGTGCAGCAAATTTGTTCTTTTGGTTTC 321 ATCACTAACAAAAGTGCCTCATCATAAAAATACAGTTGGTTTTTAGGGTGCCATATTGTTAAAATTAGATAACTTACTTA 401 CATTGAATAAACGAATGCGTTTTATTGGTAACAGATATCATTACATTTACCAGTTTTAACACAGGTGGATACAGAACTTC 481 CATTCTTTAGTCATTCCAGGTGGATCTGAGTTTTATATTCAAACTTTTAATACAGTTTTTGAGTTTTGTGTGACTTGAAT 561 TTTTAATCTTTCTGTAAAATACGTAACTTAAATGAACATATTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATA 641 ATGTTGTAACATAGGTGTGTAGATAGTGGATCCTGGATGGAACTGGCTTCTTTATCGAGAAGAATATAATTCTGCATGAG 721 GACTTAATGAATCCAAACCTGTGTCATGCCTGTGTGCATACCCAATTAAACACTGGAAATAAAAATTGTTTTGGTGAATT 801 TTGAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Disease | 57584.0 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
"HITS-CLIP data was present in GSM714642. RNA binding protein: AGO2. Condition:completeT1
"PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Disease | 57584.0 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
CLIP-seq Support 1 for dataset GSM714642 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repA |
Location of target site | ENST00000396432.2 | 3UTR | AACAUAUAUAUAUAUAUAUAUAU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM714644 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repA |
Location of target site | ENST00000396432.2 | 3UTR | AACAUAUAUAUAUAUAUAUAUAUU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
CLIP-seq Support 3 for dataset GSM1065667 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_6 |
Location of target site | ENST00000396432.2 | 3UTR | AACAUAUAUAUAUAUAUAUAUAUUU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23446348 / GSE43573 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
84 hsa-miR-4677-5p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT080553 | PMAIP1 | phorbol-12-myristate-13-acetate-induced protein 1 | 2 | 2 | ||||||||
MIRT089446 | STAMBP | STAM binding protein | 2 | 2 | ||||||||
MIRT135057 | ADSS | adenylosuccinate synthase | 2 | 4 | ||||||||
MIRT263519 | RPS24 | ribosomal protein S24 | 2 | 2 | ||||||||
MIRT357966 | GRPEL2 | GrpE like 2, mitochondrial | 2 | 2 | ||||||||
MIRT384298 | GOLT1B | golgi transport 1B | 2 | 2 | ||||||||
MIRT407003 | CEBPB | CCAAT/enhancer binding protein beta | 2 | 2 | ||||||||
MIRT442312 | UBE2Q1 | ubiquitin conjugating enzyme E2 Q1 | 2 | 2 | ||||||||
MIRT443782 | ST13 | ST13, Hsp70 interacting protein | 2 | 2 | ||||||||
MIRT446864 | NBPF3 | NBPF member 3 | 2 | 2 | ||||||||
MIRT447642 | RAB3GAP1 | RAB3 GTPase activating protein catalytic subunit 1 | 2 | 2 | ||||||||
MIRT448464 | SLC45A4 | solute carrier family 45 member 4 | 2 | 2 | ||||||||
MIRT449117 | XRRA1 | X-ray radiation resistance associated 1 | 2 | 2 | ||||||||
MIRT450240 | TRIM66 | tripartite motif containing 66 | 2 | 2 | ||||||||
MIRT450265 | F2RL2 | coagulation factor II thrombin receptor like 2 | 2 | 2 | ||||||||
MIRT450682 | RPN2 | ribophorin II | 2 | 2 | ||||||||
MIRT465594 | TNRC6A | trinucleotide repeat containing 6A | 2 | 2 | ||||||||
MIRT481118 | AZIN1 | antizyme inhibitor 1 | 2 | 4 | ||||||||
MIRT497203 | CDH7 | cadherin 7 | 2 | 4 | ||||||||
MIRT502954 | CCNT2 | cyclin T2 | 2 | 2 | ||||||||
MIRT506337 | NUP54 | nucleoporin 54 | 2 | 4 | ||||||||
MIRT509224 | KIF14 | kinesin family member 14 | 2 | 6 | ||||||||
MIRT514595 | NDUFA12 | NADH:ubiquinone oxidoreductase subunit A12 | 2 | 4 | ||||||||
MIRT515392 | ARHGAP21 | Rho GTPase activating protein 21 | 2 | 4 | ||||||||
MIRT525555 | MTRNR2L7 | MT-RNR2-like 7 | 2 | 6 | ||||||||
MIRT525604 | MTRNR2L3 | MT-RNR2-like 3 | 2 | 4 | ||||||||
MIRT533249 | VCAM1 | vascular cell adhesion molecule 1 | 2 | 2 | ||||||||
MIRT535778 | MTRNR2L11 | MT-RNR2-like 11 | 2 | 6 | ||||||||
MIRT535799 | MTRNR2L10 | MT-RNR2-like 10 | 2 | 4 | ||||||||
MIRT552784 | YAF2 | YY1 associated factor 2 | 2 | 2 | ||||||||
MIRT556213 | MB21D2 | Mab-21 domain containing 2 | 2 | 2 | ||||||||
MIRT558192 | EIF2S1 | eukaryotic translation initiation factor 2 subunit alpha | 2 | 4 | ||||||||
MIRT565809 | SDCCAG3 | serologically defined colon cancer antigen 3 | 2 | 2 | ||||||||
MIRT566341 | POLDIP2 | DNA polymerase delta interacting protein 2 | 2 | 2 | ||||||||
MIRT567792 | DEK | DEK proto-oncogene | 2 | 2 | ||||||||
MIRT572455 | ZNF516 | zinc finger protein 516 | 2 | 2 | ||||||||
MIRT572582 | HGFAC | HGF activator | 2 | 2 | ||||||||
MIRT573357 | PDE3A | phosphodiesterase 3A | 2 | 2 | ||||||||
MIRT574649 | LMAN2 | lectin, mannose binding 2 | 2 | 2 | ||||||||
MIRT608164 | ERBB2 | erb-b2 receptor tyrosine kinase 2 | 2 | 2 | ||||||||
MIRT610690 | FAM89A | family with sequence similarity 89 member A | 2 | 2 | ||||||||
MIRT618457 | TMCO1 | transmembrane and coiled-coil domains 1 | 2 | 2 | ||||||||
MIRT621924 | SYAP1 | synapse associated protein 1 | 2 | 4 | ||||||||
MIRT622279 | SH3TC2 | SH3 domain and tetratricopeptide repeats 2 | 2 | 2 | ||||||||
MIRT624610 | B3GALT5 | beta-1,3-galactosyltransferase 5 | 2 | 2 | ||||||||
MIRT631040 | TAS2R30 | taste 2 receptor member 30 | 2 | 2 | ||||||||
MIRT636153 | TRPS1 | transcriptional repressor GATA binding 1 | 2 | 2 | ||||||||
MIRT638255 | SIX1 | SIX homeobox 1 | 2 | 2 | ||||||||
MIRT638330 | RCAN1 | regulator of calcineurin 1 | 2 | 2 | ||||||||
MIRT641621 | KIAA1244 | ARFGEF family member 3 | 3 | 3 | ||||||||
MIRT644556 | SPOP | speckle type BTB/POZ protein | 2 | 2 | ||||||||
MIRT645900 | LRIF1 | ligand dependent nuclear receptor interacting factor 1 | 2 | 2 | ||||||||
MIRT649115 | SRD5A1 | steroid 5 alpha-reductase 1 | 2 | 2 | ||||||||
MIRT652244 | TPI1 | triosephosphate isomerase 1 | 2 | 2 | ||||||||
MIRT657249 | ICOSLG | inducible T-cell costimulator ligand | 2 | 2 | ||||||||
MIRT659857 | CAPRIN1 | cell cycle associated protein 1 | 2 | 4 | ||||||||
MIRT665369 | XIAP | X-linked inhibitor of apoptosis | 2 | 2 | ||||||||
MIRT669214 | CAND1 | cullin associated and neddylation dissociated 1 | 2 | 2 | ||||||||
MIRT682579 | CPA4 | carboxypeptidase A4 | 2 | 2 | ||||||||
MIRT698725 | STX6 | syntaxin 6 | 2 | 4 | ||||||||
MIRT699788 | SEC24A | SEC24 homolog A, COPII coat complex component | 2 | 2 | ||||||||
MIRT700290 | RABGEF1 | RAB guanine nucleotide exchange factor 1 | 2 | 2 | ||||||||
MIRT710374 | LMBR1 | limb development membrane protein 1 | 2 | 2 | ||||||||
MIRT710407 | YTHDC1 | YTH domain containing 1 | 2 | 2 | ||||||||
MIRT710569 | TNPO1 | transportin 1 | 2 | 2 | ||||||||
MIRT711384 | PLEKHG4B | pleckstrin homology and RhoGEF domain containing G4B | 2 | 2 | ||||||||
MIRT712042 | STYK1 | serine/threonine/tyrosine kinase 1 | 2 | 2 | ||||||||
MIRT712717 | NCAPG2 | non-SMC condensin II complex subunit G2 | 2 | 2 | ||||||||
MIRT713288 | ADAMTS20 | ADAM metallopeptidase with thrombospondin type 1 motif 20 | 2 | 2 | ||||||||
MIRT715649 | USP6NL | USP6 N-terminal like | 2 | 2 | ||||||||
MIRT716167 | FAM71F2 | family with sequence similarity 71 member F2 | 2 | 2 | ||||||||
MIRT716756 | TRABD2A | TraB domain containing 2A | 2 | 2 | ||||||||
MIRT718209 | TNRC6C | trinucleotide repeat containing 6C | 2 | 2 | ||||||||
MIRT718361 | SOX1 | SRY-box 1 | 2 | 2 | ||||||||
MIRT718806 | SLC25A33 | solute carrier family 25 member 33 | 2 | 2 | ||||||||
MIRT719339 | VGLL4 | vestigial like family member 4 | 2 | 2 | ||||||||
MIRT719671 | SPDYE1 | speedy/RINGO cell cycle regulator family member E1 | 2 | 2 | ||||||||
MIRT720827 | C1orf52 | chromosome 1 open reading frame 52 | 2 | 2 | ||||||||
MIRT722184 | DNAJC9 | DnaJ heat shock protein family (Hsp40) member C9 | 2 | 2 | ||||||||
MIRT722398 | BCAS2 | BCAS2, pre-mRNA processing factor | 2 | 2 | ||||||||
MIRT723460 | ST8SIA3 | ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3 | 2 | 2 | ||||||||
MIRT724072 | NCKAP1L | NCK associated protein 1 like | 2 | 2 | ||||||||
MIRT724594 | AP3B1 | adaptor related protein complex 3 beta 1 subunit | 2 | 2 | ||||||||
MIRT725234 | PDE1B | phosphodiesterase 1B | 2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|