pre-miRNA Information
pre-miRNA hsa-mir-4781   
Genomic Coordinates chr1: 54054079 - 54054154
Description Homo sapiens miR-4781 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4781-3p
Sequence 46| AAUGUUGGAAUCCUCGCUAGAG |67
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs968609764 2 dbSNP
rs899910686 3 dbSNP
rs74085143 4 dbSNP
rs550946107 8 dbSNP
rs747064911 10 dbSNP
rs1352517651 13 dbSNP
rs1436072914 22 dbSNP
Putative Targets

Gene Information
Gene Symbol AGTPBP1   
Synonyms CCP1, NNA1
Description ATP/GTP binding protein 1
Transcript NM_015239   
Expression
Putative miRNA Targets on AGTPBP1
3'UTR of AGTPBP1
(miRNA target sites are highlighted)
>AGTPBP1|NM_015239|3'UTR
   1 GCCCGCTGCCATCTCTTGTTAACTGCAAAGAATAAATGAAATATCTTGGTTTTTATTTCCCAGGAAGCTTGAGAGAAATG
  81 AGTTTATACAGAGCTGACTCAAAAAGACAAAAAGTAACTTGGGCCAGTTTGGTTTCAAGATAATAAATGTGTTATTAATT
 161 AATGATAAAATTGGCGCTTGTTTTATTTTCGATATTCAATGCACTTTATGTAGCATTGAATGATCAAATATTGGATTTAC
 241 CTTTAAAAAAAAAACCTGAGTATCATTGCATGAATTTTTATCTCCCTATGGTTATATCCTGCATCAAGTGGATAATTTTG
 321 AAGTGTGTTCAGAATATAAAATTGAAATTTTAGAGTTGTTGAAAATCCTGACTTGTTGAAAACTAATATATATGTACATG
 401 GATTTCTATAGATGTGTTTGTTTAGAAGTGGGTAGATATTGCAGATAAGACTGTTCTTCAGAATCATGTTAACTATTGGG
 481 TTGTGACTGAAGTAGTCCAGGGTTTGCCTTGAAACCATTACATTCTACATTTACCAAATTAAACAAATAAAAACTGTATT
 561 AAATGTTGCAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' gagaUCGCUC---CUAAGGUUGUAa 5'
              :|| ||   |:||:||| || 
Target 5' cttgGGCCAGTTTGGTTTCAAGATa 3'
118 - 142 114.00 -9.00
2
miRNA  3' gagAUC-GCUCCUAA----------GGU--UGUAa 5'
             ||| | |||:||          |||  |||| 
Target 5' aagTAGTCCAGGGTTTGCCTTGAAACCATTACATt 3'
490 - 524 109.00 -10.40
3
miRNA  3' gaGAUCGCUCCUA-AGGUUGUAa 5'
            ||| :|:  || ||| :||| 
Target 5' ccCTA-TGGTTATATCCTGCATc 3'
284 - 305 107.00 -5.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30141920 13 COSMIC
COSN31586389 30 COSMIC
COSN26965512 45 COSMIC
COSN31599154 45 COSMIC
COSN31547907 53 COSMIC
COSN30577754 54 COSMIC
COSN30450827 61 COSMIC
COSN31482611 100 COSMIC
COSN31612014 124 COSMIC
COSN30496804 126 COSMIC
COSN30528579 182 COSMIC
COSN29073844 244 COSMIC
COSN21247118 398 COSMIC
COSN9286865 520 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs770161230 2 dbSNP
rs200269013 4 dbSNP
rs371388579 5 dbSNP
rs746537872 11 dbSNP
rs558578947 12 dbSNP
rs758218580 15 dbSNP
rs377366142 23 dbSNP
rs1275221117 25 dbSNP
rs1189082189 30 dbSNP
rs371574763 31 dbSNP
rs56148123 34 dbSNP
rs374990965 37 dbSNP
rs757185840 44 dbSNP
rs951043644 49 dbSNP
rs184923853 56 dbSNP
rs766864819 62 dbSNP
rs577331626 64 dbSNP
rs1446042405 79 dbSNP
rs1281753455 80 dbSNP
rs1405071331 83 dbSNP
rs1453031324 86 dbSNP
rs554075625 90 dbSNP
rs1385212735 96 dbSNP
rs534198724 107 dbSNP
rs1306359055 109 dbSNP
rs997349788 111 dbSNP
rs576824120 122 dbSNP
rs1353216662 123 dbSNP
rs147024207 126 dbSNP
rs1044569835 134 dbSNP
rs1461148995 148 dbSNP
rs1204661066 155 dbSNP
rs1244616575 158 dbSNP
rs1012427328 162 dbSNP
rs1437408047 166 dbSNP
rs1245833689 167 dbSNP
rs896197791 175 dbSNP
rs1038937441 176 dbSNP
rs192876044 185 dbSNP
rs141421425 190 dbSNP
rs902183690 191 dbSNP
rs1338402695 198 dbSNP
rs1043646855 201 dbSNP
rs1384145717 203 dbSNP
rs946620705 208 dbSNP
rs921778605 213 dbSNP
rs1374163471 214 dbSNP
rs1360851778 231 dbSNP
rs550189746 236 dbSNP
rs1054628442 237 dbSNP
rs1323384485 239 dbSNP
rs1162728004 241 dbSNP
rs1265349343 244 dbSNP
rs1456223379 245 dbSNP
rs1422612934 248 dbSNP
rs934376422 250 dbSNP
rs944792438 254 dbSNP
rs1428544978 255 dbSNP
rs1481333705 255 dbSNP
rs796786669 255 dbSNP
rs924113867 255 dbSNP
rs1178376621 262 dbSNP
rs1421188117 285 dbSNP
rs1387064767 288 dbSNP
rs1170012421 296 dbSNP
rs189422340 304 dbSNP
rs747102708 312 dbSNP
rs1301342204 315 dbSNP
rs1345479671 329 dbSNP
rs949547507 331 dbSNP
rs1285650600 343 dbSNP
rs1239874579 356 dbSNP
rs918189669 362 dbSNP
rs532240899 368 dbSNP
rs566639533 373 dbSNP
rs991067374 376 dbSNP
rs1447253460 387 dbSNP
rs1490509325 390 dbSNP
rs1201513614 392 dbSNP
rs950787746 401 dbSNP
rs938026849 403 dbSNP
rs1474976267 407 dbSNP
rs909184289 408 dbSNP
rs761207368 409 dbSNP
rs1411835383 411 dbSNP
rs1222280430 414 dbSNP
rs546964504 416 dbSNP
rs1425316764 420 dbSNP
rs1305494084 422 dbSNP
rs984877465 425 dbSNP
rs1027638916 431 dbSNP
rs1271118205 435 dbSNP
rs973679482 441 dbSNP
rs1243317622 442 dbSNP
rs1290507665 445 dbSNP
rs970274693 447 dbSNP
rs1228946532 450 dbSNP
rs778653044 461 dbSNP
rs1338758203 465 dbSNP
rs1268495678 466 dbSNP
rs1014389643 472 dbSNP
rs895963874 475 dbSNP
rs1034813885 478 dbSNP
rs999662625 485 dbSNP
rs1229831680 489 dbSNP
rs902214757 490 dbSNP
rs3185651 497 dbSNP
rs1181994432 498 dbSNP
rs1384771144 502 dbSNP
rs946656728 504 dbSNP
rs1165499830 512 dbSNP
rs1367363406 523 dbSNP
rs1400607777 523 dbSNP
rs1319473106 527 dbSNP
rs1347328856 532 dbSNP
rs900390705 538 dbSNP
rs1017957826 547 dbSNP
rs1039289035 557 dbSNP
rs1324064386 565 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 23287.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' gagaucgcuccuaaGGUUGUAa 5'
                        ||||||| 
Target 5' -----------uggCCAACAUg 3'
1 - 11
Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000376083.3 | 3UTR | UGGCCAACAUGGUGAAACUCCACC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
204 hsa-miR-4781-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT071728 CCNK cyclin K 2 2
MIRT184858 FLVCR1 feline leukemia virus subgroup C cellular receptor 1 2 2
MIRT205881 TNRC6B trinucleotide repeat containing 6B 2 2
MIRT218699 ANKS1A ankyrin repeat and sterile alpha motif domain containing 1A 2 2
MIRT223783 OXR1 oxidation resistance 1 2 2
MIRT242435 GAN gigaxonin 2 2
MIRT306825 NCBP2 nuclear cap binding protein subunit 2 2 2
MIRT334170 CCND1 cyclin D1 2 6
MIRT339617 TMPO thymopoietin 2 2
MIRT400371 C2ORF68 chromosome 2 open reading frame 68 2 2
MIRT445533 KIF1B kinesin family member 1B 2 4
MIRT450273 F2RL2 coagulation factor II thrombin receptor like 2 2 2
MIRT450701 RORA RAR related orphan receptor A 2 2
MIRT451160 C19orf53 chromosome 19 open reading frame 53 2 2
MIRT453775 NUCB1 nucleobindin 1 2 10
MIRT453884 IFRD1 interferon related developmental regulator 1 2 12
MIRT454238 OSBPL10 oxysterol binding protein like 10 2 9
MIRT458661 PAGR1 PAXIP1 associated glutamate rich protein 1 2 12
MIRT466948 STAU1 staufen double-stranded RNA binding protein 1 2 2
MIRT470278 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 2 2
MIRT471144 PHF19 PHD finger protein 19 2 2
MIRT471873 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 2
MIRT476739 FOXN2 forkhead box N2 2 2
MIRT480453 C16orf72 chromosome 16 open reading frame 72 2 6
MIRT482107 AKT3 AKT serine/threonine kinase 3 2 4
MIRT483374 CYP4A22 cytochrome P450 family 4 subfamily A member 22 2 2
MIRT484063 CYP4A11 cytochrome P450 family 4 subfamily A member 11 2 2
MIRT496329 SH3BGRL SH3 domain binding glutamate rich protein like 2 2
MIRT498659 AP3B2 adaptor related protein complex 3 beta 2 subunit 2 4
MIRT498711 PGAM5 PGAM family member 5, mitochondrial serine/threonine protein phosphatase 2 10
MIRT499322 ZNF485 zinc finger protein 485 2 6
MIRT499711 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 2 10
MIRT499767 CIRH1A UTP4, small subunit processome component 2 6
MIRT499912 PIGO phosphatidylinositol glycan anchor biosynthesis class O 2 8
MIRT504946 ZSWIM6 zinc finger SWIM-type containing 6 2 4
MIRT505377 TMEM154 transmembrane protein 154 2 4
MIRT508778 GSG1 germ cell associated 1 2 2
MIRT509793 CHAF1B chromatin assembly factor 1 subunit B 2 4
MIRT512421 LAYN layilin 2 4
MIRT513321 SCUBE3 signal peptide, CUB domain and EGF like domain containing 3 2 2
MIRT513592 DCTN6 dynactin subunit 6 2 2
MIRT514785 RBM4B RNA binding motif protein 4B 2 2
MIRT514859 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 2
MIRT515122 LMOD3 leiomodin 3 2 2
MIRT515271 CSNK1E casein kinase 1 epsilon 2 2
MIRT515594 FBXL13 F-box and leucine rich repeat protein 13 2 2
MIRT515880 PLXDC2 plexin domain containing 2 2 2
MIRT515908 AGTPBP1 ATP/GTP binding protein 1 2 2
MIRT515960 C9orf156 tRNA methyltransferase O 2 2
MIRT517210 OTUD6A OTU deubiquitinase 6A 2 2
MIRT517330 ZNF347 zinc finger protein 347 2 2
MIRT517480 PEX26 peroxisomal biogenesis factor 26 2 2
MIRT517594 ZNF579 zinc finger protein 579 2 4
MIRT517676 TRIM72 tripartite motif containing 72 2 2
MIRT518215 TRMT10B tRNA methyltransferase 10B 2 2
MIRT518583 ATP8B1 ATPase phospholipid transporting 8B1 2 2
MIRT518777 ZFP14 ZFP14 zinc finger protein 2 2
MIRT519094 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 2 4
MIRT519112 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 2 2
MIRT519400 DNASE2 deoxyribonuclease 2, lysosomal 2 4
MIRT519446 GLA galactosidase alpha 2 2
MIRT519476 SPTLC2 serine palmitoyltransferase long chain base subunit 2 2 2
MIRT519711 ZNF584 zinc finger protein 584 2 4
MIRT521409 RDH11 retinol dehydrogenase 11 (all-trans/9-cis/11-cis) 2 2
MIRT521522 QSOX1 quiescin sulfhydryl oxidase 1 2 2
MIRT522652 MANEAL mannosidase endo-alpha like 2 2
MIRT523505 GMPS guanine monophosphate synthase 2 4
MIRT523795 FAM63B MINDY lysine 48 deubiquitinase 2 2 2
MIRT524062 DNAJC8 DnaJ heat shock protein family (Hsp40) member C8 2 2
MIRT524136 DMXL1 Dmx like 1 2 2
MIRT524192 DENND4C DENN domain containing 4C 2 4
MIRT525925 KIAA0391 KIAA0391 2 2
MIRT528021 ACOT9 acyl-CoA thioesterase 9 2 2
MIRT528685 CEP57L1 centrosomal protein 57 like 1 2 2
MIRT528769 CD1D CD1d molecule 2 2
MIRT529373 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 2 4
MIRT529469 ZNF546 zinc finger protein 546 2 2
MIRT529641 ZNF621 zinc finger protein 621 2 2
MIRT530681 CHRNB1 cholinergic receptor nicotinic beta 1 subunit 2 4
MIRT530752 GPR82 G protein-coupled receptor 82 2 2
MIRT531628 TM4SF5 transmembrane 4 L six family member 5 2 4
MIRT531649 C19orf52 translocase of inner mitochondrial membrane 29 2 4
MIRT532179 SEC14L5 SEC14 like lipid binding 5 2 4
MIRT532219 CCDC117 coiled-coil domain containing 117 2 2
MIRT534238 SLC25A16 solute carrier family 25 member 16 2 4
MIRT539952 SLC30A5 solute carrier family 30 member 5 2 2
MIRT540179 MB21D1 Mab-21 domain containing 1 2 2
MIRT540466 ZNF71 zinc finger protein 71 2 2
MIRT540560 PPIC peptidylprolyl isomerase C 2 2
MIRT543265 ZNF662 zinc finger protein 662 2 2
MIRT543596 KIAA1549 KIAA1549 2 2
MIRT543971 RNF20 ring finger protein 20 2 2
MIRT544053 C9orf64 chromosome 9 open reading frame 64 2 2
MIRT544605 DCAF5 DDB1 and CUL4 associated factor 5 2 2
MIRT544679 AP1S1 adaptor related protein complex 1 sigma 1 subunit 2 2
MIRT547627 LCOR ligand dependent nuclear receptor corepressor 2 2
MIRT550668 TRAF1 TNF receptor associated factor 1 2 2
MIRT551533 EMB embigin 2 2
MIRT552443 ZNF449 zinc finger protein 449 2 2
MIRT559265 BAG4 BCL2 associated athanogene 4 2 4
MIRT562479 CHORDC1 cysteine and histidine rich domain containing 1 2 2
MIRT564211 SDE2 SDE2 telomere maintenance homolog 2 2
MIRT565973 RPP14 ribonuclease P/MRP subunit p14 2 2
MIRT570524 SHH sonic hedgehog 2 2
MIRT575307 Osbpl10 oxysterol binding protein-like 10 2 6
MIRT618212 C22orf39 chromosome 22 open reading frame 39 2 2
MIRT620115 HARBI1 harbinger transposase derived 1 2 2
MIRT624062 EIF4E eukaryotic translation initiation factor 4E 2 2
MIRT626083 CWF19L1 CWF19 like 1, cell cycle control (S. pombe) 2 2
MIRT629868 GATAD1 GATA zinc finger domain containing 1 2 2
MIRT630750 COG6 component of oligomeric golgi complex 6 2 2
MIRT631002 ZNF573 zinc finger protein 573 2 2
MIRT631100 UQCRB ubiquinol-cytochrome c reductase binding protein 2 2
MIRT631290 SGSM1 small G protein signaling modulator 1 2 2
MIRT631337 CD300E CD300e molecule 2 2
MIRT631532 MYO6 myosin VI 2 2
MIRT631644 WDR91 WD repeat domain 91 2 4
MIRT632788 LZIC leucine zipper and CTNNBIP1 domain containing 2 2
MIRT633282 FGFR1OP2 FGFR1 oncogene partner 2 2 2
MIRT633593 ABRACL ABRA C-terminal like 2 2
MIRT634074 PLIN3 perilipin 3 2 2
MIRT634163 YME1L1 YME1 like 1 ATPase 2 2
MIRT634257 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 2 2
MIRT634679 GDE1 glycerophosphodiester phosphodiesterase 1 2 2
MIRT638384 RABL3 RAB, member of RAS oncogene family like 3 2 2
MIRT638687 GCLM glutamate-cysteine ligase modifier subunit 2 2
MIRT640311 PRR13 proline rich 13 2 2
MIRT641132 NPHP3 nephrocystin 3 2 2
MIRT642315 FPR1 formyl peptide receptor 1 2 2
MIRT643703 KIAA0586 KIAA0586 2 2
MIRT644322 NFKBID NFKB inhibitor delta 2 2
MIRT645741 POLR3A RNA polymerase III subunit A 2 2
MIRT646975 CYP2W1 cytochrome P450 family 2 subfamily W member 1 2 2
MIRT648064 TRMT10C tRNA methyltransferase 10C, mitochondrial RNase P subunit 2 2
MIRT648536 CHCHD4 coiled-coil-helix-coiled-coil-helix domain containing 4 2 2
MIRT649294 NEK8 NIMA related kinase 8 2 2
MIRT650014 KLB klotho beta 2 2
MIRT650551 YIPF4 Yip1 domain family member 4 2 2
MIRT651796 UTP6 UTP6, small subunit processome component 2 2
MIRT652647 TIMM10 translocase of inner mitochondrial membrane 10 2 2
MIRT653548 SLC38A7 solute carrier family 38 member 7 2 2
MIRT653895 SGK3 serum/glucocorticoid regulated kinase family member 3 2 2
MIRT655470 PAK3 p21 (RAC1) activated kinase 3 2 2
MIRT657764 GMEB1 glucocorticoid modulatory element binding protein 1 2 2
MIRT659118 DENND6A DENN domain containing 6A 2 2
MIRT659377 CREG2 cellular repressor of E1A stimulated genes 2 2 2
MIRT659836 CARHSP1 calcium regulated heat stable protein 1 2 2
MIRT659954 C8orf44-SGK3 C8orf44-SGK3 readthrough 2 2
MIRT660258 BLOC1S6 biogenesis of lysosomal organelles complex 1 subunit 6 2 2
MIRT663268 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 2 2
MIRT663766 ZNF285 zinc finger protein 285 2 2
MIRT666198 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 2 2
MIRT669763 ZNF101 zinc finger protein 101 2 4
MIRT669933 LRPAP1 LDL receptor related protein associated protein 1 2 2
MIRT670007 GPR156 G protein-coupled receptor 156 2 4
MIRT670465 RSBN1L round spermatid basic protein 1 like 2 2
MIRT670868 IFNAR1 interferon alpha and beta receptor subunit 1 2 4
MIRT671313 RABGAP1L RAB GTPase activating protein 1 like 2 2
MIRT671959 SPPL3 signal peptide peptidase like 3 2 2
MIRT672281 SHE Src homology 2 domain containing E 2 2
MIRT673654 CYCS cytochrome c, somatic 2 2
MIRT674063 ATXN3 ataxin 3 2 2
MIRT674423 IPP intracisternal A particle-promoted polypeptide 2 2
MIRT674438 MIOX myo-inositol oxygenase 2 4
MIRT674483 BCL2L15 BCL2 like 15 2 2
MIRT675478 NUBPL nucleotide binding protein like 2 2
MIRT675648 TTPAL alpha tocopherol transfer protein like 2 2
MIRT675981 FAM126B family with sequence similarity 126 member B 2 2
MIRT676251 PARP2 poly(ADP-ribose) polymerase 2 2 2
MIRT677652 HAUS2 HAUS augmin like complex subunit 2 2 2
MIRT682718 KIAA1456 KIAA1456 2 2
MIRT687545 MOB1B MOB kinase activator 1B 2 2
MIRT689620 AKAP6 A-kinase anchoring protein 6 2 2
MIRT690035 CCDC90B coiled-coil domain containing 90B 2 2
MIRT691449 CXorf36 chromosome X open reading frame 36 2 2
MIRT691549 FLYWCH2 FLYWCH family member 2 2 2
MIRT691737 LARS leucyl-tRNA synthetase 2 2
MIRT692638 SUSD1 sushi domain containing 1 2 2
MIRT693866 IYD iodotyrosine deiodinase 2 2
MIRT693979 ZNF70 zinc finger protein 70 2 2
MIRT694150 CYP27C1 cytochrome P450 family 27 subfamily C member 1 2 2
MIRT695492 TRAT1 T-cell receptor associated transmembrane adaptor 1 2 2
MIRT695547 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 2 2
MIRT696023 TYRO3 TYRO3 protein tyrosine kinase 2 2
MIRT696402 CORO7 coronin 7 2 2
MIRT703028 HEATR5A HEAT repeat containing 5A 2 2
MIRT703559 FKBP14 FK506 binding protein 14 2 2
MIRT705036 CACUL1 CDK2 associated cullin domain 1 2 2
MIRT705120 C4orf29 abhydrolase domain containing 18 2 2
MIRT706611 CYB5B cytochrome b5 type B 2 2
MIRT706635 PNPT1 polyribonucleotide nucleotidyltransferase 1 2 2
MIRT706730 RFK riboflavin kinase 2 2
MIRT706868 MAFF MAF bZIP transcription factor F 2 2
MIRT707020 RRP36 ribosomal RNA processing 36 2 2
MIRT707036 ACTR5 ARP5 actin related protein 5 homolog 2 2
MIRT707125 ZNF154 zinc finger protein 154 2 2
MIRT707390 SLC35F6 solute carrier family 35 member F6 2 2
MIRT708664 LYRM7 LYR motif containing 7 2 2
MIRT713010 BBX BBX, HMG-box containing 2 2
MIRT717314 TRAF3IP1 TRAF3 interacting protein 1 2 2
MIRT721912 C6orf201 chromosome 6 open reading frame 201 2 2
MIRT723050 YTHDC1 YTH domain containing 1 2 2
MIRT725038 NDUFAF7 NADH:ubiquinone oxidoreductase complex assembly factor 7 2 2
MIRT755316 SMAD5 SMAD family member 5 4 1
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4781-3p Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-4781-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-4781-3p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-4781-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)

Error report submission