pre-miRNA Information
pre-miRNA hsa-mir-6818   
Genomic Coordinates chr22: 30007049 - 30007113
Description Homo sapiens miR-6818 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-6818-5p
Sequence 6| UUGUGUGAGUACAGAGAGCAUC |27
Evidence Experimental
Experiments Meta-analysis
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs763248242 2 dbSNP
rs186621048 3 dbSNP
rs1455267770 12 dbSNP
rs1170462641 19 dbSNP
rs1435853423 22 dbSNP
Putative Targets

Gene Information
Gene Symbol C9orf156
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293
Disease 51531.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "HITS-CLIP data was present in GSM714642. RNA binding protein: AGO2. Condition:completeT1 "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 51531.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM714642
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000375119.3 | 3UTR | ACACACACAUAUAUAUAUGUAUAUAUAUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000375119.3 | 3UTR | UCACACACACAUAUAUAUAUGUAUAUAUAUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000375119.3 | 3UTR | UCACACACACAUAUAUAUAUGUAUAUAUAUUUAAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
140 hsa-miR-6818-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT071796 RNF11 ring finger protein 11 2 2
MIRT077120 NKIRAS2 NFKB inhibitor interacting Ras like 2 2 4
MIRT079951 RNF138 ring finger protein 138 2 2
MIRT102968 EN2 engrailed homeobox 2 2 4
MIRT115694 MGRN1 mahogunin ring finger 1 2 2
MIRT121074 FGFRL1 fibroblast growth factor receptor like 1 2 2
MIRT143171 GLYR1 glyoxylate reductase 1 homolog 2 2
MIRT145635 LASP1 LIM and SH3 protein 1 2 2
MIRT282026 ARID3B AT-rich interaction domain 3B 2 6
MIRT301684 EP300 E1A binding protein p300 2 2
MIRT328627 AKIRIN1 akirin 1 2 2
MIRT340977 IPO5 importin 5 2 2
MIRT371401 STC2 stanniocalcin 2 2 2
MIRT378008 TMED7 transmembrane p24 trafficking protein 7 2 4
MIRT445185 CCDC88C coiled-coil domain containing 88C 2 2
MIRT447120 DUSP16 dual specificity phosphatase 16 2 2
MIRT449153 SORCS2 sortilin related VPS10 domain containing receptor 2 2 2
MIRT450200 ABHD15 abhydrolase domain containing 15 2 2
MIRT453853 ZNF12 zinc finger protein 12 2 2
MIRT459077 LSM1 LSM1 homolog, mRNA degradation associated 2 2
MIRT461304 MRPS27 mitochondrial ribosomal protein S27 2 2
MIRT464137 VPS28 VPS28, ESCRT-I subunit 2 2
MIRT468114 SH3PXD2A SH3 and PX domains 2A 2 2
MIRT471401 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT478220 DDX52 DExD-box helicase 52 2 2
MIRT479695 CCNT1 cyclin T1 2 2
MIRT479779 CCND1 cyclin D1 2 2
MIRT484980 UBE2V1 ubiquitin conjugating enzyme E2 V1 2 8
MIRT485016 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 2 8
MIRT485034 TMEM189 transmembrane protein 189 2 8
MIRT485221 PRICKLE1 prickle planar cell polarity protein 1 2 2
MIRT490143 TERF2IP TERF2 interacting protein 2 6
MIRT508908 DOK6 docking protein 6 2 6
MIRT513877 HNRNPUL1 heterogeneous nuclear ribonucleoprotein U like 1 2 4
MIRT515966 C9orf156 tRNA methyltransferase O 2 4
MIRT517892 CHAF1B chromatin assembly factor 1 subunit B 2 4
MIRT518660 CLVS2 clavesin 2 2 4
MIRT520027 YOD1 YOD1 deubiquitinase 2 6
MIRT523884 EPHA5 EPH receptor A5 2 4
MIRT529237 PORCN porcupine O-acyltransferase 2 2
MIRT535337 PFN1 profilin 1 2 2
MIRT537532 EZR ezrin 2 2
MIRT537695 ELOVL6 ELOVL fatty acid elongase 6 2 2
MIRT538494 CLOCK clock circadian regulator 2 2
MIRT539140 ARHGAP35 Rho GTPase activating protein 35 2 2
MIRT541380 CDKN1A cyclin dependent kinase inhibitor 1A 2 2
MIRT545018 PLP1 proteolipid protein 1 2 2
MIRT547732 KIF23 kinesin family member 23 2 4
MIRT548257 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT550372 MYLK3 myosin light chain kinase 3 2 2
MIRT551867 TMEM47 transmembrane protein 47 2 2
MIRT552289 SNAP29 synaptosome associated protein 29 2 2
MIRT552902 VSNL1 visinin like 1 2 8
MIRT552990 VAMP4 vesicle associated membrane protein 4 2 4
MIRT554729 RHOC ras homolog family member C 2 2
MIRT555301 PPP3CB protein phosphatase 3 catalytic subunit beta 2 2
MIRT556832 KATNAL1 katanin catalytic subunit A1 like 1 2 2
MIRT557523 GPBP1L1 GC-rich promoter binding protein 1 like 1 2 2
MIRT558238 EDA2R ectodysplasin A2 receptor 2 2
MIRT558920 CBX1 chromobox 1 2 2
MIRT559198 BLOC1S6 biogenesis of lysosomal organelles complex 1 subunit 6 2 2
MIRT559611 AMER1 APC membrane recruitment protein 1 2 2
MIRT559769 URGCP-MRPS24 URGCP-MRPS24 readthrough 2 4
MIRT564648 ZNF487P zinc finger protein 487 1 1
MIRT565856 NHS NHS actin remodeling regulator 2 2
MIRT569044 ZNF655 zinc finger protein 655 2 2
MIRT569154 SIGMAR1 sigma non-opioid intracellular receptor 1 2 2
MIRT569166 DMD dystrophin 2 2
MIRT569205 CASZ1 castor zinc finger 1 2 2
MIRT569264 BRWD3 bromodomain and WD repeat domain containing 3 2 2
MIRT569431 FLVCR1 feline leukemia virus subgroup C cellular receptor 1 2 2
MIRT569476 CTSE cathepsin E 2 2
MIRT570232 NCAN neurocan 2 2
MIRT570519 SHH sonic hedgehog 2 2
MIRT570680 FZD5 frizzled class receptor 5 2 2
MIRT572161 CRK CRK proto-oncogene, adaptor protein 2 2
MIRT575142 Cd93 CD93 antigen 2 3
MIRT575644 Mitf microphthalmia-associated transcription factor 2 3
MIRT575653 Synpo synaptopodin 2 4
MIRT576375 Runx1t1 runt-related transcription factor 1; translocated to, 1 (cyclin D-related) 2 2
MIRT576388 Fhl2 four and a half LIM domains 2 2 3
MIRT576413 Pla2g16 phospholipase A2, group XVI 2 2
MIRT576697 Hps3 HPS3, biogenesis of lysosomal organelles complex 2 subunit 1 2 3
MIRT606872 CHST11 carbohydrate sulfotransferase 11 2 4
MIRT606940 GFRA1 GDNF family receptor alpha 1 2 6
MIRT607025 ZEB1 zinc finger E-box binding homeobox 1 2 2
MIRT607028 PPY pancreatic polypeptide 2 4
MIRT607081 MITF melanogenesis associated transcription factor 2 3
MIRT607769 HS6ST3 heparan sulfate 6-O-sulfotransferase 3 2 6
MIRT607881 SATB1 SATB homeobox 1 2 2
MIRT607996 BTBD9 BTB domain containing 9 2 2
MIRT608124 TSC22D2 TSC22 domain family member 2 2 2
MIRT608132 TGFBR2 transforming growth factor beta receptor 2 2 2
MIRT608209 ADAT2 adenosine deaminase, tRNA specific 2 2 2
MIRT608337 SPN sialophorin 2 2
MIRT608416 SYNPO synaptopodin 2 5
MIRT608459 CD93 CD93 molecule 2 3
MIRT608555 SBK1 SH3 domain binding kinase 1 2 6
MIRT608585 PPP2R1B protein phosphatase 2 scaffold subunit Abeta 2 4
MIRT608785 JAKMIP2 janus kinase and microtubule interacting protein 2 2 4
MIRT608791 CDH12 cadherin 12 2 2
MIRT608816 ONECUT3 one cut homeobox 3 2 6
MIRT608876 CNTF ciliary neurotrophic factor 2 6
MIRT608881 CLIC6 chloride intracellular channel 6 2 2
MIRT608894 ZNF860 zinc finger protein 860 2 2
MIRT608954 GIMAP1 GTPase, IMAP family member 1 2 4
MIRT609007 HPS3 HPS3, biogenesis of lysosomal organelles complex 2 subunit 1 2 3
MIRT609045 INVS inversin 2 4
MIRT619037 CASS4 Cas scaffolding protein family member 4 2 2
MIRT625226 RPSAP58 ribosomal protein SA pseudogene 58 2 4
MIRT625545 GABRB2 gamma-aminobutyric acid type A receptor beta2 subunit 2 2
MIRT627333 TTLL7 tubulin tyrosine ligase like 7 2 2
MIRT627954 NLK nemo like kinase 2 2
MIRT629280 UNC13A unc-13 homolog A 2 2
MIRT634982 TNFAIP8 TNF alpha induced protein 8 2 2
MIRT646129 C1orf147 chromosome 1 open reading frame 147 2 2
MIRT646370 SLC22A6 solute carrier family 22 member 6 2 2
MIRT652743 TGFA transforming growth factor alpha 2 4
MIRT653984 SEMA6A semaphorin 6A 2 2
MIRT660038 C15orf61 chromosome 15 open reading frame 61 2 2
MIRT663504 NKAPL NFKB activating protein like 2 4
MIRT667117 OCIAD2 OCIA domain containing 2 2 2
MIRT683747 C3orf36 chromosome 3 open reading frame 36 2 2
MIRT683922 SLC43A3 solute carrier family 43 member 3 2 2
MIRT684101 LHFP LHFPL tetraspan subfamily member 6 2 2
MIRT684224 FGF14 fibroblast growth factor 14 2 2
MIRT685560 SRD5A3 steroid 5 alpha-reductase 3 2 2
MIRT687408 NRXN1 neurexin 1 2 2
MIRT687467 NHSL2 NHS like 2 2 2
MIRT687695 LEPREL1 prolyl 3-hydroxylase 2 1 1
MIRT688094 GLRA3 glycine receptor alpha 3 2 2
MIRT688255 FHL2 four and a half LIM domains 2 2 3
MIRT688851 CAMKK2 calcium/calmodulin dependent protein kinase kinase 2 2 2
MIRT700293 RABGEF1 RAB guanine nucleotide exchange factor 1 2 2
MIRT704679 CHST2 carbohydrate sulfotransferase 2 2 2
MIRT706392 PPID peptidylprolyl isomerase D 2 2
MIRT707388 SLC35F6 solute carrier family 35 member F6 2 2
MIRT707509 PPP1R16B protein phosphatase 1 regulatory subunit 16B 2 2
MIRT709808 AR androgen receptor 2 2
MIRT715491 MAZ MYC associated zinc finger protein 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-6818-5p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-6818-5p Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-6818-5p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)

Error report submission