miRTarBase - #MIRT516109


—
pre-miRNA Information
pre-miRNA hsa-mir-4732   
Genomic Coordinates chr17: 28861655 - 28861730
Description Homo sapiens miR-4732 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4732-5p
Sequence 9| UGUAGAGCAGGGAGCAGGAAGCU |31
Evidence Experimental
Experiments Illumina
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 19 17 - 28861704 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1217937677 2 dbSNP
rs758352089 5 dbSNP
rs1043420842 7 dbSNP
rs1282565841 10 dbSNP
rs1221758243 12 dbSNP
rs1380889672 13 dbSNP
rs1284341041 15 dbSNP
rs1413647390 16 dbSNP
rs762363998 18 dbSNP
rs1352947256 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol OARD1   
Synonyms C6orf130, TARG1, dJ34B21.3
Description O-acyl-ADP-ribose deacylase 1
Transcript NM_145063   
Expression
Putative miRNA Targets on OARD1
3'UTR of OARD1
(miRNA target sites are highlighted)		 
>OARD1|NM_145063|3'UTR
   1 ACCAGTGAACATTTTGGATGTTTCCGTGTTCTCCTGTGTCATCTCTACTGGGCCATAGGACCGGGCAAACCTACCTTAAA
  81 ATAGGCAGAGGAAAGTTTCATGAGAAGTAGTGTGTTTAACAAGACAGACTTTGGTTGCTGTATTCAAGTATTTGGATTAT
 161 GACTGTGGAGGAGGGCTTGCTTAAGATATGTGGTTGTGTTTTTTTGTGGAAAAGTAAGGAGTTAGGTGGCTTGATAATAG
 241 GCAGGGAAACCAGATTGTCGGGACTATGACCTTTTTCTCCAGTATGCTACCTGATTTGTTTGGCTGGCCACTAGGTGGCA
 321 GCATTGGTTCTACTTCTCTGCTTTTTAAGAGAAATTTCAGGAAGGATGATCATTCCAGTTAGTTTGGCATTTTTTGTCGT
 401 TTGTGCACATAACTTGGTGTTATCCTTATGTCATCAGATTCCTCCTAGGGGAGAGTTTTTGTTTTAATTACAAAATTAAA
 481 TTCTACATTGTTACCAAGAAATTTGTGGTGATAAAAATGGAAAAATAAAAATTTGGGGAGTTAGTGAAAAAAAAAAAAAA
 561 AAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ucGAAGG-ACGAG-GGA------CGAGAUGu 5'
            :|||| ||:|| |||       |||||| 
Target 5' tgTTTCCGTGTTCTCCTGTGTCATCTCTACt 3'
 19 - 49 131.00 -23.50
2 
miRNA  3' ucgaaggaCGAGGGA--CGAGAUGu 5'
                  ||  | |  |:||||| 
Target 5' actaggtgGCAGCATTGGTTCTACt 3'
 310 - 334 125.00 -8.50
3 
miRNA  3' ucgaaggacgagggacGAGAUGu 5'
                          :||||| 
Target 5' taattacaaaattaaaTTCTACa 3'
 465 - 487 104.00 -7.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30485245 24 COSMIC
COSN30472442 25 COSMIC
COSN30170128 33 COSMIC
COSN31559774 38 COSMIC
COSN26671185 40 COSMIC
COSN507313 41 COSMIC
COSN30156642 45 COSMIC
COSN30164310 59 COSMIC
COSN26562524 61 COSMIC
COSN30497209 62 COSMIC
COSN31509151 64 COSMIC
COSN30544572 65 COSMIC
COSN31563438 70 COSMIC
COSN30137099 100 COSMIC
COSN30121579 128 COSMIC
COSN31491517 179 COSMIC
COSN29693953 212 COSMIC
COSN31579767 228 COSMIC
COSN28192744 263 COSMIC
COSN17577150 365 COSMIC
COSN5630195 472 COSMIC
COSN9907186 815 COSMIC
COSN17929644 1119 COSMIC
COSN17925003 1122 COSMIC
COSN22439541 1339 COSMIC
COSN23415458 1501 COSMIC
COSN23797416 1513 COSMIC
COSN9907185 1661 COSMIC
COSN23799185 1917 COSMIC
COSN21675705 2017 COSMIC
COSN22155541 2188 COSMIC
COSN7790417 2411 COSMIC
COSN27564464 2412 COSMIC
COSN7790416 2423 COSMIC
rs114812713 1074 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs764724990 6 dbSNP
rs371647903 7 dbSNP
rs1361929807 11 dbSNP
rs1470880492 11 dbSNP
rs749762738 15 dbSNP
rs1463515991 18 dbSNP
rs1187988221 23 dbSNP
rs759274647 24 dbSNP
rs1258495779 25 dbSNP
rs776232037 26 dbSNP
rs770594243 28 dbSNP
rs112260512 29 dbSNP
rs1278681573 36 dbSNP
rs768257950 38 dbSNP
rs746910477 39 dbSNP
rs773083175 50 dbSNP
rs1297595492 51 dbSNP
rs371749521 52 dbSNP
rs973134412 54 dbSNP
rs1470222391 56 dbSNP
rs182802798 62 dbSNP
rs1184768886 63 dbSNP
rs960104768 64 dbSNP
rs1332728120 65 dbSNP
rs1243348346 66 dbSNP
rs1053985513 72 dbSNP
rs527468988 79 dbSNP
rs1207919439 86 dbSNP
rs369156425 92 dbSNP
rs1194945480 93 dbSNP
rs921407628 94 dbSNP
rs1269964775 109 dbSNP
rs779948050 127 dbSNP
rs1439438978 132 dbSNP
rs1351502298 141 dbSNP
rs1283741990 153 dbSNP
rs1473936456 156 dbSNP
rs565039431 161 dbSNP
rs965458188 170 dbSNP
rs1166664083 173 dbSNP
rs545345635 184 dbSNP
rs969969125 185 dbSNP
rs1021377551 186 dbSNP
rs1011375498 187 dbSNP
rs1399057597 192 dbSNP
rs891538799 206 dbSNP
rs1411018690 211 dbSNP
rs1312804035 213 dbSNP
rs11280 216 dbSNP
rs1416630710 217 dbSNP
rs1337605293 224 dbSNP
rs1326031223 240 dbSNP
rs997573996 241 dbSNP
rs982800827 259 dbSNP
rs1434869644 260 dbSNP
rs555896307 261 dbSNP
rs1320871259 263 dbSNP
rs373780302 266 dbSNP
rs1205868102 272 dbSNP
rs1279506420 282 dbSNP
rs1401861540 288 dbSNP
rs747322109 291 dbSNP
rs1345543423 292 dbSNP
rs1039121922 293 dbSNP
rs942906196 295 dbSNP
rs994655064 297 dbSNP
rs1160999429 302 dbSNP
rs963202382 315 dbSNP
rs1375211448 321 dbSNP
rs1430796325 323 dbSNP
rs1033490812 325 dbSNP
rs1173581178 326 dbSNP
rs1002362856 328 dbSNP
rs1436689354 332 dbSNP
rs1303449550 338 dbSNP
rs1384317530 338 dbSNP
rs1048560218 340 dbSNP
rs542598971 348 dbSNP
rs931501490 354 dbSNP
rs1385508415 359 dbSNP
rs918662933 372 dbSNP
rs1463387627 385 dbSNP
rs972863575 386 dbSNP
rs573701479 390 dbSNP
rs1256119717 396 dbSNP
rs1485258937 396 dbSNP
rs766641604 398 dbSNP
rs892745638 399 dbSNP
rs1054058530 406 dbSNP
rs1243565755 408 dbSNP
rs777973441 421 dbSNP
rs938667536 422 dbSNP
rs936878165 423 dbSNP
rs921439459 426 dbSNP
rs1216233319 429 dbSNP
rs1039835731 433 dbSNP
rs980076820 448 dbSNP
rs1177383124 450 dbSNP
rs758412531 454 dbSNP
rs912640979 458 dbSNP
rs1226724860 464 dbSNP
rs1290868380 465 dbSNP
rs1361632345 469 dbSNP
rs192942363 470 dbSNP
rs1316026836 471 dbSNP
rs1435572821 473 dbSNP
rs1060042 483 dbSNP
rs1227879195 487 dbSNP
rs983218359 501 dbSNP
rs1368478652 503 dbSNP
rs1220946694 508 dbSNP
rs879678421 521 dbSNP
rs1021533340 528 dbSNP
rs1315831058 532 dbSNP
rs534157222 533 dbSNP
rs1291054869 538 dbSNP
rs919906104 540 dbSNP
rs1269658189 549 dbSNP
rs533726239 553 dbSNP
rs200228866 566 dbSNP
rs997247901 578 dbSNP
rs567283638 579 dbSNP
rs1192344320 581 dbSNP
rs146922258 590 dbSNP
rs1002034823 592 dbSNP
rs1426026733 593 dbSNP
rs548958744 601 dbSNP
rs1461160766 605 dbSNP
rs1167575396 614 dbSNP
rs1392098901 615 dbSNP
rs140117391 618 dbSNP
rs1294053654 623 dbSNP
rs890034225 624 dbSNP
rs11556586 632 dbSNP
rs1289729111 638 dbSNP
rs754144102 639 dbSNP
rs187275273 654 dbSNP
rs892148159 658 dbSNP
rs1323891918 662 dbSNP
rs938742306 663 dbSNP
rs566888987 665 dbSNP
rs1490866080 670 dbSNP
rs980067018 675 dbSNP
rs1184932167 677 dbSNP
rs1204503431 680 dbSNP
rs558059748 684 dbSNP
rs533438133 686 dbSNP
rs1163073885 689 dbSNP
rs565078409 690 dbSNP
rs551562468 694 dbSNP
rs1040310646 700 dbSNP
rs531547826 701 dbSNP
rs1406912586 704 dbSNP
rs944207548 705 dbSNP
rs891230826 707 dbSNP
rs1353681513 708 dbSNP
rs1460437390 711 dbSNP
rs1047154898 719 dbSNP
rs1031478574 727 dbSNP
rs1413566252 730 dbSNP
rs143191701 731 dbSNP
rs767300753 736 dbSNP
rs976322710 738 dbSNP
rs965789070 746 dbSNP
rs1306123561 752 dbSNP
rs930034650 752 dbSNP
rs919937514 761 dbSNP
rs1007227593 764 dbSNP
rs1306935793 769 dbSNP
rs761368423 779 dbSNP
rs1239449735 780 dbSNP
rs1473275191 781 dbSNP
rs887463416 782 dbSNP
rs1355960072 787 dbSNP
rs1170661940 790 dbSNP
rs1418606863 790 dbSNP
rs1170426929 792 dbSNP
rs941974234 797 dbSNP
rs926545991 801 dbSNP
rs1310597753 806 dbSNP
rs981034449 821 dbSNP
rs542284632 822 dbSNP
rs182810319 825 dbSNP
rs1448389743 828 dbSNP
rs1269217579 835 dbSNP
rs970604893 838 dbSNP
rs149123392 844 dbSNP
rs1360332710 851 dbSNP
rs1230989335 853 dbSNP
rs1299037825 854 dbSNP
rs1347736900 865 dbSNP
rs1037170446 868 dbSNP
rs1025199861 869 dbSNP
rs1215404499 881 dbSNP
rs1240515621 891 dbSNP
rs1447438473 892 dbSNP
rs532772797 896 dbSNP
rs1250955232 898 dbSNP
rs774043428 906 dbSNP
rs1003489245 909 dbSNP
rs1170736498 915 dbSNP
rs1317198935 917 dbSNP
rs1426729206 917 dbSNP
rs907285412 919 dbSNP
rs539959043 920 dbSNP
rs1321707077 923 dbSNP
rs1032051304 935 dbSNP
rs1370680801 937 dbSNP
rs577269162 946 dbSNP
rs948710222 960 dbSNP
rs768690772 961 dbSNP
rs866379940 962 dbSNP
rs1311978055 965 dbSNP
rs1223227540 972 dbSNP
rs1054405958 974 dbSNP
rs1466384137 976 dbSNP
rs1018510979 982 dbSNP
rs1225720808 991 dbSNP
rs1008874152 993 dbSNP
rs76738325 995 dbSNP
rs1248484618 996 dbSNP
rs1467856405 1000 dbSNP
rs775143022 1004 dbSNP
rs769562425 1011 dbSNP
rs975932571 1017 dbSNP
rs201107291 1031 dbSNP
rs966311531 1031 dbSNP
rs560557126 1032 dbSNP
rs898574872 1037 dbSNP
rs538049691 1044 dbSNP
rs1038360957 1045 dbSNP
rs1385398122 1047 dbSNP
rs76212222 1050 dbSNP
rs1332142600 1056 dbSNP
rs1374817978 1057 dbSNP
rs1441593787 1058 dbSNP
rs927260790 1061 dbSNP
rs114812713 1074 dbSNP
rs993580297 1078 dbSNP
rs949292259 1080 dbSNP
rs917758458 1083 dbSNP
rs961644386 1085 dbSNP
rs777920425 1094 dbSNP
rs772309559 1096 dbSNP
rs1249074866 1097 dbSNP
rs920120961 1100 dbSNP
rs1357071646 1108 dbSNP
rs1173871442 1112 dbSNP
rs1416630078 1116 dbSNP
rs974182146 1122 dbSNP
rs1178378950 1128 dbSNP
rs1470092864 1130 dbSNP
rs1003027685 1131 dbSNP
rs956477881 1133 dbSNP
rs907412303 1134 dbSNP
rs201965005 1153 dbSNP
rs1409964920 1155 dbSNP
rs1044557901 1164 dbSNP
rs568993390 1176 dbSNP
rs1442975482 1182 dbSNP
rs1338871360 1183 dbSNP
rs1156796586 1188 dbSNP
rs1267032264 1193 dbSNP
rs1417415584 1199 dbSNP
rs535742090 1200 dbSNP
rs1054348630 1206 dbSNP
rs1356787458 1206 dbSNP
rs893223367 1206 dbSNP
rs979117046 1208 dbSNP
rs1205206535 1209 dbSNP
rs924546362 1210 dbSNP
rs1040718061 1215 dbSNP
rs963767232 1216 dbSNP
rs1206015404 1222 dbSNP
rs1475256914 1226 dbSNP
rs1018330349 1234 dbSNP
rs1430507044 1245 dbSNP
rs1008490504 1246 dbSNP
rs542401077 1254 dbSNP
rs771788885 1265 dbSNP
rs1398080254 1270 dbSNP
rs779024766 1278 dbSNP
rs1340862749 1279 dbSNP
rs1227314363 1284 dbSNP
rs796570473 1294 dbSNP
rs1318207096 1302 dbSNP
rs1229027631 1305 dbSNP
rs951743015 1305 dbSNP
rs1025800051 1306 dbSNP
rs1481981486 1307 dbSNP
rs1201836130 1320 dbSNP
rs1307176064 1325 dbSNP
rs79749757 1326 dbSNP
rs540773567 1330 dbSNP
rs1338246022 1335 dbSNP
rs1453130007 1338 dbSNP
rs879035135 1339 dbSNP
rs73427205 1341 dbSNP
rs1450676745 1342 dbSNP
rs1038433248 1353 dbSNP
rs1173552883 1353 dbSNP
rs1376056266 1354 dbSNP
rs1467600875 1356 dbSNP
rs75305639 1358 dbSNP
rs1384480189 1365 dbSNP
rs1455342861 1372 dbSNP
rs905870770 1379 dbSNP
rs1364298041 1381 dbSNP
rs754308912 1394 dbSNP
rs1367053886 1395 dbSNP
rs949369221 1407 dbSNP
rs1300433909 1418 dbSNP
rs917832210 1419 dbSNP
rs373110893 1420 dbSNP
rs1052295786 1421 dbSNP
rs1423286938 1422 dbSNP
rs1234729363 1423 dbSNP
rs1256246321 1424 dbSNP
rs780439275 1425 dbSNP
rs1185604113 1428 dbSNP
rs9394761 1434 dbSNP
rs979219401 1436 dbSNP
rs551648827 1448 dbSNP
rs767249521 1459 dbSNP
rs1435015605 1464 dbSNP
rs1176821065 1472 dbSNP
rs1363282826 1476 dbSNP
rs1455880919 1494 dbSNP
rs910894787 1499 dbSNP
rs756848505 1500 dbSNP
rs986870952 1502 dbSNP
rs1292897877 1515 dbSNP
rs1487173094 1516 dbSNP
rs1388420947 1517 dbSNP
rs531510632 1523 dbSNP
rs1301407037 1536 dbSNP
rs1349327339 1562 dbSNP
rs955647548 1563 dbSNP
rs1025831026 1565 dbSNP
rs1261790572 1582 dbSNP
rs1033548319 1584 dbSNP
rs1330253512 1588 dbSNP
rs1221249558 1591 dbSNP
rs748861107 1591 dbSNP
rs1264228366 1593 dbSNP
rs1489783494 1595 dbSNP
rs369006307 1601 dbSNP
rs562672961 1612 dbSNP
rs761605685 1615 dbSNP
rs903211809 1616 dbSNP
rs1364004452 1621 dbSNP
rs1412922191 1627 dbSNP
rs1040388397 1631 dbSNP
rs944596668 1632 dbSNP
rs1017022511 1633 dbSNP
rs1347869881 1654 dbSNP
rs1001629030 1661 dbSNP
rs1293248930 1662 dbSNP
rs1383683929 1674 dbSNP
rs1459437944 1675 dbSNP
rs905940691 1680 dbSNP
rs1349354794 1682 dbSNP
rs1045765998 1685 dbSNP
rs140057869 1686 dbSNP
rs1350677898 1687 dbSNP
rs1227363181 1695 dbSNP
rs930503586 1703 dbSNP
rs896429346 1704 dbSNP
rs972254972 1706 dbSNP
rs940467548 1707 dbSNP
rs146583416 1715 dbSNP
rs1389772105 1727 dbSNP
rs935208769 1737 dbSNP
rs567706527 1742 dbSNP
rs1472613558 1749 dbSNP
rs925117846 1752 dbSNP
rs1180330501 1757 dbSNP
rs1411423948 1759 dbSNP
rs1425270583 1760 dbSNP
rs1165407051 1767 dbSNP
rs559718352 1769 dbSNP
rs927597496 1770 dbSNP
rs1369834836 1777 dbSNP
rs796527168 1789 dbSNP
rs971586430 1797 dbSNP
rs1023205299 1800 dbSNP
rs1446924879 1802 dbSNP
rs1300700178 1805 dbSNP
rs991613444 1810 dbSNP
rs1297540668 1820 dbSNP
rs957556102 1822 dbSNP
rs1043912958 1828 dbSNP
rs1263071102 1832 dbSNP
rs1033084269 1836 dbSNP
rs1208294581 1840 dbSNP
rs942506109 1843 dbSNP
rs1019323026 1846 dbSNP
rs1008938250 1848 dbSNP
rs1389298575 1850 dbSNP
rs1489639827 1861 dbSNP
rs149971021 1864 dbSNP
rs1222566973 1866 dbSNP
rs1341081174 1872 dbSNP
rs1413351120 1892 dbSNP
rs986504003 1896 dbSNP
rs1331825893 1898 dbSNP
rs955058653 1899 dbSNP
rs1360485729 1900 dbSNP
rs918222462 1902 dbSNP
rs1050358906 1907 dbSNP
rs1249229149 1914 dbSNP
rs1363458668 1919 dbSNP
rs972966109 1921 dbSNP
rs962892996 1923 dbSNP
rs139258255 1927 dbSNP
rs1402956638 1931 dbSNP
rs1002101206 1933 dbSNP
rs927745340 1936 dbSNP
rs982175867 1937 dbSNP
rs1247260447 1938 dbSNP
rs563819528 1952 dbSNP
rs1242566746 1959 dbSNP
rs1477420956 1971 dbSNP
rs544440679 1976 dbSNP
rs957631391 1988 dbSNP
rs547397410 1989 dbSNP
rs891816586 1992 dbSNP
rs1463862996 1999 dbSNP
rs1373926286 2004 dbSNP
rs1031644996 2005 dbSNP
rs1479775251 2013 dbSNP
rs999447598 2032 dbSNP
rs1271654470 2039 dbSNP
rs1199564301 2050 dbSNP
rs977620324 2052 dbSNP
rs967831504 2053 dbSNP
rs903771956 2054 dbSNP
rs1326823582 2055 dbSNP
rs1210307993 2077 dbSNP
rs1197112179 2082 dbSNP
rs1043603457 2096 dbSNP
rs745675105 2097 dbSNP
rs942508144 2108 dbSNP
rs374874712 2117 dbSNP
rs200166431 2120 dbSNP
rs77302419 2124 dbSNP
rs1008884607 2125 dbSNP
rs79520973 2125 dbSNP
rs879854295 2125 dbSNP
rs1029013527 2128 dbSNP
rs1325629669 2130 dbSNP
rs564914253 2131 dbSNP
rs1390431343 2143 dbSNP
rs1283798490 2145 dbSNP
rs1405665312 2149 dbSNP
rs994735761 2154 dbSNP
rs899085973 2158 dbSNP
rs150835379 2159 dbSNP
rs1327121125 2164 dbSNP
rs1393418475 2167 dbSNP
rs1441907600 2171 dbSNP
rs933706235 2172 dbSNP
rs1229209965 2175 dbSNP
rs1279990886 2187 dbSNP
rs1004751617 2196 dbSNP
rs1397480459 2204 dbSNP
rs573418600 2219 dbSNP
rs1468544918 2221 dbSNP
rs1432111000 2225 dbSNP
rs1490378682 2227 dbSNP
rs1203755802 2229 dbSNP
rs972368508 2235 dbSNP
rs1473394378 2238 dbSNP
rs190636214 2240 dbSNP
rs910110697 2244 dbSNP
rs1177732469 2249 dbSNP
rs1046153179 2254 dbSNP
rs539838893 2259 dbSNP
rs1469184653 2260 dbSNP
rs1230615196 2261 dbSNP
rs762373601 2262 dbSNP
rs916218623 2263 dbSNP
rs1392241185 2266 dbSNP
rs970649978 2268 dbSNP
rs1339655581 2269 dbSNP
rs75415238 2275 dbSNP
rs1317101744 2277 dbSNP
rs76963661 2300 dbSNP
rs769637038 2301 dbSNP
rs1201583222 2303 dbSNP
rs956071119 2307 dbSNP
rs147295276 2310 dbSNP
rs967596921 2322 dbSNP
rs759332390 2323 dbSNP
rs1254967369 2325 dbSNP
rs1441081200 2331 dbSNP
rs1031718584 2334 dbSNP
rs1244093796 2337 dbSNP
rs1449459514 2337 dbSNP
rs1000191526 2346 dbSNP
rs1392114970 2352 dbSNP
rs953463918 2356 dbSNP
rs1028962082 2360 dbSNP
rs1348441575 2361 dbSNP
rs1397985984 2370 dbSNP
rs994849474 2376 dbSNP
rs1277926190 2392 dbSNP
rs1241237081 2397 dbSNP
rs1336628844 2398 dbSNP
rs1336267067 2399 dbSNP
rs1295239854 2403 dbSNP
rs1450953230 2403 dbSNP
rs903790316 2404 dbSNP
rs1408671631 2405 dbSNP
rs1227471589 2408 dbSNP
rs1255076089 2408 dbSNP
rs1337975013 2408 dbSNP
rs569053982 2411 dbSNP
rs548855542 2412 dbSNP
rs1006778381 2419 dbSNP
rs1014880500 2422 dbSNP
rs114837730 2423 dbSNP
rs1491261633 2424 dbSNP
rs1374332779 2425 dbSNP
rs1467835431 2425 dbSNP
rs1491562057 2425 dbSNP
rs879118790 2425 dbSNP
rs879366104 2427 dbSNP
rs906393162 2427 dbSNP
rs1384263494 2431 dbSNP
rs1011927167 2440 dbSNP
rs894901015 2442 dbSNP
rs1382691313 2447 dbSNP
rs1300072474 2448 dbSNP
rs186223556 2454 dbSNP
rs933779962 2459 dbSNP
rs896901241 2461 dbSNP
rs1328938020 2464 dbSNP
rs1207157806 2467 dbSNP
rs1262839414 2475 dbSNP
rs1486504321 2478 dbSNP
rs753163991 2479 dbSNP
rs1207875929 2483 dbSNP
rs748438295 2487 dbSNP
rs1200421243 2489 dbSNP
rs941012237 2491 dbSNP
rs779116524 2493 dbSNP
rs909526520 2498 dbSNP
rs1286235688 2501 dbSNP
rs144010508 2508 dbSNP
rs768724421 2511 dbSNP
rs1346740611 2518 dbSNP
rs948966178 2522 dbSNP
rs543494941 2523 dbSNP
rs532752880 2526 dbSNP
rs1406199263 2532 dbSNP
rs1283548910 2539 dbSNP
rs530230698 2542 dbSNP
rs749349504 2543 dbSNP
rs532022334 2546 dbSNP
rs973396915 2552 dbSNP
rs768025610 2558 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545215. RNA binding protein: AGO4. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ucgaaggacgaGGGAC-GAGAugu 5'
                     ||||| ||||   
Target 5' --auagcgagaCCCUGUCUCU--- 3'
 		1 - 19
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 221443.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ucgaaggacgaGGGAC-GAGAUGu 5'
                     ||||| |||||| 
Target 5' acauagcgagaCCCUGUCUCUAC- 3'
 		3 - 25
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 221443.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 221443.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM545215
Method / RBP PAR-CLIP / AGO4
Cell line / Condition HEK293 / Control
Location of target site ENST00000373154.2 | 3UTR | AUAGCGAGACCCUGUCUCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000373154.2 | 3UTR | UAACAUAGCGAGACCCUGUCUCUAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000373154.2 | 3UTR | UUAACAUAGCGAGACCCUGUCUCUACAAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000373154.2 | 3UTR | CAUAGCGAGACCCUGUCUCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
65 hsa-miR-4732-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT076214 ALKBH5 alkB homolog 5, RNA demethylase 2 2
MIRT443015 C21orf91 chromosome 21 open reading frame 91 2 2
MIRT450317 ZNF562 zinc finger protein 562 2 2
MIRT450522 ZNF236 zinc finger protein 236 2 2
MIRT453952 ENTHD1 ENTH domain containing 1 2 2
MIRT463438 ZC3HAV1L zinc finger CCCH-type containing, antiviral 1 like 2 2
MIRT463971 WHSC1 nuclear receptor binding SET domain protein 2 2 4
MIRT465545 TOB2 transducer of ERBB2, 2 2 2
MIRT473817 MAP2K7 mitogen-activated protein kinase kinase 7 2 2
MIRT476716 FRK fyn related Src family tyrosine kinase 2 4
MIRT477373 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 2 2
MIRT477756 EDEM3 ER degradation enhancing alpha-mannosidase like protein 3 2 2
MIRT479642 CD4 CD4 molecule 2 2
MIRT483891 IL20RB interleukin 20 receptor subunit beta 2 6
MIRT485654 DAZAP2 DAZ associated protein 2 2 10
MIRT493568 HSP90AA1 heat shock protein 90 alpha family class A member 1 2 8
MIRT499708 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 2 10
MIRT499933 MFSD8 major facilitator superfamily domain containing 8 2 2
MIRT509169 EFHC1 EF-hand domain containing 1 2 4
MIRT510594 TUBB2A tubulin beta 2A class IIa 2 2
MIRT510832 RTN4RL1 reticulon 4 receptor like 1 2 6
MIRT512419 LAYN layilin 2 4
MIRT516109 OARD1 O-acyl-ADP-ribose deacylase 1 2 8
MIRT517204 OTUD6A OTU deubiquitinase 6A 2 2
MIRT519106 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 2 2
MIRT519283 SPCS1 signal peptidase complex subunit 1 2 2
MIRT519823 ZKSCAN4 zinc finger with KRAB and SCAN domains 4 2 2
MIRT521976 PFN2 profilin 2 2 4
MIRT526729 ZNF138 zinc finger protein 138 2 2
MIRT528765 CD1D CD1d molecule 2 2
MIRT531567 ILDR1 immunoglobulin like domain containing receptor 1 2 2
MIRT532173 SEC14L5 SEC14 like lipid binding 5 2 4
MIRT534865 QSER1 glutamine and serine rich 1 2 2
MIRT539948 SLC30A5 solute carrier family 30 member 5 2 2
MIRT543594 KIAA1549 KIAA1549 2 2
MIRT543964 RNF20 ring finger protein 20 2 2
MIRT544747 C8orf33 chromosome 8 open reading frame 33 2 2
MIRT544871 EHD3 EH domain containing 3 2 2
MIRT550459 OSCAR osteoclast associated, immunoglobulin-like receptor 2 2
MIRT551950 RNF157 ring finger protein 157 2 2
MIRT552504 ZIK1 zinc finger protein interacting with K protein 1 2 4
MIRT554074 SNX4 sorting nexin 4 2 4
MIRT555952 NUBP1 nucleotide binding protein 1 2 2
MIRT561097 VAMP8 vesicle associated membrane protein 8 2 2
MIRT561827 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 2
MIRT563962 ZNF431 zinc finger protein 431 2 2
MIRT566851 LRRC58 leucine rich repeat containing 58 2 2
MIRT608133 TGFBR2 transforming growth factor beta receptor 2 2 2
MIRT615716 ZNF383 zinc finger protein 383 2 2
MIRT615959 ERBB3 erb-b2 receptor tyrosine kinase 3 2 4
MIRT620031 ST6GALNAC3 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 3 2 2
MIRT621102 IL36B interleukin 36, beta 2 2
MIRT627383 TNNC1 troponin C1, slow skeletal and cardiac type 2 2
MIRT628263 DOK6 docking protein 6 2 2
MIRT635011 PDHB pyruvate dehydrogenase E1 beta subunit 2 2
MIRT636129 YIPF4 Yip1 domain family member 4 2 2
MIRT646812 COX19 COX19, cytochrome c oxidase assembly factor 2 2
MIRT652099 TRUB2 TruB pseudouridine synthase family member 2 2 2
MIRT662038 KSR2 kinase suppressor of ras 2 2 2
MIRT691530 ZNF208 zinc finger protein 208 2 2
MIRT698030 TRPV2 transient receptor potential cation channel subfamily V member 2 2 2
MIRT706642 NCBP2 nuclear cap binding protein subunit 2 2 2
MIRT707919 PRIMA1 proline rich membrane anchor 1 2 2
MIRT714664 CHRNE cholinergic receptor nicotinic epsilon subunit 2 2
MIRT721201 ZNF724P zinc finger protein 724 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4732-5p S-1 NULL 9949648 Microarray gastric cancer cells 24317477 2014 up-regulated
miR-4732-5p 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4732 Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-mir-4732 Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-mir-4732 Topotecan 60699 NSC609699 approved resistant cell line (W1)
hsa-mir-4732 Tamoxifen 2733525 NSC180973 approved resistant cell line (MCF7)
hsa-miR-4732-5p Doxorubicin 31703 NSC123127 approved resistant High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-4732-5p Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-4732-5p Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-4732-5p Palbociclib 5330286 NSC758247 approved resistant High Breast Cancer cell line (T47D)
hsa-miR-4732-5p Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-4732-5p Doxorubicin 31703 NSC123127 approved sensitive cell line (BAS)
hsa-miR-4732-5p Tamoxifen+Fulvestrant sensitive cell line (LCC9)
hsa-miR-4732-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-4732-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-4732-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-4732-5p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR3)
hsa-miR-4732-5p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR1)
hsa-miR-4732-5p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)

Error report submission