pre-miRNA Information
pre-miRNA hsa-mir-1303   
Genomic Coordinates chr5: 154685776 - 154685861
Synonyms MIRN1303, hsa-mir-1303, MIR1303
Description Homo sapiens miR-1303 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-1303
Sequence 52| UUUAGAGACGGGGUCUUGCUCU |73
Evidence Experimental
Experiments Illumina
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 5 + 154685830 23291724, 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs370437195 6 dbSNP
rs1195001383 7 dbSNP
rs546614687 8 dbSNP
rs762579883 9 dbSNP
rs766041486 10 dbSNP
rs751079975 12 dbSNP
rs888516744 13 dbSNP
rs566454487 14 dbSNP
rs766973220 15 dbSNP
rs1474274822 17 dbSNP
rs753222192 18 dbSNP
rs1230907999 19 dbSNP
rs756552638 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol NTMT1   
Synonyms AD-003, C9orf32, HOMT1A, METTL11A, NRMT, NRMT1, NTM1A
Description N-terminal Xaa-Pro-Lys N-methyltransferase 1
Transcript NM_014064   
Expression
Putative miRNA Targets on NTMT1
3'UTR of NTMT1
(miRNA target sites are highlighted)
>NTMT1|NM_014064|3'UTR
   1 GCCGGGGCTGGCAGGAGAAACTGAGGAACCACAGTCCTGGTGGGGGGAGCTGGCAGCTGGGCAAGATCCAGGCGCCACGC
  81 TGGCGGTTCGTGAGTGTCGAGGCACCACTAAATATAGCTGTCTGCCGTCCACTCATTATGCGGGCTCTTCTTCAAAAGGC
 161 AAGGTGGGACCCGGCGGGGAGGGTGCTGCTGAACCAGCGGTGAGGCAGGAGCCCAGACCCTGCTCTCCTGCGAGATGGGA
 241 TTGGGTGGAAGGGGCTCCAGGGCTCCTGGTGCTCCCCATGTGGGAATAGGGTGGCCACATCAGTAACCGATTCCCTGGGC
 321 CTCCAGCCCGGCCTTCCAGCCATGGGCCTGGCTGCCTGAAGAGGAAGGAAACCACCCCCAACTTGGTTGCTGGGGACTTG
 401 AAGACTTCAGTGTGATCTTTACCTAGGGGAGGGACAGAGCTGGGCTGGTGGAGCCCATGGGTGCTGCCTGATGGTGCTGT
 481 GGGGTGGGTGCTCATGTGCCAAGTCCTGCTTGGCAGTGGAGACCTGGGGCCCTTAAAGTGTTACAACAGCCTGCAGCAAG
 561 GGAAGTTCCCCGTAGCCTCAGTCTTCTCTGGGCTTGAGGCTGCTCCTTGGCAGGCATTTAAAGTAAAAAATAAAATGGGG
 641 CTGGGCGCGGTGGCTCACGCCTGTAAT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' ucucgUUCUGGGG-----C-AGAGAUuu 5'
               |||||::|     | |||:||  
Target 5' acttgAAGACTTCAGTGTGATCTTTAcc 3'
396 - 423 117.00 -8.90
2
miRNA  3' ucucguUCUGGG---GCAGAGAUUu 5'
                || |:|   | |||||:: 
Target 5' ccccgtAGCCTCAGTCTTCTCTGGg 3'
568 - 592 116.00 -15.40
3
miRNA  3' ucUC-GUUCUGGGGC-AGAGauuu 5'
            || | ||||||:| ||||    
Target 5' ggAGCCCAGACCCTGCTCTCctgc 3'
208 - 231 112.00 -21.96
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30177617 5 COSMIC
COSN30191708 8 COSMIC
COSN30582166 18 COSMIC
COSN31579965 23 COSMIC
COSN26552679 43 COSMIC
COSN26987119 48 COSMIC
COSN30492831 48 COSMIC
COSN30535493 76 COSMIC
COSN14375453 86 COSMIC
COSN26987118 87 COSMIC
COSN30529925 102 COSMIC
COSN19564835 114 COSMIC
COSN31611025 125 COSMIC
COSN30670780 142 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1265496702 1 dbSNP
rs769513261 2 dbSNP
rs762457236 3 dbSNP
rs55943174 4 dbSNP
rs369469508 5 dbSNP
rs761847792 6 dbSNP
rs767314125 7 dbSNP
rs541925695 19 dbSNP
rs755807015 20 dbSNP
rs769251299 25 dbSNP
rs766628583 27 dbSNP
rs1391223609 31 dbSNP
rs1435218431 33 dbSNP
rs1307575853 34 dbSNP
rs935517544 36 dbSNP
rs372578515 37 dbSNP
rs1241168790 38 dbSNP
rs1279800812 39 dbSNP
rs755236847 40 dbSNP
rs1252425430 41 dbSNP
rs1228943074 42 dbSNP
rs775408144 42 dbSNP
rs779185577 43 dbSNP
rs748210162 44 dbSNP
rs758976003 45 dbSNP
rs1239787007 47 dbSNP
rs1440004005 48 dbSNP
rs1328964614 57 dbSNP
rs939123509 66 dbSNP
rs1397099232 69 dbSNP
rs1169621485 70 dbSNP
rs78602607 74 dbSNP
rs1039720016 75 dbSNP
rs1423258396 79 dbSNP
rs901194971 80 dbSNP
rs1454826417 81 dbSNP
rs1402832566 83 dbSNP
rs997440678 85 dbSNP
rs1052149975 86 dbSNP
rs541975307 90 dbSNP
rs183816323 91 dbSNP
rs1481980716 100 dbSNP
rs1015945357 102 dbSNP
rs1044030645 103 dbSNP
rs963112557 114 dbSNP
rs1012436994 115 dbSNP
rs1349540502 121 dbSNP
rs867993043 127 dbSNP
rs1239124370 132 dbSNP
rs1436486837 135 dbSNP
rs970837220 136 dbSNP
rs982375852 142 dbSNP
rs891169556 143 dbSNP
rs1008277255 146 dbSNP
rs1312314091 160 dbSNP
rs187872989 161 dbSNP
rs924197677 173 dbSNP
rs1397090994 174 dbSNP
rs1273890923 176 dbSNP
rs35274982 176 dbSNP
rs550458768 177 dbSNP
rs1184441954 180 dbSNP
rs1422513585 182 dbSNP
rs956819227 187 dbSNP
rs1210952061 189 dbSNP
rs1486389615 192 dbSNP
rs762917352 199 dbSNP
rs1204242869 200 dbSNP
rs373184580 205 dbSNP
rs532750590 210 dbSNP
rs546602332 212 dbSNP
rs996043241 217 dbSNP
rs1028026423 231 dbSNP
rs951999561 232 dbSNP
rs1040233761 233 dbSNP
rs983655806 235 dbSNP
rs1385948684 238 dbSNP
rs1160616226 246 dbSNP
rs1456757679 251 dbSNP
rs1417737064 252 dbSNP
rs566366093 254 dbSNP
rs1014774460 260 dbSNP
rs535496886 267 dbSNP
rs758733240 269 dbSNP
rs778008792 281 dbSNP
rs886378409 285 dbSNP
rs745498374 286 dbSNP
rs774392110 291 dbSNP
rs555178296 292 dbSNP
rs1273731713 296 dbSNP
rs1037485577 298 dbSNP
rs979678046 309 dbSNP
rs145444758 310 dbSNP
rs1327194747 314 dbSNP
rs1320579578 321 dbSNP
rs1011994369 324 dbSNP
rs935602332 325 dbSNP
rs1328828065 327 dbSNP
rs1023837498 328 dbSNP
rs2270402 330 dbSNP
rs557674962 331 dbSNP
rs1031234693 333 dbSNP
rs1349656145 339 dbSNP
rs1226284813 343 dbSNP
rs774962206 344 dbSNP
rs995430414 347 dbSNP
rs1467855722 349 dbSNP
rs1253329800 353 dbSNP
rs1215337773 373 dbSNP
rs989758130 377 dbSNP
rs1315941971 378 dbSNP
rs1026995469 387 dbSNP
rs753630070 391 dbSNP
rs1004821839 393 dbSNP
rs1340229415 395 dbSNP
rs1272133130 397 dbSNP
rs746909615 398 dbSNP
rs1015152359 406 dbSNP
rs1370540957 410 dbSNP
rs1183248448 423 dbSNP
rs964595152 434 dbSNP
rs960557897 436 dbSNP
rs975490258 443 dbSNP
rs991899614 449 dbSNP
rs1328817755 451 dbSNP
rs922682957 454 dbSNP
rs933985227 458 dbSNP
rs1011880874 460 dbSNP
rs1471820583 477 dbSNP
rs139412944 478 dbSNP
rs908580697 485 dbSNP
rs1453348997 493 dbSNP
rs940591822 496 dbSNP
rs1419245265 503 dbSNP
rs1472787895 504 dbSNP
rs1456312762 512 dbSNP
rs1205207360 513 dbSNP
rs979471299 519 dbSNP
rs1232225711 535 dbSNP
rs1347369308 536 dbSNP
rs1161967472 540 dbSNP
rs1236919652 543 dbSNP
rs924983133 545 dbSNP
rs1356790318 547 dbSNP
rs1037620263 548 dbSNP
rs1310499196 554 dbSNP
rs527281940 555 dbSNP
rs947885127 556 dbSNP
rs1175169380 560 dbSNP
rs758881383 561 dbSNP
rs1406903213 570 dbSNP
rs759529651 572 dbSNP
rs546203629 573 dbSNP
rs1235688904 577 dbSNP
rs1294949030 586 dbSNP
rs1340819168 590 dbSNP
rs1030658369 595 dbSNP
rs892176069 599 dbSNP
rs1011156313 607 dbSNP
rs1306650108 612 dbSNP
rs553300288 617 dbSNP
rs573166243 621 dbSNP
rs1341562371 625 dbSNP
rs976007332 632 dbSNP
rs1205887889 637 dbSNP
rs1029720431 644 dbSNP
rs1482172890 647 dbSNP
rs955631716 648 dbSNP
rs1314191339 649 dbSNP
rs931411215 655 dbSNP
rs796948906 657 dbSNP
rs1451093808 658 dbSNP
rs542263406 659 dbSNP
rs1048851279 668 dbSNP
rs1213245408 671 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 28989.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084079. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep2_AbnovaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' ucUCGUUCUGGGGCAGAGAUuu 5'
            :|::| ||||||||||||  
Target 5' caGGUGAAACCCCGUCUCUAcu 3'
2 - 23
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084079
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep2_AbnovaAb
Location of target site ENST00000372481.3 | 3UTR | ACAGGUGAAACCCCGUCUCUACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000372481.3 | 3UTR | UCUCUACUAAAAAUACAAAAAUCAGCCAGGCAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
186 hsa-miR-1303 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT035871 SOAT1 sterol O-acyltransferase 1 1 1
MIRT035872 FHOD3 formin homology 2 domain containing 3 1 1
MIRT035873 RPL7A ribosomal protein L7a 1 1
MIRT035874 NCAPD2 non-SMC condensin I complex subunit D2 1 1
MIRT035875 RPS8 ribosomal protein S8 1 1
MIRT035876 AHNAK AHNAK nucleoprotein 1 1
MIRT035877 ACTB actin beta 1 1
MIRT035878 DEF8 differentially expressed in FDCP 8 homolog 1 1
MIRT035879 MET MET proto-oncogene, receptor tyrosine kinase 1 1
MIRT035880 MED13 mediator complex subunit 13 1 1
MIRT035881 FAT3 FAT atypical cadherin 3 1 1
MIRT035882 HUWE1 HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase 1 1
MIRT035883 RPS16 ribosomal protein S16 1 1
MIRT035884 CDK6 cyclin dependent kinase 6 1 1
MIRT035885 GEMIN5 gem nuclear organelle associated protein 5 1 1
MIRT035886 PITRM1 pitrilysin metallopeptidase 1 1 1
MIRT035887 PRRC2A proline rich coiled-coil 2A 1 1
MIRT035888 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT035889 MLLT6 MLLT6, PHD finger containing 1 1
MIRT035890 EIF3I eukaryotic translation initiation factor 3 subunit I 1 1
MIRT035891 FASN fatty acid synthase 1 1
MIRT035892 LEPREL4 prolyl 3-hydroxylase family member 4 (non-enzymatic) 1 1
MIRT035893 HSCB HscB mitochondrial iron-sulfur cluster cochaperone 1 1
MIRT035894 PSME4 proteasome activator subunit 4 1 1
MIRT035895 FRS2 fibroblast growth factor receptor substrate 2 1 1
MIRT035896 ZNF264 zinc finger protein 264 1 1
MIRT035897 HYLS1 HYLS1, centriolar and ciliogenesis associated 1 1
MIRT035898 USP54 ubiquitin specific peptidase 54 1 1
MIRT035899 L1TD1 LINE1 type transposase domain containing 1 1 1
MIRT035900 OR51E2 olfactory receptor family 51 subfamily E member 2 1 1
MIRT053762 CLDN18 claudin 18 3 1
MIRT060730 RPS3 ribosomal protein S3 2 2
MIRT083986 RAB22A RAB22A, member RAS oncogene family 2 2
MIRT098550 TBPL1 TATA-box binding protein like 1 2 6
MIRT134983 TWF1 twinfilin actin binding protein 1 2 4
MIRT136956 FNDC3A fibronectin type III domain containing 3A 2 2
MIRT222065 PURB purine rich element binding protein B 2 2
MIRT239574 UBN2 ubinuclein 2 2 4
MIRT261820 BUB3 BUB3, mitotic checkpoint protein 2 2
MIRT264698 C11ORF57 chromosome 11 open reading frame 57 2 4
MIRT308476 GXYLT2 glucoside xylosyltransferase 2 2 2
MIRT377481 NDUFB5 NADH:ubiquinone oxidoreductase subunit B5 2 2
MIRT442304 NEU3 neuraminidase 3 2 2
MIRT446083 SLC30A10 solute carrier family 30 member 10 2 2
MIRT449606 PRPF4 pre-mRNA processing factor 4 2 2
MIRT453767 NUCB1 nucleobindin 1 2 10
MIRT455603 SRSF3 serine and arginine rich splicing factor 3 2 2
MIRT455913 KIF2C kinesin family member 2C 2 2
MIRT460091 ZYG11B zyg-11 family member B, cell cycle regulator 2 4
MIRT460866 UBE2S ubiquitin conjugating enzyme E2 S 2 2
MIRT461339 NUP133 nucleoporin 133 2 2
MIRT463769 YOD1 YOD1 deubiquitinase 2 2
MIRT466368 THAP1 THAP domain containing 1 2 4
MIRT467168 SPTY2D1 SPT2 chromatin protein domain containing 1 2 2
MIRT468703 SDHD succinate dehydrogenase complex subunit D 2 2
MIRT469122 RNF126 ring finger protein 126 2 2
MIRT472426 NCBP2 nuclear cap binding protein subunit 2 2 4
MIRT479420 CDKN1B cyclin dependent kinase inhibitor 1B 2 8
MIRT484260 FAM177A1 family with sequence similarity 177 member A1 2 2
MIRT485468 IL6ST interleukin 6 signal transducer 2 10
MIRT490237 H2AFZ H2A histone family member Z 2 6
MIRT491002 ATF7IP activating transcription factor 7 interacting protein 2 2
MIRT492127 SUMO2 small ubiquitin-like modifier 2 2 2
MIRT499169 RBPJL recombination signal binding protein for immunoglobulin kappa J region like 2 2
MIRT499825 PCSK9 proprotein convertase subtilisin/kexin type 9 2 8
MIRT501794 NRAS NRAS proto-oncogene, GTPase 2 2
MIRT503441 GINS4 GINS complex subunit 4 2 4
MIRT503688 MAVS mitochondrial antiviral signaling protein 2 5
MIRT506926 IGDCC4 immunoglobulin superfamily DCC subclass member 4 2 6
MIRT511430 HOXA10 homeobox A10 2 6
MIRT512415 LAYN layilin 2 4
MIRT513791 NIPAL3 NIPA like domain containing 3 2 4
MIRT516163 NTMT1 N-terminal Xaa-Pro-Lys N-methyltransferase 1 2 4
MIRT516513 PARK2 parkin RBR E3 ubiquitin protein ligase 2 2
MIRT516915 HINFP histone H4 transcription factor 2 2
MIRT517102 NDUFV3 NADH:ubiquinone oxidoreductase subunit V3 2 2
MIRT517350 NLRP9 NLR family pyrin domain containing 9 2 2
MIRT518019 ABHD15 abhydrolase domain containing 15 2 2
MIRT520945 SRSF10 serine and arginine rich splicing factor 10 2 2
MIRT525250 RNF213 ring finger protein 213 2 2
MIRT530634 PPIC peptidylprolyl isomerase C 2 4
MIRT530671 CHRNB1 cholinergic receptor nicotinic beta 1 subunit 2 4
MIRT531563 ILDR1 immunoglobulin like domain containing receptor 1 2 2
MIRT538205 CYR61 cysteine rich angiogenic inducer 61 2 2
MIRT538419 COLEC10 collectin subfamily member 10 2 2
MIRT541964 ZNF485 zinc finger protein 485 2 2
MIRT543088 KNSTRN kinetochore localized astrin/SPAG5 binding protein 2 2
MIRT543257 ZNF662 zinc finger protein 662 2 2
MIRT543589 KIAA1549 KIAA1549 2 2
MIRT543955 RNF20 ring finger protein 20 2 2
MIRT544043 C9orf64 chromosome 9 open reading frame 64 2 4
MIRT548064 GIGYF1 GRB10 interacting GYF protein 1 2 2
MIRT548240 FBXW7 F-box and WD repeat domain containing 7 2 2
MIRT548442 EIF1AX eukaryotic translation initiation factor 1A, X-linked 2 2
MIRT548623 DAZAP1 DAZ associated protein 1 2 4
MIRT548770 COLEC12 collectin subfamily member 12 2 2
MIRT549506 HDDC2 HD domain containing 2 2 4
MIRT551924 AKAP8 A-kinase anchoring protein 8 2 4
MIRT555656 PGRMC1 progesterone receptor membrane component 1 2 2
MIRT556286 MAP3K5 mitogen-activated protein kinase kinase kinase 5 2 2
MIRT557012 HOXD13 homeobox D13 2 4
MIRT563907 CLSPN claspin 2 2
MIRT565527 SON SON DNA binding protein 2 2
MIRT568000 COMMD2 COMM domain containing 2 2 2
MIRT569831 PLA2G16 phospholipase A2 group XVI 2 4
MIRT573905 PARP1 poly(ADP-ribose) polymerase 1 2 2
MIRT616589 KLHL9 kelch like family member 9 2 2
MIRT617137 ZNF556 zinc finger protein 556 2 2
MIRT617400 API5 apoptosis inhibitor 5 2 2
MIRT617455 CCS copper chaperone for superoxide dismutase 2 2
MIRT617799 ZNF793 zinc finger protein 793 2 2
MIRT618190 MACC1 MACC1, MET transcriptional regulator 2 2
MIRT618303 GNE glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase 2 2
MIRT618329 ZNF813 zinc finger protein 813 2 2
MIRT618820 PHF20 PHD finger protein 20 2 2
MIRT619153 PPDPF pancreatic progenitor cell differentiation and proliferation factor 2 2
MIRT619530 ZNF708 zinc finger protein 708 2 2
MIRT619849 KIR3DX1 killer cell immunoglobulin like receptor, three Ig domains X1 2 2
MIRT620806 SLC26A2 solute carrier family 26 member 2 2 2
MIRT621312 YIPF4 Yip1 domain family member 4 2 2
MIRT621358 GUCA1B guanylate cyclase activator 1B 2 2
MIRT621366 ART4 ADP-ribosyltransferase 4 (Dombrock blood group) 2 2
MIRT621547 ZMYM1 zinc finger MYM-type containing 1 2 2
MIRT621883 TAOK1 TAO kinase 1 2 2
MIRT622451 RNF19B ring finger protein 19B 2 2
MIRT623404 KREMEN1 kringle containing transmembrane protein 1 2 2
MIRT623587 IPO9 importin 9 2 2
MIRT623974 FAM63A MINDY lysine 48 deubiquitinase 1 2 2
MIRT624086 DPP8 dipeptidyl peptidase 8 2 2
MIRT624108 DNAH10OS dynein axonemal heavy chain 10 opposite strand 2 2
MIRT632486 RNF8 ring finger protein 8 2 2
MIRT634057 PLIN3 perilipin 3 2 2
MIRT634657 GDE1 glycerophosphodiester phosphodiesterase 1 2 2
MIRT640682 MCUR1 mitochondrial calcium uniporter regulator 1 2 2
MIRT641242 CENPN centromere protein N 2 2
MIRT642260 ZNF677 zinc finger protein 677 2 2
MIRT642954 RELA RELA proto-oncogene, NF-kB subunit 2 2
MIRT644326 IPP intracisternal A particle-promoted polypeptide 2 2
MIRT644632 ICA1L islet cell autoantigen 1 like 2 2
MIRT645721 POLR3A RNA polymerase III subunit A 2 2
MIRT647850 LYPLA1 lysophospholipase I 2 2
MIRT649281 NEK8 NIMA related kinase 8 2 2
MIRT650038 VHL von Hippel-Lindau tumor suppressor 2 2
MIRT650354 RRP36 ribosomal RNA processing 36 2 2
MIRT651144 ZNF384 zinc finger protein 384 2 2
MIRT651778 UTP6 UTP6, small subunit processome component 2 2
MIRT652576 TLCD2 TLC domain containing 2 2 2
MIRT654621 PTPRJ protein tyrosine phosphatase, receptor type J 2 2
MIRT656023 MYO5A myosin VA 2 2
MIRT656105 MSRB3 methionine sulfoxide reductase B3 2 2
MIRT657749 GMEB1 glucocorticoid modulatory element binding protein 1 2 2
MIRT657924 GATSL2 cytosolic arginine sensor for mTORC1 subunit 2 2 2
MIRT658848 DUSP19 dual specificity phosphatase 19 2 2
MIRT659100 DENND6A DENN domain containing 6A 2 2
MIRT659153 DCX doublecortin 2 2
MIRT660870 ADRBK2 G protein-coupled receptor kinase 3 2 2
MIRT661941 FAHD1 fumarylacetoacetate hydrolase domain containing 1 2 2
MIRT663577 C10orf32 BLOC-1 related complex subunit 7 2 2
MIRT664625 WDPCP WD repeat containing planar cell polarity effector 2 4
MIRT666562 RHOBTB3 Rho related BTB domain containing 3 2 2
MIRT669992 GPR156 G protein-coupled receptor 156 2 4
MIRT670445 RSBN1L round spermatid basic protein 1 like 2 2
MIRT670853 IFNAR1 interferon alpha and beta receptor subunit 1 2 4
MIRT671942 SPPL3 signal peptide peptidase like 3 2 2
MIRT674269 LMOD3 leiomodin 3 2 2
MIRT674424 MIOX myo-inositol oxygenase 2 4
MIRT674982 ATP5G1 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C1 (subunit 9) 2 2
MIRT675038 BACE2 beta-site APP-cleaving enzyme 2 2 4
MIRT675309 C2orf68 chromosome 2 open reading frame 68 2 2
MIRT675641 TTPAL alpha tocopherol transfer protein like 2 2
MIRT688688 CPS1 carbamoyl-phosphate synthase 1 2 2
MIRT689369 ZNF101 zinc finger protein 101 2 2
MIRT689605 AKAP6 A-kinase anchoring protein 6 2 2
MIRT691715 LARS leucyl-tRNA synthetase 2 2
MIRT695473 TRAT1 T-cell receptor associated transmembrane adaptor 1 2 2
MIRT695530 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 2 2
MIRT695878 CACNG8 calcium voltage-gated channel auxiliary subunit gamma 8 2 2
MIRT696586 ORMDL2 ORMDL sphingolipid biosynthesis regulator 2 2 2
MIRT703007 HEATR5A HEAT repeat containing 5A 2 2
MIRT707942 PHKA1 phosphorylase kinase regulatory subunit alpha 1 2 2
MIRT709765 GPR183 G protein-coupled receptor 183 2 2
MIRT710332 ZNF669 zinc finger protein 669 2 2
MIRT713249 ZFP30 ZFP30 zinc finger protein 2 2
MIRT716613 RBM18 RNA binding motif protein 18 2 2
MIRT733414 BAG2 BCL2 associated athanogene 2 2 0
MIRT756135 THSD7A thrombospondin type 1 domain containing 7A 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-1 Anthocyanin NULL 145858 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Caffeic acid NULL 689043 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Catechin approved 9064 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-1 Curcumin NULL 969516 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Ferulic acid NULL 445858 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Hesperidin NULL 10621 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-1 Quercetin NULL 5280343 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 up-regulated
miR-1 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 down-regulated
miR-1 Trichostatin A (TSA) NULL 444732 Quantitative real-time PCR myocardial differentiation of mouse ES cells 19521018 2009 down-regulated
miR-1 Sulfonyl-hydrazone-1 (SHZ) NULL NULL Quantitative real-time PCR Murine broblast-derived Induced pluripotent stem cells 21445862 2011 up-regulated
miR-1 Cocaine NULL 446220 Next-generation sequencing ventral striatum 21708909 2011 up-regulated
miR-1 Atorvastatin approved 60823 Quantitative real-time PCR Cardiomyocyte 23860036 2013 down-regualted
miR-1 Glucose NULL 5793 Quantitative real-time PCR endothelial cells 24394957 2014 down-regulated
miR-1 Docosahexaenoic acid NULL 445580 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-1 Palmitic acid approved 985 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-1 17beta-estradiol (E2) approved 5757 Microarray MCF-7AKT breast cancer cells 19528081 2009 down-regulated
miR-1 Essential amino acids (EAA) NULL NULL Quantitative real-time PCR skeletal muscle of young adults 19828686 2009 up-regulated
miR-1 Hydrogen peroxide (H2O2) NULL 784 Quantitative real-time PCR Human umbilical vein endothelial cells 21527937 2011 down-regulated
miR-1 Trichostatin A (TSA) NULL 444732 Microarray apoptosis-resistant breast cancer cells 21971930 2011 up-regulated
miR-1 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-1 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miR-1 Bicalutamide approved 2375 Microarray prostate 22674191 2012 up-regulated
miR-1 Arsenic trioxide approved 14888 Quantitative real-time PCR cardia 22889704 2012 up-regulated
miR-1 Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-1 Quinidine approved 441074 Quantitative real-time PCR myocardial infarction (MI) rats 19775284 2009 up-regulated
miR-1 Tanshinone IIA NULL 164676 Quantitative real-time PCR myocardial infarction (MI) rats 19775284 2009 down-regulated
miR-1 Tanshinone IIA NULL 164676 Quantitative real-time PCR post-infarction rat cardiomyocytes 21220930 2011 down-regulated
miR-1 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 down-regulated
miR-1 Dexamethasone approved 5743 Microarray adrenals and granulosa cells 24205079 2014 up-regulated
miR-1 Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 up-regulated
miR-1 Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 down-regulated
miR-1 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-1303 Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (RKO)
hsa-miR-1303 Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (HT-29)
hsa-miR-1303 Imatinib 5291 NSC743414 approved sensitive High Gastrointestinal Stromal Tumor cell line (882R-NC, 882R-OE, 882R-KD)
hsa-miR-1303 Fulvestrant 17756771 NSC719276 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-1303 Rituximab sensitive High Diffuse Large B-Cell Lymphoma cell line (DB, NU-DHL-1, NU-DUL-1, MC-116, SU-DHL-4, SU-DHL-5, FARAGE, HBL-1, OCI-Ly3, OCI-Ly7, OCI-Ly8, OCI-Ly19, RIVA, SU-DHL-8, U2932)
hsa-miR-1303 Etoposide 36462 NSC141540 approved resistant High Colorectal Cancer cell line (HCT8)
hsa-miR-1303 Doxorubicin 31703 NSC123127 approved resistant High Colorectal Cancer cell line (HCT8)
hsa-miR-1303 Vinorelbine 44424639 approved resistant High Colorectal Cancer cell line (HCT8)
hsa-miR-1303 Vincristine 5978 approved resistant High Colorectal Cancer cell line (HCT8)
hsa-miR-1303 Paclitaxel 36314 NSC125973 approved resistant High Colorectal Cancer cell line (HCT8)
hsa-mir-1303 Dabrafenib 44462760 NSC764134 approved sensitive cell line (A375)
hsa-mir-1303 Cisplatin 5460033 NSC119875 approved resistant cell line (W1)
hsa-mir-1303 Topotecan 60699 NSC609699 approved resistant cell line (W1)
hsa-mir-1303 Androstenedione+Letrozole resistant cell line (MCF-7)
hsa-miR-1303 Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-1303 Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-1303 Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-1303 Vemurafenib 42611257 NSC761431 approved resistant cell line (451Lu)
hsa-miR-1303 Palbociclib 5330286 NSC758247 approved resistant tissue (breast cancer)
hsa-miR-1303 Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-1303 Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-1303 Paclitaxel 36314 NSC125973 approved resistant cell line (BAS)
hsa-miR-1303 Doxorubicin 31703 NSC123127 approved resistant cell line (HS578T)
hsa-miR-1303 Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-miR-1303 Cisplatin 5460033 NSC119875 approved sensitive cell line (MGC-803)
hsa-miR-1303 Oxaliplatin 6857599 NSC266046 approved sensitive cell line (IGROV-1)
hsa-miR-1303 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)

Error report submission