miRTarBase - #MIRT516313


—
pre-miRNA Information
pre-miRNA hsa-mir-5189   
Genomic Coordinates chr16: 88468918 - 88469031
Description Homo sapiens miR-5189 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-5189-5p
Sequence 26| UCUGGGCACAGGCGGAUGGACAGG |49
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1253186568 1 dbSNP
rs1157467955 6 dbSNP
rs1375543253 7 dbSNP
rs188172752 9 dbSNP
rs1214792828 10 dbSNP
rs990027849 13 dbSNP
rs913161946 14 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol F8A2
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 474383.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ggacagguAGGCGGACACGGGUCu 5'
                  |:| ::| ||||||| 
Target 5' ------acUUC-UUUUUGCCCAGg 3'
 		1 - 17
Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000369505.3 | 3UTR | ACUUCUUUUUGCCCAGGCCGGGACUUUUUGCAUCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
177 hsa-miR-5189-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT142280 DCTN5 dynactin subunit 5 2 4
MIRT455613 SRSF3 serine and arginine rich splicing factor 3 2 2
MIRT458687 MRI1 methylthioribose-1-phosphate isomerase 1 2 2
MIRT470847 PLXND1 plexin D1 2 2
MIRT471838 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 2
MIRT475228 IKZF3 IKAROS family zinc finger 3 2 4
MIRT480294 C7orf73 short transmembrane mitochondrial protein 1 2 4
MIRT483509 C10orf76 chromosome 10 open reading frame 76 2 2
MIRT484952 ZBTB34 zinc finger and BTB domain containing 34 2 6
MIRT489295 B4GALNT4 beta-1,4-N-acetyl-galactosaminyltransferase 4 2 4
MIRT490801 PSMD3 proteasome 26S subunit, non-ATPase 3 2 2
MIRT493375 KIAA1614 KIAA1614 2 2
MIRT496408 PARVB parvin beta 2 2
MIRT497267 GRK6 G protein-coupled receptor kinase 6 2 2
MIRT497679 SYNGR1 synaptogyrin 1 2 2
MIRT498222 TLN2 talin 2 2 2
MIRT498313 BCL11B B-cell CLL/lymphoma 11B 2 2
MIRT504049 TOMM5 translocase of outer mitochondrial membrane 5 2 2
MIRT516313 F8A2 coagulation factor VIII associated 2 2 2
MIRT516339 F8A3 coagulation factor VIII associated 3 2 2
MIRT517813 UGDH UDP-glucose 6-dehydrogenase 2 6
MIRT518743 C1orf35 chromosome 1 open reading frame 35 2 2
MIRT519295 MLH1 mutL homolog 1 2 2
MIRT520387 UBB ubiquitin B 2 4
MIRT525228 DPY19L3 dpy-19 like C-mannosyltransferase 3 2 2
MIRT533147 WNT10A Wnt family member 10A 2 2
MIRT533544 TPR translocated promoter region, nuclear basket protein 2 2
MIRT533684 TMEM86A transmembrane protein 86A 2 2
MIRT534544 RUNX1 runt related transcription factor 1 2 2
MIRT539592 SSH2 slingshot protein phosphatase 2 2 2
MIRT539676 ZBTB44 zinc finger and BTB domain containing 44 2 2
MIRT539710 EIF3H eukaryotic translation initiation factor 3 subunit H 2 2
MIRT539730 DNAH10OS dynein axonemal heavy chain 10 opposite strand 2 2
MIRT539755 CNBP CCHC-type zinc finger nucleic acid binding protein 2 2
MIRT539787 EMC1 ER membrane protein complex subunit 1 2 4
MIRT539812 GAPVD1 GTPase activating protein and VPS9 domains 1 2 2
MIRT539995 SLC24A4 solute carrier family 24 member 4 2 2
MIRT540073 SSH3 slingshot protein phosphatase 3 2 2
MIRT540092 NPY4R neuropeptide Y receptor Y4 2 2
MIRT540428 FAM83F family with sequence similarity 83 member F 2 2
MIRT540512 CXCL10 C-X-C motif chemokine ligand 10 2 2
MIRT540531 ZNF417 zinc finger protein 417 2 2
MIRT540622 F2RL2 coagulation factor II thrombin receptor like 2 2 2
MIRT540909 PON1 paraoxonase 1 2 2
MIRT540990 ZNF460 zinc finger protein 460 2 4
MIRT541513 TOR1AIP1 torsin 1A interacting protein 1 2 2
MIRT541633 PARP2 poly(ADP-ribose) polymerase 2 2 2
MIRT541665 ATP8B3 ATPase phospholipid transporting 8B3 2 2
MIRT541738 ZC3HAV1 zinc finger CCCH-type containing, antiviral 1 2 2
MIRT541813 SMU1 DNA replication regulator and spliceosomal factor 2 2
MIRT541904 VWA7 von Willebrand factor A domain containing 7 2 2
MIRT542004 XRCC2 X-ray repair cross complementing 2 2 2
MIRT542020 PEX2 peroxisomal biogenesis factor 2 2 2
MIRT542187 FUT1 fucosyltransferase 1 (H blood group) 2 6
MIRT542204 C14orf142 GON7, KEOPS complex subunit homolog 2 2
MIRT542337 LIMD1 LIM domains containing 1 2 2
MIRT542426 ZNF331 zinc finger protein 331 2 2
MIRT542459 AKR7A2 aldo-keto reductase family 7 member A2 2 2
MIRT542494 WDR13 WD repeat domain 13 2 2
MIRT542552 MRPS10 mitochondrial ribosomal protein S10 2 2
MIRT542699 RPS15A ribosomal protein S15a 2 2
MIRT542819 PDE12 phosphodiesterase 12 2 2
MIRT552108 PPP1R1A protein phosphatase 1 regulatory inhibitor subunit 1A 2 2
MIRT555606 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 2 2
MIRT564916 YTHDF1 YTH N6-methyladenosine RNA binding protein 1 2 2
MIRT568609 ACVR2A activin A receptor type 2A 2 2
MIRT608702 GMPR guanosine monophosphate reductase 2 2
MIRT610061 MYBPC1 myosin binding protein C, slow type 2 2
MIRT610794 KLK2 kallikrein related peptidase 2 2 2
MIRT617179 GOSR2 golgi SNAP receptor complex member 2 2 2
MIRT620581 WBSCR27 methyltransferase like 27 2 4
MIRT623348 MAGI3 membrane associated guanylate kinase, WW and PDZ domain containing 3 2 2
MIRT623873 FUS FUS RNA binding protein 2 2
MIRT625418 IMP4 IMP4, U3 small nucleolar ribonucleoprotein 2 2
MIRT630227 SORD sorbitol dehydrogenase 2 2
MIRT631870 BBS5 Bardet-Biedl syndrome 5 2 2
MIRT631905 VEGFC vascular endothelial growth factor C 2 2
MIRT632005 POPDC2 popeye domain containing 2 2 2
MIRT632876 GOSR1 golgi SNAP receptor complex member 1 2 2
MIRT633313 LINC00346 long intergenic non-protein coding RNA 346 2 2
MIRT633989 SLC35E2 solute carrier family 35 member E2 2 2
MIRT635248 ELOVL6 ELOVL fatty acid elongase 6 2 2
MIRT635258 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT635280 GK5 glycerol kinase 5 (putative) 2 2
MIRT635862 SLC11A2 solute carrier family 11 member 2 2 2
MIRT636624 CHAF1B chromatin assembly factor 1 subunit B 2 4
MIRT637085 SELPLG selectin P ligand 2 2
MIRT639025 AAK1 AP2 associated kinase 1 2 2
MIRT640876 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 2
MIRT641928 SLC25A16 solute carrier family 25 member 16 2 2
MIRT642173 HEBP2 heme binding protein 2 2 2
MIRT642251 PAK4 p21 (RAC1) activated kinase 4 2 2
MIRT642854 RNF135 ring finger protein 135 2 2
MIRT643240 PRSS21 protease, serine 21 2 2
MIRT643375 TRIM16L tripartite motif containing 16 like 2 2
MIRT646931 MCCC2 methylcrotonoyl-CoA carboxylase 2 2 2
MIRT647803 FRMD8 FERM domain containing 8 2 2
MIRT650517 UFM1 ubiquitin fold modifier 1 2 2
MIRT651618 WASF3 WAS protein family member 3 2 2
MIRT655588 OTUD7B OTU deubiquitinase 7B 2 2
MIRT657652 GPR75 G protein-coupled receptor 75 2 2
MIRT657835 GJD3 gap junction protein delta 3 2 2
MIRT658357 FAM65B RHO family interacting cell polarization regulator 2 2 2
MIRT661173 S1PR2 sphingosine-1-phosphate receptor 2 2 2
MIRT661332 TBC1D15 TBC1 domain family member 15 2 2
MIRT662003 ZNF445 zinc finger protein 445 2 2
MIRT662194 MEI1 meiotic double-stranded break formation protein 1 2 2
MIRT663473 POFUT2 protein O-fucosyltransferase 2 2 2
MIRT663958 ZNF554 zinc finger protein 554 2 2
MIRT665907 TBCCD1 TBCC domain containing 1 2 2
MIRT666029 STRN3 striatin 3 2 2
MIRT666496 SBNO1 strawberry notch homolog 1 2 2
MIRT667290 MYPN myopalladin 2 4
MIRT668020 HAUS3 HAUS augmin like complex subunit 3 2 2
MIRT670087 ABCF3 ATP binding cassette subfamily F member 3 2 4
MIRT670598 LLGL1 LLGL1, scribble cell polarity complex component 2 4
MIRT670689 SUGT1 SGT1 homolog, MIS12 kinetochore complex assembly cochaperone 2 2
MIRT670848 SFT2D2 SFT2 domain containing 2 2 2
MIRT670981 MED17 mediator complex subunit 17 2 2
MIRT672621 IGF2R insulin like growth factor 2 receptor 2 2
MIRT673223 KLHDC8A kelch domain containing 8A 2 2
MIRT674265 ZNF284 zinc finger protein 284 2 2
MIRT675631 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 2
MIRT675806 MED28 mediator complex subunit 28 2 2
MIRT676337 PCCB propionyl-CoA carboxylase beta subunit 2 2
MIRT681724 KCNE4 potassium voltage-gated channel subfamily E regulatory subunit 4 2 2
MIRT682844 DNAJC28 DnaJ heat shock protein family (Hsp40) member C28 2 2
MIRT682913 FAM73A mitoguardin 1 2 2
MIRT682932 ZNF292 zinc finger protein 292 2 2
MIRT682950 RPL12 ribosomal protein L12 2 2
MIRT683030 SUSD5 sushi domain containing 5 2 2
MIRT684387 MCTS1 MCTS1, re-initiation and release factor 2 2
MIRT684687 OR7D2 olfactory receptor family 7 subfamily D member 2 2 2
MIRT687202 PLXNA3 plexin A3 2 2
MIRT689145 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 2 2
MIRT689632 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 2 2
MIRT690598 C17orf105 chromosome 17 open reading frame 105 2 2
MIRT690802 FAHD1 fumarylacetoacetate hydrolase domain containing 1 2 2
MIRT690943 GLG1 golgi glycoprotein 1 2 2
MIRT691850 OSCAR osteoclast associated, immunoglobulin-like receptor 2 2
MIRT693615 CENPL centromere protein L 2 2
MIRT693757 ZNF383 zinc finger protein 383 2 2
MIRT694014 PPIL4 peptidylprolyl isomerase like 4 2 2
MIRT694594 AAR2 AAR2 splicing factor homolog 2 2
MIRT694983 PLAC8 placenta specific 8 2 2
MIRT695016 MRPS21 mitochondrial ribosomal protein S21 2 2
MIRT696414 DOCK7 dedicator of cytokinesis 7 2 2
MIRT697803 UBXN2A UBX domain protein 2A 2 2
MIRT697941 TVP23C trans-golgi network vesicle protein 23 homolog C 2 2
MIRT698775 STK4 serine/threonine kinase 4 2 2
MIRT699532 SIX4 SIX homeobox 4 2 2
MIRT701073 PARD6B par-6 family cell polarity regulator beta 2 2
MIRT702610 ITPRIPL2 inositol 1,4,5-trisphosphate receptor interacting protein like 2 2 2
MIRT702688 IRGQ immunity related GTPase Q 2 2
MIRT702931 HMX3 H6 family homeobox 3 2 2
MIRT703721 FAM127A retrotransposon Gag like 8C 2 2
MIRT704296 DDX19B DEAD-box helicase 19B 2 2
MIRT704332 DCTN6 dynactin subunit 6 2 2
MIRT706758 KIAA0907 KIAA0907 2 2
MIRT708483 OLR1 oxidized low density lipoprotein receptor 1 2 2
MIRT710773 PHF7 PHD finger protein 7 2 2
MIRT712484 FSTL3 follistatin like 3 2 2
MIRT712784 ZNF154 zinc finger protein 154 2 2
MIRT714507 SHE Src homology 2 domain containing E 2 2
MIRT714771 TERF1 telomeric repeat binding factor 1 2 2
MIRT715263 RNF125 ring finger protein 125 2 2
MIRT716447 TMPRSS11BNL TMPRSS11B N-terminal like, pseudogene 2 2
MIRT718198 PSMF1 proteasome inhibitor subunit 1 2 2
MIRT720001 SNRPD3 small nuclear ribonucleoprotein D3 polypeptide 2 2
MIRT720394 ZNF549 zinc finger protein 549 2 2
MIRT720597 TTC39C tetratricopeptide repeat domain 39C 2 2
MIRT721231 CRCP CGRP receptor component 2 2
MIRT721261 SH3D19 SH3 domain containing 19 2 2
MIRT721802 GRM1 glutamate metabotropic receptor 1 2 2
MIRT722573 C1orf95 stum, mechanosensory transduction mediator homolog 2 2
MIRT722842 C17orf102 chromosome 17 open reading frame 102 2 2
MIRT722909 COA4 cytochrome c oxidase assembly factor 4 homolog 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-5189-5p Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-5189-5p Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-5189-5p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-5189-5p Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-5189-5p Osimertinib 71496458 NSC779217 approved resistant Low Non-Small Cell Lung Cancer tissue
hsa-miR-5189-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780)
hsa-miR-5189-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (451Lu)
hsa-miR-5189-5p Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-5189-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-5189-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-5189-5p Doxorubicin 31703 NSC123127 approved resistant cell line (HS578T)
hsa-miR-5189-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-miR-5189-5p Osimertinib 71496458 NSC779217 approved resistant cell line (H1975)
hsa-miR-5189-5p Paclitaxel 36314 NSC125973 approved resistant cell line (A2780)
hsa-miR-5189-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-5189-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (MGC-803)
hsa-miR-5189-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)

Error report submission