pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4695 |
Genomic Coordinates | chr1: 18883202 - 18883275 |
Description | Homo sapiens miR-4695 stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | ||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4695-3p | |||||||||||||||||||||
Sequence | 51| UGAUCUCACCGCUGCCUCCUUC |72 | |||||||||||||||||||||
Evidence | Experimental | |||||||||||||||||||||
Experiments | Illumina | |||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | COPA | ||||||||||||||||||||
Synonyms | AILJK, HEP-COP | ||||||||||||||||||||
Description | coatomer protein complex subunit alpha | ||||||||||||||||||||
Transcript | NM_001098398 | ||||||||||||||||||||
Other Transcripts | NM_004371 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on COPA | |||||||||||||||||||||
3'UTR of COPA (miRNA target sites are highlighted) |
>COPA|NM_001098398|3'UTR 1 GGCCCCCTTTGTGTGCATGGGTCAGTCACCATATGTTCCCCCCAGAGAATGTGTCTATATCCTCCTTCTAACAGCACCTT 81 CCCCCTGCAGCTACTCTTCAGATCTGGCTCTCTGTACCCTAAAACCTAGTATCTTTTTCTCTTCTATGGAAAATCCGAAG 161 GTCTAAACTTGACTTTTTTGAGGTCTTCTCAACTTGACTACAGTTGTGCTCATAATTGTCCTTGCCTTTCCAGCTTAATT 241 ATTTTAAGGAACAAATGAAAACTCTGGGCTGGGTGGAGTGGCTCATACCTGTAATCCCAGCACTTTGGGAGGCTACGGTG 321 GGCAGATCATCTGAGGCCAGGAGTTCGAGACCTGCCTGGCCAACATGGCAACACCCCGTCTCTAATAAAAATATAAAAAT 401 TAGCCTGGCATGGTAGCATGCGCCTATAGTCCCAGCTGCTCAGGAGGCTGAGGCATGAGAATCGCTTGAACCTAGGAGGT 481 GGAGGTTGCATTCAACTGAGATCATACCACTTCATTCCAGCCTGGGTGACAGAGCAAGACTCTGTCTCAAAAAAAAAAAA 561 AAGGAAAACTCTGTGATGGACATTTGTTTAGTAAATCCCTTCAGTATTTATCCCTCCTTTCCCCACAGCAGCTTTCTTTC 641 CTGTCAACTAGAAAGGAGCAGGATGTAATAAATACATTTTGGTGTGACTAGGCCACACCAACTCTTAATCATCTCCCATT 721 TTCCTTAGACATTTAAATTTCAAGGCAGGTACCCTCTGTGTACTCAGAAATTTGAAGAAGTTATTTGGTTTTCCAAAATG 801 CACACTGCGGGTTATTGATTTGTTCTTTACAACTATTGTTCTCATATTTCTCACACTAAATAAATCTCTATGAGAGCTTC 881 TTGACTTGGCCATTTATTTCTTGGACACTCTCATGTTCTTGTTCACCCATGCAGGCACCCCACCAAAGTACATATCTTCC 961 TTCCAGTAATAATTTTTAATTACAAAATAAACATCCACTATTGGAAAAAAAAAAAAAAAGCTAGCCGGGCATGGTGGTGG 1041 GTGCCTGTAATCCCAGCTACTCTGGAGGCTGAGGCAGAGGATTGCTTGAACCCGGGAGGCGGAGGTTGCAGTAAGCTGAG 1121 ATCGCGCCACCGCACTCCAGCCTGGGCGACAGAGTGAGACTCCATCTCAAAAAAAAAGAAAGAAAAAAAGAAGCACATGT 1201 TTTTCATAGGGTATATATGAGGACCTAAACTGCTGTGAAAATGATAGAAAGCAAGTAGCTCCCTTATTCTGTTTTTGATT 1281 GCAGCCTTTTATCTTTTGCTAATTATAGCAATATTTATTGAGCACCTGCCATGTGACTGTCACTGTTCTAGATATTTTAC 1361 ATGTAATATACAGATAAAAGAATAGTACTTTATATATATTACAATGATACAATGATTACATTAACAATACAATATTTTGC 1441 TTGTCATATGCTAAGAATAATTGGGTAGAGTGACATTACTGTGCCTTCGATTAAAATAAGTACTTTTTTGCGTGTTAAAT 1521 TCATGTTTTCAATAAATAATAAATGCATATAGTTGAAAAATCAGTAAATA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Disease | 1314.0 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
CLIP-seq Support 1 for dataset GSM4903828 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | Dermal fibroblasts / PID21_9124 |
Location of target site | NM_001098398 | 3UTR | AUACCACUUCAUUCCAGCCUGG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE161237 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM4903829 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | Human neurons / CTLTD_shCTL_a |
Location of target site | NM_001098398 | 3UTR | AUCGCGCCACCGCACUCCAGCCUGG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE161238 |
CLIP-seq Viewer | Link |
CLIP-seq Support 3 for dataset GSM4903833 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | Dermal fibroblasts / CTL_TD_21_a |
Location of target site | NM_001098398 | 3UTR | GAGAUCGCGCCACCGCACUCCAGCCUGG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE161239 |
CLIP-seq Viewer | Link |
CLIP-seq Support 4 for dataset GSM4903834 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | Dermal fibroblasts / CTL_TD_21_b |
Location of target site | NM_004371 | 3UTR | AGAUCGCGCCACCGCACUCCAGCCUGG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE161239 |
CLIP-seq Viewer | Link |
CLIP-seq Support 5 for dataset GSM4903835 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | Dermal fibroblasts / CTL_TD_21_c |
Location of target site | NM_001098398 | 3UTR | AGAUCGCGCCACCGCACUCCAGCCUGG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE161239 |
CLIP-seq Viewer | Link |
CLIP-seq Support 6 for dataset GSM4903836 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | Dermal fibroblasts / 124_TD_21_a |
Location of target site | NM_001098398 | 3UTR | GAUCGCGCCACCGCACUCCAGCCUGG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE161239 |
CLIP-seq Viewer | Link |
CLIP-seq Support 7 for dataset GSM4903837 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | Dermal fibroblasts / 124_TD_21_b |
Location of target site | NM_004371 | 3UTR | UCGCGCCACCGCACUCCAGCCUGG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE161239 |
CLIP-seq Viewer | Link |
CLIP-seq Support 8 for dataset GSM4903838 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | Dermal fibroblasts / 124_TD_21_c |
Location of target site | NM_004371 | 3UTR | AGAUCGCGCCACCGCACUCCAGCCUGG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE161239 |
CLIP-seq Viewer | Link |
CLIP-seq Support 9 for dataset GSM1065667 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_6 |
Location of target site | ENST00000368069.3 | 3UTR | CGCGCCACCGCACUCCAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23446348 / GSE43573 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
133 hsa-miR-4695-3p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT271431 | ETNK1 | ethanolamine kinase 1 | 2 | 2 | ||||||||
MIRT287899 | ZNF652 | zinc finger protein 652 | 2 | 2 | ||||||||
MIRT405482 | ARID1A | AT-rich interaction domain 1A | 2 | 2 | ||||||||
MIRT441675 | CXXC4 | CXXC finger protein 4 | 2 | 2 | ||||||||
MIRT442163 | ARL10 | ADP ribosylation factor like GTPase 10 | 2 | 2 | ||||||||
MIRT442924 | TFDP2 | transcription factor Dp-2 | 2 | 2 | ||||||||
MIRT443908 | ZNF256 | zinc finger protein 256 | 2 | 2 | ||||||||
MIRT444792 | TMEM251 | transmembrane protein 251 | 2 | 2 | ||||||||
MIRT447161 | MFSD8 | major facilitator superfamily domain containing 8 | 2 | 2 | ||||||||
MIRT452992 | CABP4 | calcium binding protein 4 | 2 | 4 | ||||||||
MIRT454347 | CDKL1 | cyclin dependent kinase like 1 | 2 | 2 | ||||||||
MIRT461937 | TNFSF14 | TNF superfamily member 14 | 2 | 2 | ||||||||
MIRT462299 | PPM1H | protein phosphatase, Mg2+/Mn2+ dependent 1H | 2 | 2 | ||||||||
MIRT463127 | ZNF451 | zinc finger protein 451 | 2 | 2 | ||||||||
MIRT469460 | REL | REL proto-oncogene, NF-kB subunit | 2 | 6 | ||||||||
MIRT470528 | PPIF | peptidylprolyl isomerase F | 2 | 2 | ||||||||
MIRT473758 | MAP3K9 | mitogen-activated protein kinase kinase kinase 9 | 2 | 2 | ||||||||
MIRT482910 | ZNF845 | zinc finger protein 845 | 2 | 2 | ||||||||
MIRT497070 | GTF2H5 | general transcription factor IIH subunit 5 | 2 | 4 | ||||||||
MIRT497169 | EPGN | epithelial mitogen | 2 | 2 | ||||||||
MIRT497196 | DRP2 | dystrophin related protein 2 | 2 | 2 | ||||||||
MIRT514518 | SHISA9 | shisa family member 9 | 2 | 2 | ||||||||
MIRT516415 | COPA | coatomer protein complex subunit alpha | 2 | 2 | ||||||||
MIRT525259 | TLK2 | tousled like kinase 2 | 2 | 2 | ||||||||
MIRT525804 | SOD2 | superoxide dismutase 2 | 2 | 2 | ||||||||
MIRT533723 | TMEM246 | transmembrane protein 246 | 2 | 2 | ||||||||
MIRT540226 | SAMD5 | sterile alpha motif domain containing 5 | 2 | 2 | ||||||||
MIRT566417 | PIM3 | Pim-3 proto-oncogene, serine/threonine kinase | 2 | 2 | ||||||||
MIRT572422 | PTGES3L | prostaglandin E synthase 3 like | 2 | 2 | ||||||||
MIRT575206 | Entpd4 | ectonucleoside triphosphate diphosphohydrolase 4 | 2 | 2 | ||||||||
MIRT575327 | Fbxo6 | F-box protein 6 | 2 | 2 | ||||||||
MIRT575383 | Ang | angiogenin, ribonuclease, RNase A family, 5 | 2 | 3 | ||||||||
MIRT607069 | POM121L7 | POM121 transmembrane nucleoporin like 7 pseudogene | 2 | 2 | ||||||||
MIRT607660 | BTN3A2 | butyrophilin subfamily 3 member A2 | 2 | 2 | ||||||||
MIRT607845 | PHLDA3 | pleckstrin homology like domain family A member 3 | 2 | 4 | ||||||||
MIRT607935 | ANG | angiogenin | 2 | 3 | ||||||||
MIRT608144 | SYAP1 | synapse associated protein 1 | 2 | 4 | ||||||||
MIRT612151 | SIX1 | SIX homeobox 1 | 2 | 4 | ||||||||
MIRT615709 | MYO16 | myosin XVI | 2 | 2 | ||||||||
MIRT617556 | MTO1 | mitochondrial tRNA translation optimization 1 | 2 | 2 | ||||||||
MIRT618062 | ZNF799 | zinc finger protein 799 | 2 | 2 | ||||||||
MIRT618515 | SELPLG | selectin P ligand | 2 | 2 | ||||||||
MIRT618906 | CDK9 | cyclin dependent kinase 9 | 2 | 2 | ||||||||
MIRT621160 | RTTN | rotatin | 2 | 2 | ||||||||
MIRT624169 | DGKE | diacylglycerol kinase epsilon | 2 | 2 | ||||||||
MIRT624953 | SERF2 | small EDRK-rich factor 2 | 2 | 2 | ||||||||
MIRT625465 | ZNF135 | zinc finger protein 135 | 2 | 2 | ||||||||
MIRT627786 | RAB11FIP1 | RAB11 family interacting protein 1 | 2 | 2 | ||||||||
MIRT629274 | CD84 | CD84 molecule | 2 | 2 | ||||||||
MIRT629311 | ZNF566 | zinc finger protein 566 | 2 | 2 | ||||||||
MIRT629569 | FAM180B | family with sequence similarity 180 member B | 2 | 4 | ||||||||
MIRT629667 | USP1 | ubiquitin specific peptidase 1 | 2 | 2 | ||||||||
MIRT630486 | DHTKD1 | dehydrogenase E1 and transketolase domain containing 1 | 2 | 2 | ||||||||
MIRT631017 | DNAJC22 | DnaJ heat shock protein family (Hsp40) member C22 | 2 | 2 | ||||||||
MIRT631192 | TSPAN14 | tetraspanin 14 | 2 | 2 | ||||||||
MIRT631970 | YIPF5 | Yip1 domain family member 5 | 2 | 2 | ||||||||
MIRT632246 | VPS41 | VPS41, HOPS complex subunit | 2 | 2 | ||||||||
MIRT632890 | GINM1 | glycoprotein integral membrane 1 | 2 | 2 | ||||||||
MIRT634499 | NYAP2 | neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2 | 2 | 2 | ||||||||
MIRT635431 | LRP10 | LDL receptor related protein 10 | 2 | 2 | ||||||||
MIRT636017 | GNPNAT1 | glucosamine-phosphate N-acetyltransferase 1 | 2 | 2 | ||||||||
MIRT636343 | PHAX | phosphorylated adaptor for RNA export | 2 | 2 | ||||||||
MIRT636657 | CDK4 | cyclin dependent kinase 4 | 2 | 2 | ||||||||
MIRT637378 | HINFP | histone H4 transcription factor | 2 | 2 | ||||||||
MIRT637727 | EXO5 | exonuclease 5 | 2 | 2 | ||||||||
MIRT638580 | HYPK | huntingtin interacting protein K | 2 | 2 | ||||||||
MIRT638611 | HIF1AN | hypoxia inducible factor 1 alpha subunit inhibitor | 2 | 2 | ||||||||
MIRT640797 | HEYL | hes related family bHLH transcription factor with YRPW motif-like | 2 | 2 | ||||||||
MIRT641965 | PWWP2A | PWWP domain containing 2A | 2 | 2 | ||||||||
MIRT642621 | CDKN3 | cyclin dependent kinase inhibitor 3 | 2 | 2 | ||||||||
MIRT643125 | FAM71F2 | family with sequence similarity 71 member F2 | 2 | 2 | ||||||||
MIRT643352 | TRIM10 | tripartite motif containing 10 | 2 | 2 | ||||||||
MIRT643838 | PPP5D1 | PPP5 tetratricopeptide repeat domain containing 1 | 2 | 2 | ||||||||
MIRT645613 | TSPAN6 | tetraspanin 6 | 2 | 2 | ||||||||
MIRT647206 | NPTXR | neuronal pentraxin receptor | 2 | 2 | ||||||||
MIRT649302 | IGSF6 | immunoglobulin superfamily member 6 | 2 | 2 | ||||||||
MIRT650008 | KLB | klotho beta | 2 | 2 | ||||||||
MIRT650166 | USHBP1 | USH1 protein network component harmonin binding protein 1 | 2 | 2 | ||||||||
MIRT650441 | CPXM2 | carboxypeptidase X, M14 family member 2 | 2 | 2 | ||||||||
MIRT651906 | UEVLD | UEV and lactate/malate dehyrogenase domains | 2 | 4 | ||||||||
MIRT652158 | TRIM66 | tripartite motif containing 66 | 2 | 2 | ||||||||
MIRT654719 | PRR11 | proline rich 11 | 2 | 2 | ||||||||
MIRT654846 | PPM1K | protein phosphatase, Mg2+/Mn2+ dependent 1K | 2 | 2 | ||||||||
MIRT656063 | MTMR10 | myotubularin related protein 10 | 2 | 2 | ||||||||
MIRT657240 | IDE | insulin degrading enzyme | 2 | 2 | ||||||||
MIRT657261 | HSPA4L | heat shock protein family A (Hsp70) member 4 like | 2 | 2 | ||||||||
MIRT659504 | CIAO1 | cytosolic iron-sulfur assembly component 1 | 2 | 2 | ||||||||
MIRT660210 | BMPR1A | bone morphogenetic protein receptor type 1A | 2 | 2 | ||||||||
MIRT661075 | FFAR2 | free fatty acid receptor 2 | 2 | 2 | ||||||||
MIRT662239 | PGBD4 | piggyBac transposable element derived 4 | 2 | 2 | ||||||||
MIRT662336 | MYLK3 | myosin light chain kinase 3 | 2 | 2 | ||||||||
MIRT662449 | SEMA5A | semaphorin 5A | 2 | 2 | ||||||||
MIRT662740 | LRRC3C | leucine rich repeat containing 3C | 2 | 2 | ||||||||
MIRT663459 | FADS1 | fatty acid desaturase 1 | 2 | 2 | ||||||||
MIRT664177 | MYOZ2 | myozenin 2 | 2 | 2 | ||||||||
MIRT664906 | PDE6A | phosphodiesterase 6A | 2 | 2 | ||||||||
MIRT664924 | BHMT2 | betaine--homocysteine S-methyltransferase 2 | 2 | 2 | ||||||||
MIRT665528 | USP14 | ubiquitin specific peptidase 14 | 2 | 2 | ||||||||
MIRT665534 | UROS | uroporphyrinogen III synthase | 2 | 2 | ||||||||
MIRT666081 | SSTR2 | somatostatin receptor 2 | 2 | 2 | ||||||||
MIRT666458 | SCRG1 | stimulator of chondrogenesis 1 | 2 | 2 | ||||||||
MIRT668253 | FUT11 | fucosyltransferase 11 | 2 | 2 | ||||||||
MIRT668722 | DIP2A | disco interacting protein 2 homolog A | 2 | 2 | ||||||||
MIRT669551 | ALG14 | ALG14, UDP-N-acetylglucosaminyltransferase subunit | 2 | 2 | ||||||||
MIRT670021 | TECPR1 | tectonin beta-propeller repeat containing 1 | 2 | 2 | ||||||||
MIRT671098 | ZNF665 | zinc finger protein 665 | 2 | 2 | ||||||||
MIRT671479 | FLYWCH2 | FLYWCH family member 2 | 2 | 2 | ||||||||
MIRT671495 | SLC38A9 | solute carrier family 38 member 9 | 2 | 2 | ||||||||
MIRT672908 | KRBA2 | KRAB-A domain containing 2 | 2 | 2 | ||||||||
MIRT675102 | SNTB2 | syntrophin beta 2 | 2 | 2 | ||||||||
MIRT676194 | GSTM3 | glutathione S-transferase mu 3 | 2 | 2 | ||||||||
MIRT677349 | POC1A | POC1 centriolar protein A | 2 | 2 | ||||||||
MIRT677551 | C19orf52 | translocase of inner mitochondrial membrane 29 | 2 | 2 | ||||||||
MIRT677665 | UGGT1 | UDP-glucose glycoprotein glucosyltransferase 1 | 2 | 2 | ||||||||
MIRT677689 | SCO1 | SCO1, cytochrome c oxidase assembly protein | 2 | 2 | ||||||||
MIRT678246 | FITM2 | fat storage inducing transmembrane protein 2 | 2 | 2 | ||||||||
MIRT678300 | GPR155 | G protein-coupled receptor 155 | 2 | 2 | ||||||||
MIRT684176 | MOG | myelin oligodendrocyte glycoprotein | 2 | 2 | ||||||||
MIRT688037 | GNE | glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase | 2 | 2 | ||||||||
MIRT689034 | ANGPTL3 | angiopoietin like 3 | 2 | 2 | ||||||||
MIRT689618 | AKAP6 | A-kinase anchoring protein 6 | 2 | 2 | ||||||||
MIRT691210 | KLHL30 | kelch like family member 30 | 2 | 2 | ||||||||
MIRT692300 | CNNM3 | cyclin and CBS domain divalent metal cation transport mediator 3 | 2 | 2 | ||||||||
MIRT703556 | FKBP14 | FK506 binding protein 14 | 2 | 2 | ||||||||
MIRT709136 | GLG1 | golgi glycoprotein 1 | 2 | 2 | ||||||||
MIRT709392 | QRFPR | pyroglutamylated RFamide peptide receptor | 2 | 2 | ||||||||
MIRT711949 | SLC7A14 | solute carrier family 7 member 14 | 2 | 2 | ||||||||
MIRT712590 | ADCYAP1 | adenylate cyclase activating polypeptide 1 | 2 | 2 | ||||||||
MIRT714007 | IL6R | interleukin 6 receptor | 2 | 2 | ||||||||
MIRT714592 | CMBL | carboxymethylenebutenolidase homolog | 2 | 2 | ||||||||
MIRT716716 | SCN7A | sodium voltage-gated channel alpha subunit 7 | 2 | 2 | ||||||||
MIRT718816 | PYGO1 | pygopus family PHD finger 1 | 2 | 2 | ||||||||
MIRT719980 | MAPK1 | mitogen-activated protein kinase 1 | 2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|