miRTarBase - #MIRT516564


—
pre-miRNA Information
pre-miRNA hsa-mir-3128   
Genomic Coordinates chr2: 177255945 - 177256010
Description Homo sapiens miR-3128 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3128
Sequence 5| UCUGGCAAGUAAAAAACUCUCAU |27
Evidence Experimental
Experiments Illumina
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN31530001 21 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1235581387 2 dbSNP
rs1336086844 4 dbSNP
rs1049299498 14 dbSNP
rs1442692120 17 dbSNP
rs574224659 17 dbSNP
rs911997793 17 dbSNP
rs1235274433 19 dbSNP
rs868602383 21 dbSNP
Putative Targets

Gene Information
Gene Symbol PARP1   
Synonyms ADPRT, ADPRT 1, ADPRT1, ARTD1, PARP, PARP-1, PPOL, pADPRT-1
Description poly(ADP-ribose) polymerase 1
Transcript NM_001618   
Expression
Putative miRNA Targets on PARP1
3'UTR of PARP1
(miRNA target sites are highlighted)		 
>PARP1|NM_001618|3'UTR
   1 TTGGGAGAGGTAGCCGAGTCACACCCGGTGGCTCTGGTATGAATTCACCCGAAGCGCTTCTGCACCAACTCACCTGGCCG
  81 CTAAGTTGCTGATGGGTAGTACCTGTACTAAACCACCTCAGAAAGGATTTTACAGAAACGTGTTAAAGGTTTTCTCTAAC
 161 TTCTCAAGTCCCTTGTTTTGTGTTGTGTCTGTGGGGAGGGGTTGTTTTGGGGTTGTTTTTGTTTTTTCTTGCCAGGTAGA
 241 TAAAACTGACATAGAGAAAAGGCTGGAGAGAGATTCTGTTGCATAGACTAGTCCTATGGAAAAAACCAAGCTTCGTTAGA
 321 ATGTCTGCCTTACTGGTTTCCCCAGGGAAGGAAAAATACACTTCCACCCTTTTTTCTAAGTGTTCGTCTTTAGTTTTGAT
 401 TTTGGAAAGATGTTAAGCATTTATTTTTAGTTAAAAATAAAAACTAATTTCATACTATTTAGATTTTCTTTTTTATCTTG
 481 CACTTATTGTCCCCTTTTTAGTTTTTTTTGTTTGCCTCTTGTGGTGAGGGGTGTGGGAAGACCAAAGGAAGGAACGCTAA
 561 CAATTTCTCATACTTAGAAACAAAAAGAGCTTTCCTTCTCCAGGAATACTGAACATGGGAGCTCTTGAAATATGTAGTAT
 641 TAAAAGTTGCATTTGAAATTCTTGACTTTCTTATGGGCACTTTTGTCTTCCAAATTAAAACTCTACCACAAATATACTTA
 721 CCCAAGGGCTAATAGTAATACTCGATTAAAAATGCAGATGCCTTCTCTAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uacucuCAAAAAAUGAACGGUCu 5'
                ||||||| |||||||| 
Target 5' gtttttGTTTTTT-CTTGCCAGg 3'
 215 - 236 172.00 -17.90
2 
miRNA  3' uacUCUCAAAAAAUGAACGGucu 5'
             ||  ||||||::|||||   
Target 5' tttAGTTTTTTTTGTTTGCCtct 3'
 497 - 519 136.00 -11.92
3 
miRNA  3' uaCUCUCAAAAAAUGAACG-GUCu 5'
            ||||| || |   |||| :|| 
Target 5' gaGAGAGATTCT--GTTGCATAGa 3'
 266 - 287 113.00 -9.94
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26987933 15 COSMIC
COSN23014253 20 COSMIC
COSN30495363 25 COSMIC
COSN23014252 72 COSMIC
COSN31610660 89 COSMIC
COSN31590103 139 COSMIC
COSN20073969 140 COSMIC
COSN30538499 296 COSMIC
COSN28643765 365 COSMIC
COSN31551201 430 COSMIC
COSN30159687 468 COSMIC
COSN32065431 660 COSMIC
COSN29337570 738 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs374503866 1 dbSNP
rs763734343 2 dbSNP
rs1401959326 3 dbSNP
rs762659079 5 dbSNP
rs527512520 7 dbSNP
rs769498944 10 dbSNP
rs3219147 15 dbSNP
rs776434191 16 dbSNP
rs1414939511 22 dbSNP
rs759432325 24 dbSNP
rs1468947193 25 dbSNP
rs770815468 26 dbSNP
rs777807405 27 dbSNP
rs377335474 28 dbSNP
rs778933132 31 dbSNP
rs1064578 34 dbSNP
rs777374023 37 dbSNP
rs544978843 39 dbSNP
rs918967512 40 dbSNP
rs1337403502 44 dbSNP
rs1294332011 47 dbSNP
rs749562125 50 dbSNP
rs577915890 51 dbSNP
rs1297697076 55 dbSNP
rs910499102 56 dbSNP
rs1232350751 58 dbSNP
rs562336579 63 dbSNP
rs957288309 65 dbSNP
rs1486088790 69 dbSNP
rs72746749 79 dbSNP
rs1403804060 80 dbSNP
rs149958872 88 dbSNP
rs1187595482 89 dbSNP
rs1042258184 94 dbSNP
rs13306133 95 dbSNP
rs1173338638 105 dbSNP
rs893749449 107 dbSNP
rs1309226104 109 dbSNP
rs1024385813 115 dbSNP
rs1014457258 131 dbSNP
rs1156500850 132 dbSNP
rs1344068293 139 dbSNP
rs1419671436 139 dbSNP
rs1430898922 140 dbSNP
rs1290559284 153 dbSNP
rs1365323996 160 dbSNP
rs199849757 165 dbSNP
rs1054111300 167 dbSNP
rs943420123 171 dbSNP
rs1181004092 172 dbSNP
rs958840823 178 dbSNP
rs1034492059 183 dbSNP
rs55917000 196 dbSNP
rs1246430544 201 dbSNP
rs1316402682 205 dbSNP
rs1216502498 207 dbSNP
rs1197797264 211 dbSNP
rs1449510326 212 dbSNP
rs888670368 214 dbSNP
rs1049206916 218 dbSNP
rs1051691098 218 dbSNP
rs1222613369 221 dbSNP
rs993175696 223 dbSNP
rs897614629 232 dbSNP
rs1487761116 234 dbSNP
rs1193588834 238 dbSNP
rs534086697 250 dbSNP
rs1455891347 253 dbSNP
rs1176380134 258 dbSNP
rs573359334 259 dbSNP
rs919327008 266 dbSNP
rs1804317 271 dbSNP
rs972574791 272 dbSNP
rs972227993 273 dbSNP
rs1283801728 280 dbSNP
rs558374643 283 dbSNP
rs566187557 291 dbSNP
rs1242155151 294 dbSNP
rs139052323 296 dbSNP
rs909500259 297 dbSNP
rs1278001479 301 dbSNP
rs539731658 306 dbSNP
rs1224561655 308 dbSNP
rs1333023350 311 dbSNP
rs1286377325 314 dbSNP
rs1050242658 315 dbSNP
rs1213588859 319 dbSNP
rs1399514450 327 dbSNP
rs1470101661 340 dbSNP
rs1197072040 348 dbSNP
rs780633733 351 dbSNP
rs925856182 353 dbSNP
rs1160991188 355 dbSNP
rs187860345 359 dbSNP
rs1424991371 360 dbSNP
rs1178608700 365 dbSNP
rs1171154544 368 dbSNP
rs1410957821 369 dbSNP
rs3219148 370 dbSNP
rs756147713 372 dbSNP
rs992929051 373 dbSNP
rs80076717 377 dbSNP
rs1327879894 384 dbSNP
rs781300170 384 dbSNP
rs1443161260 386 dbSNP
rs1281540237 391 dbSNP
rs183728616 414 dbSNP
rs1218784029 417 dbSNP
rs1232820132 439 dbSNP
rs1005679750 443 dbSNP
rs1277709025 444 dbSNP
rs1337512950 445 dbSNP
rs1213349208 447 dbSNP
rs1032135181 448 dbSNP
rs1217292148 450 dbSNP
rs953116130 452 dbSNP
rs547128219 462 dbSNP
rs1206161839 468 dbSNP
rs1275670589 471 dbSNP
rs1235442000 482 dbSNP
rs1485058511 483 dbSNP
rs1187968325 485 dbSNP
rs527437232 486 dbSNP
rs1419415133 487 dbSNP
rs1476775827 489 dbSNP
rs1167300461 492 dbSNP
rs993599937 493 dbSNP
rs1411509268 495 dbSNP
rs1013432250 500 dbSNP
rs1373788008 506 dbSNP
rs1051741507 509 dbSNP
rs374654237 510 dbSNP
rs933304522 510 dbSNP
rs1300113191 514 dbSNP
rs560087931 515 dbSNP
rs1359073078 516 dbSNP
rs1332727451 518 dbSNP
rs1225836599 521 dbSNP
rs1039994480 525 dbSNP
rs1036396231 527 dbSNP
rs555478222 527 dbSNP
rs888833442 528 dbSNP
rs1216762287 533 dbSNP
rs1050691405 534 dbSNP
rs753436883 534 dbSNP
rs935848675 543 dbSNP
rs925888235 544 dbSNP
rs1041615114 547 dbSNP
rs909375118 554 dbSNP
rs537409644 555 dbSNP
rs191721576 556 dbSNP
rs1476353322 563 dbSNP
rs34588544 565 dbSNP
rs992789472 569 dbSNP
rs937417311 577 dbSNP
rs1174540759 586 dbSNP
rs1377332143 587 dbSNP
rs867034659 601 dbSNP
rs981798515 606 dbSNP
rs8679 607 dbSNP
rs186874898 615 dbSNP
rs1433521219 618 dbSNP
rs1301649830 621 dbSNP
rs1207854762 627 dbSNP
rs1020753146 629 dbSNP
rs1234537036 632 dbSNP
rs984735650 633 dbSNP
rs1347916735 634 dbSNP
rs1203967897 635 dbSNP
rs543769554 638 dbSNP
rs1284359366 642 dbSNP
rs957785656 646 dbSNP
rs1191704694 650 dbSNP
rs1032601025 651 dbSNP
rs1454587519 670 dbSNP
rs1194494209 673 dbSNP
rs1007378862 674 dbSNP
rs1451905994 678 dbSNP
rs1158011396 701 dbSNP
rs1385800116 705 dbSNP
rs1402917849 705 dbSNP
rs573309470 705 dbSNP
rs1026344557 708 dbSNP
rs1370696957 713 dbSNP
rs183554484 714 dbSNP
rs779752350 721 dbSNP
rs1316262005 729 dbSNP
rs1280231514 731 dbSNP
rs1237903756 743 dbSNP
rs3219149 744 dbSNP
rs897837388 753 dbSNP
rs1211719887 755 dbSNP
rs965575719 756 dbSNP
rs1468750069 766 dbSNP
rs1018566944 768 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' uacucucaAAAAAUGAACGGUCu 5'
                  ||||| |||||||| 
Target 5' --------UUUUUUCUUGCCAGg 3'
 		1 - 15
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 142.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000366794.5 | 3UTR | UUUUUUCUUGCCAGGUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000366794.5 | 3UTR | UUUUUUCUUGCCAGGUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000366794.5 | 3UTR | UUUUUGUUUUUUCUUGCCAGGUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
Click to see details
Click to see details
Click to see details
Click to see details
57 hsa-miR-3128 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT080091 C18ORF25 chromosome 18 open reading frame 25 2 6
MIRT109617 KLHL15 kelch like family member 15 2 6
MIRT122644 E2F3 E2F transcription factor 3 2 2
MIRT204532 SLC39A10 solute carrier family 39 member 10 2 2
MIRT221677 ZNRF2 zinc and ring finger 2 2 2
MIRT230763 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 6
MIRT273299 CCNT1 cyclin T1 2 2
MIRT283494 KCTD5 potassium channel tetramerization domain containing 5 2 4
MIRT296656 MRGBP MRG domain binding protein 2 6
MIRT301972 NUP50 nucleoporin 50 2 4
MIRT332732 QSER1 glutamine and serine rich 1 2 2
MIRT456187 ZDHHC6 zinc finger DHHC-type containing 6 2 2
MIRT460334 CAMK4 calcium/calmodulin dependent protein kinase IV 2 6
MIRT478382 DDAH1 dimethylarginine dimethylaminohydrolase 1 2 2
MIRT508130 AMD1 adenosylmethionine decarboxylase 1 2 2
MIRT511876 GOLGA7 golgin A7 2 6
MIRT512926 UBL4A ubiquitin like 4A 2 2
MIRT515891 FAM182B family with sequence similarity 182 member B 2 2
MIRT516564 PARP1 poly(ADP-ribose) polymerase 1 2 4
MIRT520203 WASL Wiskott-Aldrich syndrome like 2 2
MIRT525592 ANKRD49 ankyrin repeat domain 49 2 2
MIRT526047 GMDS GDP-mannose 4,6-dehydratase 2 2
MIRT531124 CLPB ClpB homolog, mitochondrial AAA ATPase chaperonin 2 2
MIRT533604 TNPO1 transportin 1 2 2
MIRT552632 ZBTB41 zinc finger and BTB domain containing 41 2 2
MIRT555505 PNISR PNN interacting serine and arginine rich protein 2 2
MIRT560185 SPRTN SprT-like N-terminal domain 2 2
MIRT571001 REPS1 RALBP1 associated Eps domain containing 1 2 2
MIRT572913 MTMR3 myotubularin related protein 3 2 2
MIRT615263 DPF2 double PHD fingers 2 2 2
MIRT617721 TRAPPC2 trafficking protein particle complex 2 2 4
MIRT617981 ZNF234 zinc finger protein 234 2 4
MIRT618433 MYLK3 myosin light chain kinase 3 2 4
MIRT619670 CYP1A2 cytochrome P450 family 1 subfamily A member 2 2 2
MIRT620534 AVPR1A arginine vasopressin receptor 1A 2 2
MIRT621303 YIPF4 Yip1 domain family member 4 2 2
MIRT625058 ZNF556 zinc finger protein 556 2 2
MIRT627224 ZBTB8B zinc finger and BTB domain containing 8B 2 2
MIRT641086 ZKSCAN2 zinc finger with KRAB and SCAN domains 2 2 2
MIRT645192 POLR3F RNA polymerase III subunit F 2 2
MIRT655546 PADI2 peptidyl arginine deiminase 2 2 2
MIRT663660 ZNF486 zinc finger protein 486 2 4
MIRT664038 RPL27A ribosomal protein L27a 2 2
MIRT664095 ZDHHC24 zinc finger DHHC-type containing 24 2 2
MIRT667034 PDE3A phosphodiesterase 3A 2 2
MIRT693811 SEC31A SEC31 homolog A, COPII coat complex component 2 2
MIRT694235 ZNF749 zinc finger protein 749 2 2
MIRT699244 SLC6A8 solute carrier family 6 member 8 2 2
MIRT702577 JARID2 jumonji and AT-rich interaction domain containing 2 2 2
MIRT702960 HIF1A hypoxia inducible factor 1 alpha subunit 2 2
MIRT703628 FBXL3 F-box and leucine rich repeat protein 3 2 2
MIRT709931 MRPS16 mitochondrial ribosomal protein S16 2 2
MIRT712973 KANSL3 KAT8 regulatory NSL complex subunit 3 2 2
MIRT714884 RAD18 RAD18, E3 ubiquitin protein ligase 2 2
MIRT719140 DPYSL5 dihydropyrimidinase like 5 2 2
MIRT724999 CDC27 cell division cycle 27 2 2
MIRT735830 GREM1 gremlin 1, DAN family BMP antagonist 2 0
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-3128 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-3128 Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7)
hsa-mir-3128 Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-mir-3128 Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-mir-3128 Tamoxifen 2733525 NSC180973 approved resistant cell line (MCF7)
hsa-mir-3128 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-3128 Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-3128 Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-3128 Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-3128 Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-3128 Prednisone/Azathioprine/Methotrexate/Cyclophosphamide/Mycophenolate mofetil resistant tissue (myasthenia gravis)
hsa-miR-3128 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-3128 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)

Error report submission