miRTarBase - #MIRT516622


—
pre-miRNA Information
pre-miRNA hsa-mir-4794   
Genomic Coordinates chr1: 64579847 - 64579923
Description Homo sapiens miR-4794 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4794
Sequence 9| UCUGGCUAUCUCACGAGACUGU |30
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1162954002 4 dbSNP
rs1349204197 5 dbSNP
rs1454714841 8 dbSNP
rs191156964 14 dbSNP
rs543526824 15 dbSNP
rs1284724491 19 dbSNP
rs945565778 19 dbSNP
Putative Targets

Gene Information
Gene Symbol DARS2   
Synonyms ASPRS, LBSL, MT-ASPRS
Description aspartyl-tRNA synthetase 2, mitochondrial
Transcript NM_018122   
Expression
Putative miRNA Targets on DARS2
3'UTR of DARS2
(miRNA target sites are highlighted)		 
>DARS2|NM_018122|3'UTR
   1 ATCATGCATACCATGCAGAAAGTTGAGCTTTTAGGTTTTGTCCTCTTTGCTTCCCCAAGGCTAAAGTCAGATCTAGAGTT
  81 CTGCCACAGGTCTAACAATCAAGTCTTTAGATGGAAGGAATCCAGGCAACATTCTTCACCACAACGAAGAAACAGATAAA
 161 AGATACCCAATTTTGACTTGATTTCATGCATCATTTGGATTTTTTTTGGTTAGGACTTTTTTTGAAGTTCCTTTTTACTT
 241 AGGTGTGAAAGATGGTTCTTTGTTGAAATAATATAGTGGTTTAGTGTTTTCAAATCATGTTTCTCATACCCAGATAGTAG
 321 ATTATTCACTTAGGACAGAGGTAATCAAATTATGTGTGAAATGTAGGAAAATGCTTGCCCCTGTAAACTAGTGAGTTGAT
 401 GGAGCATTTGCTTCATCATCCTCATCAAGAGAATCATATAAATTAAGCTTTATAATGACATTTCAACCATCAACATAATA
 481 TAGTGAGGAGTAGCATAATATTTTTTAATAATGCAGAAAACATCACTGAAATGAGAGTCACAAATTTTTCTTCAGTGTTT
 561 CAGCCTGAGTAAGTTACATAAACCTCGCTTAGCCTCCCTTCCTGCTAATGTGTAAAATACATACTTGCCCTGGCTACCTC
 641 ACCGGGCTGTTATTGCTGGAATCAGAGGAGATAACATATATGGAAGATAAAGTGAATAAAAGTACTTTGAAAAACTATAA
 721 AGCATTCCACAAATATGAGATGATGGTATTATCCATCCATAAATAGGTAGATATATCTCTATTTTATAGTTTCAGATTAA
 801 ACAAAACTGATATCAATAGTAAAAGTCATTTTACTTATC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uguCAGAGCACUCUAUCGGUCu 5'
             ||:|| |   ||| |||| 
Target 5' catGTTTC-T--CATACCCAGa 3'
 296 - 314 118.00 -8.60
2 
miRNA  3' ugucagagcacucuaUCGGUCu 5'
                         ||:||| 
Target 5' cttccccaaggctaaAGTCAGa 3'
 50 - 71 104.00 -9.00
3 
miRNA  3' ugucaGAGC-ACUCUAUCGGucu 5'
               |||| |    |||||   
Target 5' taaacCTCGCT----TAGCCtcc 3'
 579 - 597 103.00 -9.12
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
873686 153 ClinVar
293831 169 ClinVar
293832 211 ClinVar
293833 432 ClinVar
873687 588 ClinVar
293834 643 ClinVar
873688 645 ClinVar
293835 654 ClinVar
COSN30110940 47 COSMIC
COSN30485735 76 COSMIC
COSN26027493 81 COSMIC
COSN31565862 81 COSMIC
COSN30510893 83 COSMIC
COSN31557921 106 COSMIC
COSN13493866 128 COSMIC
COSN26434579 147 COSMIC
COSN31563997 185 COSMIC
COSN18714183 203 COSMIC
COSN22609339 503 COSMIC
COSN19460399 587 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs759030417 6 dbSNP
rs1249302028 7 dbSNP
rs1482222045 15 dbSNP
rs778418949 17 dbSNP
rs1412846820 24 dbSNP
rs749994971 25 dbSNP
rs755664477 34 dbSNP
rs776183062 35 dbSNP
rs200858499 42 dbSNP
rs1250144800 45 dbSNP
rs1000780590 55 dbSNP
rs1186693143 56 dbSNP
rs908756396 59 dbSNP
rs944313360 66 dbSNP
rs546699392 90 dbSNP
rs145246788 99 dbSNP
rs1289688488 108 dbSNP
rs184458663 110 dbSNP
rs1340958985 126 dbSNP
rs748208338 145 dbSNP
rs1019884556 146 dbSNP
rs555583349 153 dbSNP
rs550840346 169 dbSNP
rs972902827 172 dbSNP
rs1025226694 180 dbSNP
rs952422471 187 dbSNP
rs1392206513 198 dbSNP
rs1166986029 200 dbSNP
rs1211523802 200 dbSNP
rs1448909344 202 dbSNP
rs1043109952 206 dbSNP
rs9425758 211 dbSNP
rs529812512 213 dbSNP
rs998790940 217 dbSNP
rs760958796 222 dbSNP
rs1205593670 229 dbSNP
rs959907335 231 dbSNP
rs1475863617 232 dbSNP
rs1484252696 237 dbSNP
rs1271990511 238 dbSNP
rs1169806879 243 dbSNP
rs1227260821 245 dbSNP
rs771259782 262 dbSNP
rs1347940155 271 dbSNP
rs537759436 279 dbSNP
rs990972782 288 dbSNP
rs557695965 291 dbSNP
rs1013500521 295 dbSNP
rs1314050216 307 dbSNP
rs12084787 314 dbSNP
rs1298704938 315 dbSNP
rs1377760616 316 dbSNP
rs1368522500 317 dbSNP
rs918085957 319 dbSNP
rs1025334902 330 dbSNP
rs1395762454 334 dbSNP
rs969233837 335 dbSNP
rs1178311885 336 dbSNP
rs1318054446 339 dbSNP
rs1250122648 355 dbSNP
rs777034042 367 dbSNP
rs1485831061 378 dbSNP
rs981024604 381 dbSNP
rs1257410846 389 dbSNP
rs1026709899 391 dbSNP
rs760039025 394 dbSNP
rs765636264 397 dbSNP
rs982411647 401 dbSNP
rs1348384065 408 dbSNP
rs908201992 409 dbSNP
rs1272657850 412 dbSNP
rs577636691 412 dbSNP
rs1346551754 415 dbSNP
rs1376230689 418 dbSNP
rs1234344319 421 dbSNP
rs1358693927 422 dbSNP
rs1160436364 425 dbSNP
rs886045592 432 dbSNP
rs1473889738 445 dbSNP
rs1181823768 447 dbSNP
rs1475754206 448 dbSNP
rs936684812 457 dbSNP
rs1282447334 485 dbSNP
rs1482632875 490 dbSNP
rs1053684745 492 dbSNP
rs943743175 495 dbSNP
rs889687541 496 dbSNP
rs1210511469 497 dbSNP
rs1326906347 503 dbSNP
rs1267443896 511 dbSNP
rs1233622969 525 dbSNP
rs1007233612 536 dbSNP
rs372838932 538 dbSNP
rs901005378 556 dbSNP
rs1204404801 565 dbSNP
rs765746998 567 dbSNP
rs921541431 579 dbSNP
rs1394557071 587 dbSNP
rs567773377 588 dbSNP
rs1025384256 608 dbSNP
rs1233384056 610 dbSNP
rs1289585655 613 dbSNP
rs1043225083 625 dbSNP
rs189330031 638 dbSNP
rs1387032106 640 dbSNP
rs140743566 643 dbSNP
rs574117039 644 dbSNP
rs542846978 645 dbSNP
rs934737223 647 dbSNP
rs1422952222 650 dbSNP
rs1261999109 652 dbSNP
rs886045593 654 dbSNP
rs1053170457 658 dbSNP
rs375732273 662 dbSNP
rs1453909644 671 dbSNP
rs895798339 673 dbSNP
rs1358171699 681 dbSNP
rs1034441714 695 dbSNP
rs959614964 703 dbSNP
rs1174311706 704 dbSNP
rs1263513457 710 dbSNP
rs1242872120 711 dbSNP
rs1063282 719 dbSNP
rs991480699 721 dbSNP
rs1321272782 725 dbSNP
rs1298621755 727 dbSNP
rs1437323064 741 dbSNP
rs918088729 742 dbSNP
rs971337061 745 dbSNP
rs1320451193 746 dbSNP
rs1014697782 747 dbSNP
rs978157865 753 dbSNP
rs1393323580 754 dbSNP
rs1046279739 772 dbSNP
rs1373240299 774 dbSNP
rs924045643 775 dbSNP
rs905125278 782 dbSNP
rs1447099006 792 dbSNP
rs1389065737 799 dbSNP
rs936757075 802 dbSNP
rs1386148921 803 dbSNP
rs1265184609 808 dbSNP
rs546840059 811 dbSNP
rs1321211218 815 dbSNP
rs182319107 818 dbSNP
rs1230956693 825 dbSNP
rs1340127172 830 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 55157.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ugucagagcacucuaUCGGUCu 5'
                         |||||| 
Target 5' ---------------AGCCAGg 3'
 		1 - 7
Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000361951.4 | 3UTR | AGCCAGGCAUGGUGGCCCACGCCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
110 hsa-miR-4794 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT059821 EFNA1 ephrin A1 2 2
MIRT203153 BACH1 BTB domain and CNC homolog 1 2 2
MIRT334253 SERPINH1 serpin family H member 1 2 2
MIRT475239 IGF2BP3 insulin like growth factor 2 mRNA binding protein 3 2 2
MIRT482467 ADAR adenosine deaminase, RNA specific 2 4
MIRT482632 AAR2 AAR2 splicing factor homolog 2 2
MIRT511147 MRPL17 mitochondrial ribosomal protein L17 2 4
MIRT514416 RSL1D1 ribosomal L1 domain containing 1 2 2
MIRT514842 LYRM7 LYR motif containing 7 2 4
MIRT515343 CXorf36 chromosome X open reading frame 36 2 2
MIRT515806 ALOX5AP arachidonate 5-lipoxygenase activating protein 2 2
MIRT516396 NPR1 natriuretic peptide receptor 1 2 4
MIRT516622 DARS2 aspartyl-tRNA synthetase 2, mitochondrial 2 2
MIRT516959 SLC35F6 solute carrier family 35 member F6 2 2
MIRT517154 VHLL VHL like 2 2
MIRT517268 NRIP2 nuclear receptor interacting protein 2 2 2
MIRT517660 TRIM72 tripartite motif containing 72 2 4
MIRT518026 ABHD15 abhydrolase domain containing 15 2 2
MIRT518116 RNMTL1 mitochondrial rRNA methyltransferase 3 2 4
MIRT518143 C15orf40 chromosome 15 open reading frame 40 2 4
MIRT518232 C7orf55 formation of mitochondrial complex V assembly factor 1 homolog 2 2
MIRT518517 CASP10 caspase 10 2 2
MIRT518646 NOM1 nucleolar protein with MIF4G domain 1 2 2
MIRT519287 SPCS1 signal peptidase complex subunit 1 2 2
MIRT519487 PNPLA3 patatin like phospholipase domain containing 3 2 2
MIRT520917 ST13 ST13, Hsp70 interacting protein 2 2
MIRT520928 SSBP2 single stranded DNA binding protein 2 2 2
MIRT521966 PHAX phosphorylated adaptor for RNA export 2 4
MIRT522244 NPFFR1 neuropeptide FF receptor 1 2 2
MIRT523355 GTF3C6 general transcription factor IIIC subunit 6 2 2
MIRT525181 ZNF468 zinc finger protein 468 2 2
MIRT528221 METTL8 methyltransferase like 8 2 2
MIRT528437 COL9A2 collagen type IX alpha 2 chain 2 2
MIRT531504 NONO non-POU domain containing octamer binding 2 2
MIRT532597 SIX4 SIX homeobox 4 2 2
MIRT532761 LDHD lactate dehydrogenase D 2 2
MIRT536012 MECP2 methyl-CpG binding protein 2 2 2
MIRT536262 LPGAT1 lysophosphatidylglycerol acyltransferase 1 2 2
MIRT547555 LRRC58 leucine rich repeat containing 58 2 2
MIRT554691 RNF2 ring finger protein 2 2 2
MIRT557250 CRAMP1L cramped chromatin regulator homolog 1 2 2
MIRT563339 RPLP0 ribosomal protein lateral stalk subunit P0 2 2
MIRT573179 P2RX3 purinergic receptor P2X 3 2 2
MIRT574386 UBE2N ubiquitin conjugating enzyme E2 N 2 2
MIRT574638 LPCAT3 lysophosphatidylcholine acyltransferase 3 2 2
MIRT609143 ZNF610 zinc finger protein 610 2 4
MIRT609651 PACS2 phosphofurin acidic cluster sorting protein 2 2 2
MIRT610846 ZNF44 zinc finger protein 44 2 2
MIRT612345 TP53INP1 tumor protein p53 inducible nuclear protein 1 2 2
MIRT613002 GATA6 GATA binding protein 6 2 2
MIRT614095 PDE4C phosphodiesterase 4C 2 2
MIRT615512 AGTRAP angiotensin II receptor associated protein 2 2
MIRT621281 PIWIL1 piwi like RNA-mediated gene silencing 1 2 2
MIRT623367 LUC7L2 LUC7 like 2, pre-mRNA splicing factor 2 2
MIRT624508 C7orf55-LUC7L2 C7orf55-LUC7L2 readthrough 2 2
MIRT632570 POLQ DNA polymerase theta 2 2
MIRT634829 ARHGEF39 Rho guanine nucleotide exchange factor 39 2 2
MIRT639452 CTNNBL1 catenin beta like 1 2 2
MIRT642097 FBXL2 F-box and leucine rich repeat protein 2 2 2
MIRT648408 TRMT10B tRNA methyltransferase 10B 2 2
MIRT653936 SERPINC1 serpin family C member 1 2 2
MIRT658226 FBXL16 F-box and leucine rich repeat protein 16 2 2
MIRT662599 MAGEB4 MAGE family member B4 2 2
MIRT663190 IBA57 IBA57 homolog, iron-sulfur cluster assembly 2 2
MIRT664623 DNPEP aspartyl aminopeptidase 2 2
MIRT671879 ZNF429 zinc finger protein 429 2 2
MIRT679033 ZNF419 zinc finger protein 419 2 2
MIRT684892 ZSCAN22 zinc finger and SCAN domain containing 22 2 2
MIRT685153 DTWD2 DTW domain containing 2 2 2
MIRT686415 TVP23C trans-golgi network vesicle protein 23 homolog C 2 2
MIRT687021 RNF24 ring finger protein 24 2 2
MIRT688369 ENPP1 ectonucleotide pyrophosphatase/phosphodiesterase 1 2 2
MIRT689600 FAM96A family with sequence similarity 96 member A 2 2
MIRT690375 ZSWIM7 zinc finger SWIM-type containing 7 2 2
MIRT690484 RSRC1 arginine and serine rich coiled-coil 1 2 2
MIRT691458 C21orf58 chromosome 21 open reading frame 58 2 2
MIRT691861 ZNF552 zinc finger protein 552 2 2
MIRT692035 ARSK arylsulfatase family member K 2 2
MIRT693951 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 2 2
MIRT694058 NQO2 N-ribosyldihydronicotinamide:quinone reductase 2 2 2
MIRT694469 LRTOMT leucine rich transmembrane and O-methyltransferase domain containing 2 2
MIRT695028 ALG10B ALG10B, alpha-1,2-glucosyltransferase 2 2
MIRT695093 CHRNB1 cholinergic receptor nicotinic beta 1 subunit 2 2
MIRT696624 WDR77 WD repeat domain 77 2 2
MIRT697446 ZCCHC8 zinc finger CCHC-type containing 8 2 2
MIRT697871 UBE2D3 ubiquitin conjugating enzyme E2 D3 2 2
MIRT700637 PQLC2 PQ loop repeat containing 2 2 2
MIRT701192 OTUD3 OTU deubiquitinase 3 2 2
MIRT701332 NSD1 nuclear receptor binding SET domain protein 1 2 2
MIRT702199 LPP LIM domain containing preferred translocation partner in lipoma 2 2
MIRT702891 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 2
MIRT704389 CTSS cathepsin S 2 2
MIRT704922 CCDC36 coiled-coil domain containing 36 2 2
MIRT705770 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT705797 ALDH6A1 aldehyde dehydrogenase 6 family member A1 2 2
MIRT705874 AEN apoptosis enhancing nuclease 2 2
MIRT707372 ORAI2 ORAI calcium release-activated calcium modulator 2 2 2
MIRT707426 RRP7A ribosomal RNA processing 7 homolog A 2 2
MIRT710293 SPN sialophorin 2 2
MIRT710744 ZNF71 zinc finger protein 71 2 2
MIRT713183 ERO1L endoplasmic reticulum oxidoreductase 1 alpha 1 1
MIRT715030 RANBP6 RAN binding protein 6 2 2
MIRT715829 ZNF598 zinc finger protein 598 2 2
MIRT720340 BACE2 beta-site APP-cleaving enzyme 2 2 2
MIRT722662 VKORC1L1 vitamin K epoxide reductase complex subunit 1 like 1 2 2
MIRT722683 RRM2 ribonucleotide reductase regulatory subunit M2 2 2
MIRT723908 PEX11A peroxisomal biogenesis factor 11 alpha 2 2
MIRT724044 SMIM14 small integral membrane protein 14 2 2
MIRT725241 PDE1B phosphodiesterase 1B 2 2
MIRT725307 NLRC5 NLR family CARD domain containing 5 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4794 Doxorubicin 31703 NSC123127 approved resistant High Triple-Negative Breast Cancer cell line (MDA-MB-231, MDA-MB-468)
hsa-miR-4794 Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-4794 Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (100 ng/ml)
hsa-miR-4794 Gemcitabine 60750 NSC613327 approved sensitive cell line (Panc1-GR4)

Error report submission