pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-655 |
Genomic Coordinates | chr14: 101049550 - 101049646 |
Synonyms | MIRN655, hsa-mir-655, MIR655 |
Description | Homo sapiens miR-655 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Associated Diseases | ![]() |
Mature miRNA Information | |||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-655-5p | ||||||||||||||||||||||||||||||
Sequence | 23| AGAGGUUAUCCGUGUUAUGUUC |44 | ||||||||||||||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||||||||||||||
Experiments | Illumina | ||||||||||||||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | ZNF100 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonyms | - | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Description | zinc finger protein 100 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Transcript | NM_173531 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative miRNA Targets on ZNF100 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3'UTR of ZNF100 (miRNA target sites are highlighted) |
>ZNF100|NM_173531|3'UTR 1 AAAATGTGGCAAAGCCTTTTACCAGTCCTCAACTCTTACTAAACATAAAAAAATTCATACTGGAGGGAACTCCTGTGACT 81 GTGAAGAATATGGCAAAGCCTTTAATAAATTCTCAATTCCTAACAGACATAAGATAATTCATACTAGAGAGAAATTCTAC 161 AAACCAGAAAGATGTGACAGTGCTTTGAAAACACCTCAAACTTTTCAAAACATAAATCATAGTGTTGAGAAATCCTAGAA 241 ATGTGAAGAATGTGATAAAGTTTTAAATGGTTGTCACACTTGATTGTAGGTAAGGTAAGTTATACTGGAGAAAACTTCTA 321 CATGTGTGAACAGTGTGACAAAACTTTTAACTAATGCTCACACCTTCACAGGAAAGCATTTATACTTGAGAAATATTGTA 401 CAAATATAAAGACTGTGAAAAAGCCATTAATACATGCTCACATCTTACTCAACATCAGAGAGTTCATACTCAATAAAAAC 481 ATAAGTGCAACTACTGTCAAAATATCTTTAAGAAAATATAAGCTTTTAAAGTGAAGAGTATTTTGAAGAAGAACATTGTA 561 GTAGAATTGTAATATGTTTACTTGTATCACAGATCTTACTGTACACGTTTTGTATTAGAGGAAACCTCTGAAGCAGTTGC 641 TCAAACTTTGTTCAATATCAGGGAATTTATATTGAAAAAAACTGTGCGAATGTAATAAAGTTGGAAAAATACTTTTTCAA 721 AAACTACAGCTTAGAAAACACCAGAGAGTTCATACTAAAACATATTTTTGCAGATACAGGAAAAATTTTTTAAAAATTTT 801 AATCATTAAGTCTGTAAATATCAGAGAATTTACAGTAGAAATATGTAAGGCACTGATGCTTCAGGTATTTTACTAAATCA 881 GAGTGCTGAGTATAGAAAATAATCTAAAACTAAAATTGGTAAAATATTTGTATATAACTTTAAAAGTAGAAATTTTTTGC 961 AGTTATTGCATTCAAAGTATGCTTAACTTTTTGAAAAAATTAGATTTTTTGAAAAGTGAGTAATAATGTAATTCAACTCT 1041 TAAATTATTTCCTGCCTTTTCTTCACTCCTATTTACATGTGAAAGCATGTGATCAATTGTTGCTGCATCAGATATGAGAG 1121 ATTCTTTTTTATTAGGTGAGCATTATTTATAAACTTTGCTATGAAAAAGACATTAAAATATGAGATGTATGATGAAAATC 1201 TAAGTGAAGAGACTTTTATGGTTAACTTATAATATTAAGCAATGTGTGCGTTAGGCATTCAGAGTAATATTCTGCATTAT 1281 GAGAAAACTTAATTTCATTTATAAGTAAATTAAAATTAGTATATTTTACTAATACTTTTATATAAAATGCAGTATATTTT 1361 TTAAATTTCAGATTATATGTGATGTTAATATATTCAACCTTTTTAACATGTTAAATACTATTGTGCATTCAGTGAAGTGT 1441 TATTATGCCACAGACATTAACCTATTCCACCTTACTCAAGGGTGTACGTAAAACATGGTAACAGTATACTATTTGGTAAC 1521 ATAATGGATTAACATCTCTAGTAATCTCTTTTGCTAGTGGCTTTGACTGCAAATAAGTTAAAGAATATTATTTCTGTAGG 1601 TTAAATTTTTGTTTTTATTTTATTTTATTTTTGAGAGGTAGTCTTGCTCTGTCACCCAGGCTGGAGTGCAGTGGCACGAT 1681 CTCGGCTCACTGTAACCTCCACCTCCTGGGTTCACGCAATTCTCCTGCCTCAGCCTCCTAAGTAGCTGGGATTACAGGCA 1761 CCCACCACCATGCCCAGCTAATTTTTGTATTTTAGTAGAGACAGGGTTTCATAATGTAAGTCAAGCTGGTCTCGAACTCC 1841 TGACCTTAAATGATTTGCCTGCCTCGGCTTCCCAAAGTTCTGGGATTACAGGCATGAGCCACCGTGCCCAGCCAAATGTT 1921 TATTTTATTTAAATTTATTTTTCTTAATTATTTGGGGTACATAATATGAGTATATATTCATGCAATATATGGCATATTTT 2001 GATACAAGAATACAGTATATAATAATCACATCAGGGTAAATGAGGTATCCATCACCTCTAGTATTTATCCTTTGTATTAC 2081 AAGCAACCCAGTTTTATACTTTTAGTTATTTTAAAATGTAAAATTAAATTGTTATTGATTACAGTGTTATTTTTATGGTC 2161 ATAATAAAAGTTATGTAGAAGTATAATAAAATCCCTACATTTCTGAGGCCTGAATAAGTATTTTTAAAGTTTTCTAATAT 2241 TTATTTTTTGAGCATGTTTCCTGTCTGCCTGCAAACACATGCAGACATTTAGTTTTGATTTACATATAGTTAAATATATG 2321 TTAGTCTAAAGATAAACCTTAAGTGTAAGAAAATTATAGAGTGAGTTTGTGTGTATGAATTTGTACCTGTTTTCCGAAGA 2401 AAAAAGCAATACTGAACAAAACAAATCATTTTAACAAGATGACTACTAGAAAACTAAAAGCCTCAAAAATGCTAAAAGAA 2481 AATGTATTCTCTGCTTTGTATTGAATTTATTACTGTACATTCTGTGGCTTATAGTTCTGAATCTCCCCATGAAAATTCTG 2561 TTTATACTTGCCTGGTACTCATGATAGACCCCTAATTATTTTGTATCTTTTTTCATATAAATATTTTACAGATTATGAAG 2641 TAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
DRVs in gene 3'UTRs |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SNPs in gene 3'UTRs |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293 | ||||||
Disease | 163227.0 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HCT116 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in ERX177609. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_2_11
... - Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Krell J; Stebbing J; Carissimi C; Dabrowska et al. - Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
|
Experimental Support 3 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | Prostate Tissue |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRX1760591. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP_B
... - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.). |
Article |
- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al. - Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
|
CLIP-seq Support 1 for dataset GSM1065667 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_6 |
Location of target site | ENST00000358296.6 | 3UTR | ACUGUAACCUCCACCUCCUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23446348 / GSE43573 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
91 hsa-miR-655-5p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT080691 | KIAA1468 | KIAA1468 | ![]() |
![]() |
2 | 2 | ||||||
MIRT095086 | SEC24A | SEC24 homolog A, COPII coat complex component | ![]() |
![]() |
2 | 4 | ||||||
MIRT122450 | SMIM13 | small integral membrane protein 13 | ![]() |
![]() |
2 | 2 | ||||||
MIRT214635 | SMAD5 | SMAD family member 5 | ![]() |
![]() |
2 | 4 | ||||||
MIRT268267 | CCND1 | cyclin D1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT312418 | GRPEL2 | GrpE like 2, mitochondrial | ![]() |
![]() |
2 | 2 | ||||||
MIRT329008 | DSTN | destrin, actin depolymerizing factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT329824 | PDCD4 | programmed cell death 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT389635 | LRRC58 | leucine rich repeat containing 58 | ![]() |
![]() |
2 | 6 | ||||||
MIRT443969 | FAM198B | family with sequence similarity 198 member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT444080 | C12orf73 | chromosome 12 open reading frame 73 | ![]() |
![]() |
2 | 2 | ||||||
MIRT444886 | TMEM196 | transmembrane protein 196 | ![]() |
![]() |
2 | 2 | ||||||
MIRT445506 | CRNKL1 | crooked neck pre-mRNA splicing factor 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT446292 | ACSL3 | acyl-CoA synthetase long chain family member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT446462 | THAP1 | THAP domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT446472 | THUMPD3 | THUMP domain containing 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT447413 | MED21 | mediator complex subunit 21 | ![]() |
![]() |
2 | 2 | ||||||
MIRT447491 | KIAA1715 | lunapark, ER junction formation factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT448965 | CDADC1 | cytidine and dCMP deaminase domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT449602 | INIP | INTS3 and NABP interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT449607 | PRPF4 | pre-mRNA processing factor 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT449737 | TAB2 | TGF-beta activated kinase 1/MAP3K7 binding protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT451668 | KRT8 | keratin 8 | ![]() |
![]() |
2 | 4 | ||||||
MIRT452424 | QDPR | quinoid dihydropteridine reductase | ![]() |
![]() |
2 | 2 | ||||||
MIRT455187 | AGTRAP | angiotensin II receptor associated protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT456059 | SLC25A28 | solute carrier family 25 member 28 | ![]() |
![]() |
2 | 2 | ||||||
MIRT456488 | SERAC1 | serine active site containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT456631 | ARMCX6 | armadillo repeat containing, X-linked 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT459621 | SLC25A33 | solute carrier family 25 member 33 | ![]() |
![]() |
2 | 2 | ||||||
MIRT461162 | SLC11A2 | solute carrier family 11 member 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT461990 | PACSIN1 | protein kinase C and casein kinase substrate in neurons 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT463149 | ZNF385A | zinc finger protein 385A | ![]() |
![]() |
2 | 4 | ||||||
MIRT463465 | ZC3HAV1L | zinc finger CCCH-type containing, antiviral 1 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT463801 | XPOT | exportin for tRNA | ![]() |
![]() |
2 | 2 | ||||||
MIRT464010 | WDR26 | WD repeat domain 26 | ![]() |
![]() |
2 | 2 | ||||||
MIRT465302 | TRIB1 | tribbles pseudokinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT468837 | RRM2 | ribonucleotide reductase regulatory subunit M2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT469132 | RNF126 | ring finger protein 126 | ![]() |
![]() |
2 | 2 | ||||||
MIRT469244 | RHOB | ras homolog family member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT472414 | NCKAP1 | NCK associated protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT472432 | NCBP2 | nuclear cap binding protein subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT472808 | MTMR12 | myotubularin related protein 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT477893 | DVL3 | dishevelled segment polarity protein 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT477963 | DPM2 | dolichyl-phosphate mannosyltransferase subunit 2, regulatory | ![]() |
![]() |
2 | 2 | ||||||
MIRT479258 | CHSY1 | chondroitin sulfate synthase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT479718 | CCNF | cyclin F | ![]() |
![]() |
2 | 2 | ||||||
MIRT480231 | C9orf41 | carnosine N-methyltransferase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT482600 | ABHD14B | abhydrolase domain containing 14B | ![]() |
![]() |
2 | 2 | ||||||
MIRT483096 | TFPI | tissue factor pathway inhibitor | ![]() |
![]() |
2 | 2 | ||||||
MIRT484644 | TBC1D5 | TBC1 domain family member 5 | ![]() |
![]() |
2 | 4 | ||||||
MIRT488899 | CLDND1 | claudin domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT491954 | VPS52 | VPS52, GARP complex subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT496937 | LBR | lamin B receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT498546 | TMEM30B | transmembrane protein 30B | ![]() |
![]() |
2 | 2 | ||||||
MIRT501778 | NRBF2 | nuclear receptor binding factor 2 | ![]() |
![]() |
2 | 6 | ||||||
MIRT516286 | DBT | dihydrolipoamide branched chain transacylase E2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT516351 | GABPB1 | GA binding protein transcription factor beta subunit 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT516751 | ZNF100 | zinc finger protein 100 | ![]() |
![]() |
2 | 2 | ||||||
MIRT517939 | ZNF431 | zinc finger protein 431 | ![]() |
![]() |
2 | 4 | ||||||
MIRT518295 | ZNF514 | zinc finger protein 514 | ![]() |
![]() |
2 | 4 | ||||||
MIRT518515 | CASP10 | caspase 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT519017 | NOA1 | nitric oxide associated 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT519171 | SCO1 | SCO1, cytochrome c oxidase assembly protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT519470 | SPTLC2 | serine palmitoyltransferase long chain base subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT521029 | SLC30A5 | solute carrier family 30 member 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT521251 | SAMD8 | sterile alpha motif domain containing 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT521682 | PRKAR2A | protein kinase cAMP-dependent type II regulatory subunit alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT529386 | SKP1 | S-phase kinase associated protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT545507 | NAP1L1 | nucleosome assembly protein 1 like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT549655 | RSL1D1 | ribosomal L1 domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT551041 | CTSB | cathepsin B | ![]() |
![]() |
2 | 4 | ||||||
MIRT551441 | ZNF490 | zinc finger protein 490 | ![]() |
![]() |
2 | 4 | ||||||
MIRT554778 | RHEBP1 | RHEB pseudogene 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT565793 | SEC14L5 | SEC14 like lipid binding 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT566727 | MSL2 | MSL complex subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT574668 | HNRNPDL | heterogeneous nuclear ribonucleoprotein D like | ![]() |
![]() |
2 | 2 | ||||||
MIRT610128 | DENND5B | DENN domain containing 5B | ![]() |
![]() |
2 | 2 | ||||||
MIRT624919 | FBXW2 | F-box and WD repeat domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT641830 | TRIM71 | tripartite motif containing 71 | ![]() |
![]() |
2 | 2 | ||||||
MIRT662165 | IFNAR2 | interferon alpha and beta receptor subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT667150 | NRXN3 | neurexin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT689085 | ADNP2 | ADNP homeobox 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT696322 | DCAF15 | DDB1 and CUL4 associated factor 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT699062 | SNX4 | sorting nexin 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT703229 | GOLGA1 | golgin A1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT705743 | AMD1 | adenosylmethionine decarboxylase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT706087 | HNRNPU | heterogeneous nuclear ribonucleoprotein U | ![]() |
![]() |
2 | 2 | ||||||
MIRT709288 | MAPK8IP2 | mitogen-activated protein kinase 8 interacting protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT711457 | RNF145 | ring finger protein 145 | ![]() |
![]() |
2 | 2 | ||||||
MIRT714708 | PPP3CC | protein phosphatase 3 catalytic subunit gamma | ![]() |
![]() |
2 | 2 | ||||||
MIRT719871 | CYP4F11 | cytochrome P450 family 4 subfamily F member 11 | ![]() |
![]() |
2 | 2 |
miRNA-Drug Associations | ||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|