>F2|NM_000506|3'UTR
   1 GGGGCCACTCATATTCTGGGCTCCTGGAACCAATCCCGTGAAAGAATTATTTTTGTGTTTCTAAAACTATGGTTCCCAAT
  81 AAAAGTGACTCTCAGCGAGCAAAAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' gaCACCUUACAGUCCCUCcgu 5' || || | |||| ||| Target 5' aaGT-GACTCTCAGCGAGcaa 3'	83 - 102	94.00	-9.60
2	miRNA 3' gacaccuuacaguccCUCCGu 5' |:||| Target 5' ---------------GGGGCc 3'	1 - 6	84.00	-5.20
3	miRNA 3' gacaccuuacagucCCUccgu 5' ||| Target 5' tattctgggctcctGGAacca 3'	12 - 32	60.00	-8.30

Mutant ID	Mutant Position	Mutant Source
877790	10	ClinVar
304823	45	ClinVar
143995	97	ClinVar
13310	98	ClinVar
COSM1980920	5	COSMIC
COSN30119972	6	COSMIC
COSN30536612	17	COSMIC
COSN31511393	18	COSMIC
COSN30520105	37	COSMIC
COSN26975564	39	COSMIC
COSN13325086	45	COSMIC
COSN31542497	46	COSMIC
COSN30114286	47	COSMIC
COSN30104771	48	COSMIC
COSN19729911	71	COSMIC
rs1799963	98	GWAS

Mutant ID	Mutant Position	Mutant Source
rs1043295771	1	dbSNP
rs1031259062	6	dbSNP
rs201577861	10	dbSNP
rs1011111326	11	dbSNP
rs748598519	13	dbSNP
rs879187678	17	dbSNP
rs770436943	20	dbSNP
rs1160117677	22	dbSNP
rs773661479	23	dbSNP
rs1240226560	24	dbSNP
rs755723502	27	dbSNP
rs774039615	32	dbSNP
rs1379644058	34	dbSNP
rs749644376	36	dbSNP
rs1185401241	37	dbSNP
rs771364258	38	dbSNP
rs773848443	39	dbSNP
rs1465107144	43	dbSNP
rs759287343	45	dbSNP
rs188001809	47	dbSNP
rs1463295861	48	dbSNP
rs968468147	49	dbSNP
rs1448014503	51	dbSNP
rs1356161570	54	dbSNP
rs541646553	54	dbSNP
rs759052297	55	dbSNP
rs1248811892	63	dbSNP
rs771758640	67	dbSNP
rs979833221	70	dbSNP
rs934669940	72	dbSNP
rs1433117218	81	dbSNP
rs879487592	96	dbSNP
rs72550707	97	dbSNP
rs1799963	98	dbSNP

- Nature methods, 2011

Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.

- Nature, 2013

Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.

- Genes & development, 2013

When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.

- Neoplasia (New York, N.Y.), 2016

MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.