pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4318 |
Genomic Coordinates | chr18: 37657135 - 37657215 |
Description | Homo sapiens miR-4318 stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4318 | |||||||||
Sequence | 55| CACUGUGGGUACAUGCU |71 | |||||||||
Evidence | Experimental | |||||||||
Experiments | SOLiD | |||||||||
SNPs in miRNA |
|
|||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | UGT2B4 | ||||||||||||||||||||
Synonyms | HLUG25, UDPGT2B4, UDPGTH1, UDPGTh-1, UGT2B11 | ||||||||||||||||||||
Description | UDP glucuronosyltransferase family 2 member B4 | ||||||||||||||||||||
Transcript | NM_021139 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on UGT2B4 | |||||||||||||||||||||
3'UTR of UGT2B4 (miRNA target sites are highlighted) |
>UGT2B4|NM_021139|3'UTR 1 TTACGTCTGAGGCTGGAAGCTGGGAAACCCAATAAATGAACTCCTTTAGTTTATTACAACAAGAAGACGTTGTGATACAA 81 GAGATTCCTTTCTTCTTGTGACAAAACATCTTTCAAAACTTACCTTGTCAAGTCAAAATTTGTTTTAGTACCTGTTTAAC 161 CATTAGAAATATTTCATGTCAAGGAGGAAAACATTAGGGAAAACAAAAATGATATAAAGCCATATGAGGTTATATTGAAA 241 TGTATTGAGCTTATATTGAAATTTATTGTTCCAATTCACAGGTTACATGAAAAAAAATTTACTAAGCTTAACTACATGTC 321 ACACATTGTACATGGAAACAAGAACATTAAGAAGTCCACTGACAGTATCAGTACTGTTTTGCAAATACTCAGCATACTTT 401 GGATCCATTTCATGCAGGATTGTGTTGTTTTAACTGTTGTTGAGGAAGCTAATAAATAATTAAATTGTAAAAAAAAAAAA 481 AAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293 | ||||||
Disease | 7363.0 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
"HITS-CLIP data was present in GSM714642. RNA binding protein: AGO2. Condition:completeT1
"PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Disease | 7363.0 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
CLIP-seq Support 1 for dataset GSM714642 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repA |
Location of target site | ENST00000305107.6 | 3UTR | AUGACUAUAUAUAUAUAUAUAUACACACACACACAGUA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM714644 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repA |
Location of target site | ENST00000305107.6 | 3UTR | AUGACUAUAUAUAUAUAUAUAUACACACACACACAGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
CLIP-seq Support 3 for dataset GSM1065667 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_6 |
Location of target site | ENST00000305107.6 | 3UTR | AUGACUAUAUAUAUAUAUAUAUACACACACACACAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23446348 / GSE43573 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
60 hsa-miR-4318 Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT068761 | RB1 | RB transcriptional corepressor 1 | 2 | 2 | ||||||||
MIRT094193 | THAP6 | THAP domain containing 6 | 2 | 2 | ||||||||
MIRT166771 | PAPD7 | poly(A) RNA polymerase D7, non-canonical | 2 | 2 | ||||||||
MIRT185495 | SRP9 | signal recognition particle 9 | 2 | 2 | ||||||||
MIRT347687 | LSM14A | LSM14A, mRNA processing body assembly factor | 2 | 2 | ||||||||
MIRT441948 | PEX2 | peroxisomal biogenesis factor 2 | 2 | 2 | ||||||||
MIRT443293 | TAF8 | TATA-box binding protein associated factor 8 | 2 | 4 | ||||||||
MIRT447126 | DUSP16 | dual specificity phosphatase 16 | 2 | 2 | ||||||||
MIRT447428 | MED21 | mediator complex subunit 21 | 2 | 2 | ||||||||
MIRT447971 | MSH6 | mutS homolog 6 | 2 | 2 | ||||||||
MIRT450693 | RPN2 | ribophorin II | 2 | 2 | ||||||||
MIRT465671 | TNPO2 | transportin 2 | 2 | 2 | ||||||||
MIRT477011 | FAM60A | SIN3-HDAC complex associated factor | 2 | 2 | ||||||||
MIRT479898 | CCDC117 | coiled-coil domain containing 117 | 2 | 2 | ||||||||
MIRT488681 | ELP2 | elongator acetyltransferase complex subunit 2 | 2 | 2 | ||||||||
MIRT490349 | PEX10 | peroxisomal biogenesis factor 10 | 2 | 2 | ||||||||
MIRT491108 | NARS | asparaginyl-tRNA synthetase | 2 | 2 | ||||||||
MIRT494804 | ALG9 | ALG9, alpha-1,2-mannosyltransferase | 2 | 2 | ||||||||
MIRT512730 | YWHAZ | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta | 2 | 2 | ||||||||
MIRT518098 | UGT2B4 | UDP glucuronosyltransferase family 2 member B4 | 2 | 4 | ||||||||
MIRT518113 | RPS7 | ribosomal protein S7 | 2 | 2 | ||||||||
MIRT528967 | FAM19A3 | family with sequence similarity 19 member A3, C-C motif chemokine like | 2 | 2 | ||||||||
MIRT529796 | AP4S1 | adaptor related protein complex 4 sigma 1 subunit | 2 | 2 | ||||||||
MIRT530503 | FADS6 | fatty acid desaturase 6 | 2 | 2 | ||||||||
MIRT530797 | SNRPD1 | small nuclear ribonucleoprotein D1 polypeptide | 2 | 2 | ||||||||
MIRT532654 | TAB1 | TGF-beta activated kinase 1 (MAP3K7) binding protein 1 | 2 | 2 | ||||||||
MIRT533417 | TXLNG | taxilin gamma | 2 | 2 | ||||||||
MIRT536327 | LGSN | lengsin, lens protein with glutamine synthetase domain | 2 | 2 | ||||||||
MIRT537611 | ERMP1 | endoplasmic reticulum metallopeptidase 1 | 2 | 2 | ||||||||
MIRT540738 | FN3KRP | fructosamine 3 kinase related protein | 2 | 2 | ||||||||
MIRT545780 | ZNF805 | zinc finger protein 805 | 2 | 2 | ||||||||
MIRT549884 | GINS4 | GINS complex subunit 4 | 2 | 2 | ||||||||
MIRT550618 | MTHFR | methylenetetrahydrofolate reductase | 2 | 2 | ||||||||
MIRT551451 | SULT1B1 | sulfotransferase family 1B member 1 | 2 | 2 | ||||||||
MIRT554858 | RDH11 | retinol dehydrogenase 11 (all-trans/9-cis/11-cis) | 2 | 2 | ||||||||
MIRT556558 | LIMS1 | LIM zinc finger domain containing 1 | 2 | 2 | ||||||||
MIRT572893 | ADCY2 | adenylate cyclase 2 | 2 | 2 | ||||||||
MIRT576517 | Slc35e2 | solute carrier family 35, member E2 | 2 | 2 | ||||||||
MIRT609005 | PYGO1 | pygopus family PHD finger 1 | 2 | 2 | ||||||||
MIRT614782 | SEC63 | SEC63 homolog, protein translocation regulator | 2 | 2 | ||||||||
MIRT633849 | ATP5A1 | ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle | 2 | 2 | ||||||||
MIRT634841 | APOOL | apolipoprotein O like | 2 | 2 | ||||||||
MIRT638838 | CRTAP | cartilage associated protein | 2 | 2 | ||||||||
MIRT639980 | POU5F1B | POU class 5 homeobox 1B | 2 | 2 | ||||||||
MIRT640263 | ALDOA | aldolase, fructose-bisphosphate A | 2 | 2 | ||||||||
MIRT641538 | SNW1 | SNW domain containing 1 | 2 | 2 | ||||||||
MIRT656540 | MACC1 | MACC1, MET transcriptional regulator | 2 | 2 | ||||||||
MIRT667590 | LONRF2 | LON peptidase N-terminal domain and ring finger 2 | 2 | 2 | ||||||||
MIRT667732 | KIAA1456 | KIAA1456 | 2 | 2 | ||||||||
MIRT667911 | ING1 | inhibitor of growth family member 1 | 2 | 2 | ||||||||
MIRT669865 | BROX | BRO1 domain and CAAX motif containing | 2 | 4 | ||||||||
MIRT675877 | ATP1B4 | ATPase Na+/K+ transporting family member beta 4 | 2 | 2 | ||||||||
MIRT676868 | ZNF451 | zinc finger protein 451 | 2 | 2 | ||||||||
MIRT683211 | MBNL1 | muscleblind like splicing regulator 1 | 2 | 2 | ||||||||
MIRT704515 | COL4A1 | collagen type IV alpha 1 chain | 2 | 2 | ||||||||
MIRT710184 | DYRK3 | dual specificity tyrosine phosphorylation regulated kinase 3 | 2 | 2 | ||||||||
MIRT712036 | TRIP13 | thyroid hormone receptor interactor 13 | 2 | 2 | ||||||||
MIRT716586 | BRAP | BRCA1 associated protein | 2 | 2 | ||||||||
MIRT724189 | MMP16 | matrix metallopeptidase 16 | 2 | 2 | ||||||||
MIRT724205 | MED7 | mediator complex subunit 7 | 2 | 2 |
miRNA-Drug Associations | ||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|