pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-497 |
Genomic Coordinates | chr17: 7017911 - 7018022 |
Synonyms | MIRN497, hsa-mir-497, MIR497 |
Description | Homo sapiens miR-497 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Associated Diseases | ![]() |
Mature miRNA Information | |||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-497-3p | ||||||||||||||||||||||||||||
Sequence | 64| CAAACCACACUGUGGUGUUAGA |85 | ||||||||||||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||||||||||||
Experiments | Cloned | ||||||||||||||||||||||||||||
Editing Events in miRNAs |
|
||||||||||||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | CEP76 | ||||||||||||||||||||
Synonyms | C18orf9, HsT1705 | ||||||||||||||||||||
Description | centrosomal protein 76 | ||||||||||||||||||||
Transcript | NM_024899 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on CEP76 | |||||||||||||||||||||
3'UTR of CEP76 (miRNA target sites are highlighted) |
>CEP76|NM_024899|3'UTR 1 GGCCAATATTTATATAAGATTTATACCTGTGTTTAATTGGAATTTTACACATTGTACATTACTTAGCTATTTAGAGGTTT 81 GTTATTTTAAAATCACAATCTGGCTTGAATGGCATACTTCAATTTTGTATATACTTGACTGGTAATGTTTAAAAAAAATC 161 ATGCATTCCTTTAAAAATTAAGGCTGAAAAACTTGTATAAATCTCCCTGGAATTTAGTATAAATTAAGTGTATATTCTAT 241 TTTAATAAATGCTACTTTGTTTACAGTTATCAGTAGTTTAAATATTAATATAAAATGCATTCAGTTTTCTTTACACAAAC 321 AGGTAATCAAAGAGATGTTTGTCTAAGGGTTTGAGCCCTAGACAAATCAGTATGATCATTACTTTTCACAGGTTAATGGA 401 ATTATTTTATACAGATTAGGAGAAATTAACCTCATGACAGATTTATTTATTGCATTGGTGAAAATAAATGTTAATGAATT 481 ACCACTTTTGTGGTTTATTCGTGGTCCTTGGGATATTTGAGACTGTCCAGAAATTTATGGTTGGACCTTGAAGCAAGAGT 561 AGGAAAAAACTAATACCAGAAAAGCATAAATATTAATAACCTCATATGAAAGTACATGAATCATTTAGAAATATTTATCA 641 CTGTGATTTGTTGTAAAAATGAATTGGGTATTTTAGAAAAACTTTATTATACCTCTTTGTTATGATACTGATAAATTGTG 721 ATCTTGCAGTCGATCACT Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Disease | 79959.0 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
CLIP-seq Support 1 for dataset GSM1065667 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_6 |
Location of target site | ENST00000262127.2 | 3UTR | UUUAUGCCUGUAAUCCCA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23446348 / GSE43573 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
95 hsa-miR-497-3p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT092955 | CYP2U1 | cytochrome P450 family 2 subfamily U member 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT124568 | PRRC2B | proline rich coiled-coil 2B | ![]() |
![]() |
2 | 2 | ||||||
MIRT125196 | EIF1AX | eukaryotic translation initiation factor 1A, X-linked | ![]() |
![]() |
2 | 4 | ||||||
MIRT147296 | KPNA2 | karyopherin subunit alpha 2 | ![]() |
![]() |
2 | 8 | ||||||
MIRT163999 | KIAA1109 | KIAA1109 | ![]() |
![]() |
2 | 4 | ||||||
MIRT252495 | NWD1 | NACHT and WD repeat domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT357969 | GRPEL2 | GrpE like 2, mitochondrial | ![]() |
![]() |
2 | 2 | ||||||
MIRT443007 | TRIOBP | TRIO and F-actin binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT443524 | NETO1 | neuropilin and tolloid like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT443573 | EVX2 | even-skipped homeobox 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT443656 | BACH1 | BTB domain and CNC homolog 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT460670 | KRT10 | keratin 10 | ![]() |
![]() |
2 | 8 | ||||||
MIRT464761 | UBE2N | ubiquitin conjugating enzyme E2 N | ![]() |
![]() |
2 | 2 | ||||||
MIRT465032 | LINC00598 | long intergenic non-protein coding RNA 598 | ![]() |
![]() |
2 | 2 | ||||||
MIRT465040 | TTC39C | tetratricopeptide repeat domain 39C | ![]() |
![]() |
2 | 2 | ||||||
MIRT468667 | SEC62 | SEC62 homolog, preprotein translocation factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT473694 | MAPK8 | mitogen-activated protein kinase 8 | ![]() |
![]() |
2 | 4 | ||||||
MIRT477618 | EFNA3 | ephrin A3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT480506 | C11orf57 | chromosome 11 open reading frame 57 | ![]() |
![]() |
2 | 2 | ||||||
MIRT480592 | BUB3 | BUB3, mitotic checkpoint protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT486915 | ZNF398 | zinc finger protein 398 | ![]() |
![]() |
2 | 6 | ||||||
MIRT487770 | ANKEF1 | ankyrin repeat and EF-hand domain containing 1 | ![]() |
![]() |
2 | 16 | ||||||
MIRT493265 | MDFIC | MyoD family inhibitor domain containing | ![]() |
![]() |
2 | 2 | ||||||
MIRT495271 | SLC1A2 | solute carrier family 1 member 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT495309 | CHST12 | carbohydrate sulfotransferase 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT496681 | DPP6 | dipeptidyl peptidase like 6 | ![]() |
![]() |
2 | 4 | ||||||
MIRT496891 | FOXP1 | forkhead box P1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT497330 | IRF4 | interferon regulatory factor 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT498272 | KIAA1644 | KIAA1644 | ![]() |
![]() |
2 | 2 | ||||||
MIRT498634 | CHD4 | chromodomain helicase DNA binding protein 4 | ![]() |
![]() |
2 | 10 | ||||||
MIRT500581 | USP53 | ubiquitin specific peptidase 53 | ![]() |
![]() |
2 | 2 | ||||||
MIRT500751 | TMPPE | transmembrane protein with metallophosphoesterase domain | ![]() |
![]() |
2 | 6 | ||||||
MIRT509668 | ZNF354B | zinc finger protein 354B | ![]() |
![]() |
2 | 10 | ||||||
MIRT510919 | PSMA2 | proteasome subunit alpha 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT519118 | CEP76 | centrosomal protein 76 | ![]() |
![]() |
2 | 2 | ||||||
MIRT526193 | ABCG2 | ATP binding cassette subfamily G member 2 (Junior blood group) | ![]() |
![]() |
2 | 2 | ||||||
MIRT526746 | HLA-DOB | major histocompatibility complex, class II, DO beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT527270 | FBLN2 | fibulin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT528198 | PLEKHM2 | pleckstrin homology and RUN domain containing M2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT528330 | TBC1D22B | TBC1 domain family member 22B | ![]() |
![]() |
2 | 2 | ||||||
MIRT530346 | GABRB3 | gamma-aminobutyric acid type A receptor beta3 subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT533627 | TMX3 | thioredoxin related transmembrane protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT533738 | TMEM200C | transmembrane protein 200C | ![]() |
![]() |
2 | 2 | ||||||
MIRT533779 | TMEM133 | transmembrane protein 133 | ![]() |
![]() |
2 | 2 | ||||||
MIRT534317 | SKIDA1 | SKI/DACH domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT538438 | COG5 | component of oligomeric golgi complex 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT539156 | AREL1 | apoptosis resistant E3 ubiquitin protein ligase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT539474 | ADARB2 | adenosine deaminase, RNA specific B2 (inactive) | ![]() |
![]() |
2 | 2 | ||||||
MIRT539620 | SHISA9 | shisa family member 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT539650 | BUB1 | BUB1 mitotic checkpoint serine/threonine kinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT540346 | OPHN1 | oligophrenin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT540412 | PITPNC1 | phosphatidylinositol transfer protein, cytoplasmic 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT541200 | HSP90AA1 | heat shock protein 90 alpha family class A member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT541395 | CDC27 | cell division cycle 27 | ![]() |
![]() |
2 | 2 | ||||||
MIRT546443 | SNX5 | sorting nexin 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT547369 | MSI2 | musashi RNA binding protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT553288 | TSPAN3 | tetraspanin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT554402 | SERP1 | stress associated endoplasmic reticulum protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT557822 | FOXN2 | forkhead box N2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT568530 | ANP32E | acidic nuclear phosphoprotein 32 family member E | ![]() |
![]() |
2 | 2 | ||||||
MIRT569508 | THYN1 | thymocyte nuclear protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT570707 | FAM69A | family with sequence similarity 69 member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT608376 | PIWIL2 | piwi like RNA-mediated gene silencing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT608483 | NKTR | natural killer cell triggering receptor | ![]() |
![]() |
2 | 6 | ||||||
MIRT613533 | TRA2B | transformer 2 beta homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT616601 | ELP2 | elongator acetyltransferase complex subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT618166 | DUSP18 | dual specificity phosphatase 18 | ![]() |
![]() |
2 | 2 | ||||||
MIRT632059 | CEP135 | centrosomal protein 135 | ![]() |
![]() |
2 | 2 | ||||||
MIRT647379 | ZDHHC23 | zinc finger DHHC-type containing 23 | ![]() |
![]() |
2 | 2 | ||||||
MIRT648366 | POTED | POTE ankyrin domain family member D | ![]() |
![]() |
2 | 2 | ||||||
MIRT651075 | ZNF518B | zinc finger protein 518B | ![]() |
![]() |
2 | 4 | ||||||
MIRT653618 | SLC30A4 | solute carrier family 30 member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT653636 | SLC30A1 | solute carrier family 30 member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT654895 | POU2F1 | POU class 2 homeobox 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT656232 | MFSD6 | major facilitator superfamily domain containing 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT659880 | CAPRIN1 | cell cycle associated protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT660526 | ARL4C | ADP ribosylation factor like GTPase 4C | ![]() |
![]() |
2 | 2 | ||||||
MIRT666286 | SLC30A3 | solute carrier family 30 member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT686808 | SNX2 | sorting nexin 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT695302 | TK1 | thymidine kinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT699737 | SERINC3 | serine incorporator 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT700794 | PIAS2 | protein inhibitor of activated STAT 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT712270 | PPP1CB | protein phosphatase 1 catalytic subunit beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT712617 | KNSTRN | kinetochore localized astrin/SPAG5 binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT714264 | RPL10A | ribosomal protein L10a | ![]() |
![]() |
2 | 2 | ||||||
MIRT715072 | TMTC1 | transmembrane and tetratricopeptide repeat containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT715386 | TADA3 | transcriptional adaptor 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT716397 | NPAS1 | neuronal PAS domain protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT725328 | NFASC | neurofascin | ![]() |
![]() |
2 | 2 | ||||||
MIRT725503 | GANAB | glucosidase II alpha subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT732913 | IRAK2 | interleukin 1 receptor associated kinase 2 | ![]() |
![]() |
![]() |
3 | 0 | |||||
MIRT734890 | SMAD3 | SMAD family member 3 | ![]() |
![]() |
![]() |
3 | 0 | |||||
MIRT737328 | LINC02476 | long intergenic non-protein coding RNA 2476 | ![]() |
![]() |
![]() |
3 | 0 | |||||
MIRT737544 | MALAT1 | metastasis associated lung adenocarcinoma transcript 1 (non-protein coding) | ![]() |
![]() |
![]() |
![]() |
4 | 0 | ||||
MIRT755545 | PAK1 | p21 (RAC1) activated kinase 1 | 3 | 1 |
miRNA-Drug Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|