miRTarBase - #MIRT520463


—
pre-miRNA Information
pre-miRNA hsa-mir-3194   
Genomic Coordinates chr20: 51452905 - 51452977
Description Homo sapiens miR-3194 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3194-5p
Sequence 10| GGCCAGCCACCAGGAGGGCUG |30
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1344875175 4 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TRPV2   
Synonyms VRL, VRL-1, VRL1
Description transient receptor potential cation channel subfamily V member 2
Transcript NM_016113   
Expression
Putative miRNA Targets on TRPV2
3'UTR of TRPV2
(miRNA target sites are highlighted)		 
>TRPV2|NM_016113|3'UTR
   1 TGGCCCAGATGCAGCAGGAGGCCAGAGGACAGAGCAGAGGATCTTTCCAACCACATCTGCTGGCTCTGGGGTCCCAGTGA
  81 ATTCTGGTGGCAAATATATATTTTCACTAACTAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gucgggaggaccacCGACCGg 5'
                        |||||| 
Target 5' ttccaaccacatctGCTGGCt 3'
 45 - 65 120.00 -14.50
2 
miRNA  3' gucgggaggaccACCGACCGg 5'
                      ||| |||| 
Target 5' cccagtgaattcTGG-TGGCa 3'
 73 - 92 93.00 -19.12
3 
miRNA  3' gucgggaggaccaccgACCGg 5'
                          |||| 
Target 5' ----------------TGGCc 3'
 1 - 5 80.00 -9.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30539631 23 COSMIC
COSN28726597 91 COSMIC
COSN6653232 114 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1238784831 4 dbSNP
rs529500225 11 dbSNP
rs767154927 13 dbSNP
rs752453301 14 dbSNP
rs755555835 17 dbSNP
rs1483647419 18 dbSNP
rs1459992564 22 dbSNP
rs777379985 22 dbSNP
rs750854811 29 dbSNP
rs1418651615 35 dbSNP
rs1158161494 36 dbSNP
rs1412509166 38 dbSNP
rs542808221 39 dbSNP
rs909632553 40 dbSNP
rs937114354 51 dbSNP
rs1358459694 52 dbSNP
rs1240964687 64 dbSNP
rs376388597 65 dbSNP
rs1037978797 68 dbSNP
rs1205803618 71 dbSNP
rs1438769987 72 dbSNP
rs1275669660 84 dbSNP
rs1055450489 96 dbSNP
rs895373032 106 dbSNP
rs1292568306 107 dbSNP
rs1248347642 108 dbSNP
rs7214366 114 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 51393.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gucgggaggaccaccgACCGg 5'
                          |||: 
Target 5' ----------ccgacaUGGUg 3'
 		1 - 11
Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000338560.7 | 3UTR | CCGACAUGGUGAAACCCCAUCUCUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
CHOL -0.998 0.02 -1.000 0.5 3 Click to see details
LIHC -0.393 0.03 -0.145 0.25 23 Click to see details
KICH 0.818 0.05 0.800 0.05 5 Click to see details
LUSC -0.657 0.11 -0.700 0.09 5 Click to see details
HNSC 0.704 0.15 0.800 0.1 4 Click to see details
BRCA -0.398 0.16 -0.452 0.13 8 Click to see details
KIRC -0.657 0.17 -0.600 0.2 4 Click to see details
UCEC -0.458 0.22 -0.600 0.14 5 Click to see details
THCA 0.139 0.27 0.197 0.19 22 Click to see details
KIRP 0.382 0.31 0.400 0.3 4 Click to see details
STAD 0.15 0.34 0.224 0.27 10 Click to see details
PRAD 0.018 0.49 0.400 0.3 4 Click to see details
PRAD 0.018 0.49 0.400 0.3 4 Click to see details
PRAD 0.018 0.49 0.400 0.3 4 Click to see details
72 hsa-miR-3194-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT443250 C9orf170 chromosome 9 open reading frame 170 2 2
MIRT443284 ZC3H12A zinc finger CCCH-type containing 12A 2 2
MIRT461518 EMC7 ER membrane protein complex subunit 7 2 2
MIRT466738 SYNJ2BP synaptojanin 2 binding protein 2 2
MIRT467651 SLC7A1 solute carrier family 7 member 1 2 2
MIRT472998 MRPS23 mitochondrial ribosomal protein S23 2 4
MIRT477911 DUSP2 dual specificity phosphatase 2 2 2
MIRT480853 BLCAP bladder cancer associated protein 2 2
MIRT482890 IAH1 isoamyl acetate-hydrolyzing esterase 1 homolog 2 4
MIRT487295 SLC38A9 solute carrier family 38 member 9 2 2
MIRT488494 SFMBT2 Scm like with four mbt domains 2 2 4
MIRT489060 STARD3 StAR related lipid transfer domain containing 3 2 2
MIRT491209 MLLT1 MLLT1, super elongation complex subunit 2 4
MIRT491479 APC2 APC2, WNT signaling pathway regulator 2 8
MIRT492558 PRX periaxin 2 6
MIRT495499 SLC39A2 solute carrier family 39 member 2 2 2
MIRT496578 ZNF280D zinc finger protein 280D 2 2
MIRT496840 KCNIP2 potassium voltage-gated channel interacting protein 2 2 2
MIRT497840 CHD1 chromodomain helicase DNA binding protein 1 2 2
MIRT499396 PLCG2 phospholipase C gamma 2 2 7
MIRT503237 C16orf74 chromosome 16 open reading frame 74 2 4
MIRT512345 ZNF665 zinc finger protein 665 2 4
MIRT512527 ATCAY ATCAY, caytaxin 2 4
MIRT513160 PPIB peptidylprolyl isomerase B 2 2
MIRT514493 STOML1 stomatin like 1 2 2
MIRT517164 SLC28A1 solute carrier family 28 member 1 2 2
MIRT520463 TRPV2 transient receptor potential cation channel subfamily V member 2 2 2
MIRT524151 DIP2A disco interacting protein 2 homolog A 2 2
MIRT530324 TNFRSF10D TNF receptor superfamily member 10d 2 2
MIRT533747 TMEM184B transmembrane protein 184B 2 2
MIRT534259 SLC12A7 solute carrier family 12 member 7 2 2
MIRT561273 ZDHHC18 zinc finger DHHC-type containing 18 2 2
MIRT569126 TMC5 transmembrane channel like 5 2 4
MIRT569937 RAB8A RAB8A, member RAS oncogene family 2 2
MIRT570073 VPS8 VPS8, CORVET complex subunit 2 2
MIRT570636 KLF13 Kruppel like factor 13 2 2
MIRT571026 CENPP centromere protein P 2 2
MIRT573838 ZWINT ZW10 interacting kinetochore protein 2 2
MIRT574899 Plcg2 phospholipase C, gamma 2 2 5
MIRT576070 Poteg POTE ankyrin domain family, member G 2 2
MIRT576753 Tmem127 transmembrane protein 127 2 2
MIRT611795 WNT9A Wnt family member 9A 2 2
MIRT616756 SVOP SV2 related protein 2 2
MIRT630965 NGDN neuroguidin 2 2
MIRT634555 LYVE1 lymphatic vessel endothelial hyaluronan receptor 1 2 2
MIRT638646 GK5 glycerol kinase 5 (putative) 2 2
MIRT639903 SRGAP2 SLIT-ROBO Rho GTPase activating protein 2 2 2
MIRT640529 TET3 tet methylcytosine dioxygenase 3 2 4
MIRT644529 TMEM134 transmembrane protein 134 2 2
MIRT644887 C2orf50 chromosome 2 open reading frame 50 2 2
MIRT647729 CXCR2 C-X-C motif chemokine receptor 2 2 2
MIRT648086 FAM192A family with sequence similarity 192 member A 2 2
MIRT650808 PGRMC1 progesterone receptor membrane component 1 2 2
MIRT660505 ARPC2 actin related protein 2/3 complex subunit 2 2 2
MIRT667193 NODAL nodal growth differentiation factor 2 2
MIRT685675 PSMB7 proteasome subunit beta 7 2 2
MIRT692710 MEAF6 MYST/Esa1 associated factor 6 2 2
MIRT693598 SLC39A1 solute carrier family 39 member 1 2 2
MIRT698059 TRIOBP TRIO and F-actin binding protein 2 2
MIRT698292 TMEM2 transmembrane protein 2 2 2
MIRT702353 KLHL26 kelch like family member 26 2 2
MIRT708623 NUDT18 nudix hydrolase 18 2 2
MIRT714289 KBTBD11 kelch repeat and BTB domain containing 11 2 2
MIRT714577 WDR41 WD repeat domain 41 2 2
MIRT716734 APOL6 apolipoprotein L6 2 2
MIRT718781 RAC3 Rac family small GTPase 3 2 2
MIRT720973 ZBTB43 zinc finger and BTB domain containing 43 2 2
MIRT720986 TOM1 target of myb1 membrane trafficking protein 2 2
MIRT721391 LDLRAD4 low density lipoprotein receptor class A domain containing 4 2 2
MIRT722905 COA4 cytochrome c oxidase assembly factor 4 homolog 2 2
MIRT723205 ZNRF1 zinc and ring finger 1 2 2
MIRT725431 HIVEP3 human immunodeficiency virus type I enhancer binding protein 3 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-3194 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-3194 Cisplatin 5460033 NSC119875 approved sensitive cell line (W1)
hsa-mir-3194 Doxorubicin 31703 NSC123127 approved sensitive cell line (W1)
hsa-mir-3194 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-3194-5p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-3194-5p Fluorouracil 3385 NSC19893 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-3194-5p Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-3194-5p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-3194-5p Cisplatin 5460033 NSC119875 approved resistant Low Hepatocellular Carcinoma cell line (HepG2)
hsa-miR-3194-5p Temozolomide 5394 NSC362856 approved resistant High Glioblastoma cell line (A172)
hsa-miR-3194-5p Estradiol 5757 NSC9895 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-3194-5p Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-3194-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-3194-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (451Lu)
hsa-miR-3194-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-3194-5p Osimertinib 71496458 NSC779217 approved resistant cell line (H1975)
hsa-miR-3194-5p Platinum 23939 resistant tissue
hsa-miR-3194-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-3194-5p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-3194-5p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)
hsa-miR-3194-5p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-3194-5p Cisplatin 5460033 NSC119875 approved resistant cell line (MDAH-2774)
hsa-miR-3194-5p Cisplatin 5460033 NSC119875 approved resistant cell line (TOV-112D)
hsa-miR-3194-5p Cisplatin 5460033 NSC119875 approved resistant cell line (OVSAHO)

Error report submission