pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-6751 |
Genomic Coordinates | chr11: 65129916 - 65129978 |
Description | Homo sapiens miR-6751 stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | |||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-6751-3p | ||||||||||||||||||||||||||||||
Sequence | 43| ACUGAGCCUCUCUCUCUCCAG |63 | ||||||||||||||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||||||||||||||
Experiments | Meta-analysis | DRVs in miRNA |
|
||||||||||||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | TCF23 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonyms | OUT, TCF-23, bHLHa24 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Description | transcription factor 23 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Transcript | NM_175769 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative miRNA Targets on TCF23 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3'UTR of TCF23 (miRNA target sites are highlighted) |
>TCF23|NM_175769|3'UTR 1 TTATCACACTCGCCCTTTTCTCCTAGACTGTGACTCATGCTTATGGGCCTGGATTTTCTACCAGCCCCCAGATTCTCAGC 81 CATC Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
DRVs in gene 3'UTRs |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SNPs in gene 3'UTRs |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293 | ||||||
Disease | 150921.0 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
CLIP-seq Support 1 for dataset GSM1065667 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_6 |
Location of target site | ENST00000296096.5 | 3UTR | CCAGGCUCAGUGGCUCAU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23446348 / GSE43573 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
77 hsa-miR-6751-3p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT130738 | GATAD2B | GATA zinc finger domain containing 2B | 2 | 4 | ||||||||
MIRT134924 | CCND2 | cyclin D2 | 2 | 2 | ||||||||
MIRT273034 | ZBTB18 | zinc finger and BTB domain containing 18 | 2 | 2 | ||||||||
MIRT276645 | KPNA3 | karyopherin subunit alpha 3 | 2 | 6 | ||||||||
MIRT446531 | OAS2 | 2'-5'-oligoadenylate synthetase 2 | 2 | 2 | ||||||||
MIRT456268 | TDRKH | tudor and KH domain containing | 2 | 12 | ||||||||
MIRT494454 | BTG2 | BTG anti-proliferation factor 2 | 2 | 2 | ||||||||
MIRT494965 | USP46 | ubiquitin specific peptidase 46 | 2 | 2 | ||||||||
MIRT496689 | KREMEN1 | kringle containing transmembrane protein 1 | 2 | 2 | ||||||||
MIRT496697 | RGS11 | regulator of G protein signaling 11 | 2 | 2 | ||||||||
MIRT504376 | IRF4 | interferon regulatory factor 4 | 2 | 6 | ||||||||
MIRT510980 | PFN2 | profilin 2 | 2 | 6 | ||||||||
MIRT512548 | MFN2 | mitofusin 2 | 2 | 6 | ||||||||
MIRT513639 | TP53INP2 | tumor protein p53 inducible nuclear protein 2 | 2 | 2 | ||||||||
MIRT514016 | CAMSAP1 | calmodulin regulated spectrin associated protein 1 | 2 | 4 | ||||||||
MIRT514074 | MTRNR2L6 | MT-RNR2-like 6 | 2 | 2 | ||||||||
MIRT515300 | C15orf38-AP3S2 | C15orf38-AP3S2 readthrough | 2 | 4 | ||||||||
MIRT517285 | AP3S2 | adaptor related protein complex 3 sigma 2 subunit | 2 | 4 | ||||||||
MIRT519075 | KCNK6 | potassium two pore domain channel subfamily K member 6 | 2 | 2 | ||||||||
MIRT520779 | TCF23 | transcription factor 23 | 2 | 2 | ||||||||
MIRT522485 | MFSD9 | major facilitator superfamily domain containing 9 | 2 | 2 | ||||||||
MIRT528856 | PKP1 | plakophilin 1 | 2 | 2 | ||||||||
MIRT529081 | PATE2 | prostate and testis expressed 2 | 2 | 2 | ||||||||
MIRT531209 | PLA2G4D | phospholipase A2 group IVD | 2 | 2 | ||||||||
MIRT533988 | TAB3 | TGF-beta activated kinase 1 and MAP3K7 binding protein 3 | 2 | 2 | ||||||||
MIRT537024 | GRIN2B | glutamate ionotropic receptor NMDA type subunit 2B | 2 | 2 | ||||||||
MIRT537498 | FAM168B | family with sequence similarity 168 member B | 2 | 2 | ||||||||
MIRT553125 | UBE2Z | ubiquitin conjugating enzyme E2 Z | 2 | 2 | ||||||||
MIRT555591 | PIP5K1C | phosphatidylinositol-4-phosphate 5-kinase type 1 gamma | 2 | 2 | ||||||||
MIRT556370 | LUZP1 | leucine zipper protein 1 | 2 | 2 | ||||||||
MIRT569745 | C2orf71 | chromosome 2 open reading frame 71 | 2 | 2 | ||||||||
MIRT570149 | DNAJC10 | DnaJ heat shock protein family (Hsp40) member C10 | 2 | 2 | ||||||||
MIRT571243 | FADS6 | fatty acid desaturase 6 | 2 | 2 | ||||||||
MIRT573065 | TRIB1 | tribbles pseudokinase 1 | 2 | 2 | ||||||||
MIRT575533 | Map4 | microtubule-associated protein 4 | 2 | 2 | ||||||||
MIRT575777 | Tnfrsf10b | tumor necrosis factor receptor superfamily, member 10b | 2 | 2 | ||||||||
MIRT616558 | ZNF512B | zinc finger protein 512B | 2 | 2 | ||||||||
MIRT624851 | ABI2 | abl interactor 2 | 2 | 2 | ||||||||
MIRT630078 | GRWD1 | glutamate rich WD repeat containing 1 | 2 | 2 | ||||||||
MIRT631479 | KLHL21 | kelch like family member 21 | 2 | 2 | ||||||||
MIRT632173 | CCL22 | C-C motif chemokine ligand 22 | 2 | 2 | ||||||||
MIRT638397 | QSOX2 | quiescin sulfhydryl oxidase 2 | 2 | 4 | ||||||||
MIRT641192 | ISG20L2 | interferon stimulated exonuclease gene 20 like 2 | 2 | 2 | ||||||||
MIRT642562 | TEX9 | testis expressed 9 | 2 | 2 | ||||||||
MIRT642935 | KRTAP5-9 | keratin associated protein 5-9 | 2 | 2 | ||||||||
MIRT649703 | ZNF175 | zinc finger protein 175 | 2 | 2 | ||||||||
MIRT650437 | CPXM2 | carboxypeptidase X, M14 family member 2 | 2 | 2 | ||||||||
MIRT652113 | TRUB2 | TruB pseudouridine synthase family member 2 | 2 | 2 | ||||||||
MIRT652273 | TOMM20 | translocase of outer mitochondrial membrane 20 | 2 | 2 | ||||||||
MIRT655215 | PFKM | phosphofructokinase, muscle | 2 | 2 | ||||||||
MIRT682778 | ZNF852 | zinc finger protein 852 | 2 | 2 | ||||||||
MIRT683001 | MUC20 | mucin 20, cell surface associated | 2 | 2 | ||||||||
MIRT684320 | GTF3C4 | general transcription factor IIIC subunit 4 | 2 | 2 | ||||||||
MIRT689435 | CYB561 | cytochrome b561 | 2 | 2 | ||||||||
MIRT693847 | ZNF107 | zinc finger protein 107 | 2 | 2 | ||||||||
MIRT696715 | TAX1BP3 | Tax1 binding protein 3 | 2 | 2 | ||||||||
MIRT698597 | TEX261 | testis expressed 261 | 2 | 2 | ||||||||
MIRT699973 | RREB1 | ras responsive element binding protein 1 | 2 | 2 | ||||||||
MIRT703310 | GFPT1 | glutamine--fructose-6-phosphate transaminase 1 | 2 | 2 | ||||||||
MIRT706796 | RAI1 | retinoic acid induced 1 | 2 | 2 | ||||||||
MIRT709004 | CD109 | CD109 molecule | 2 | 2 | ||||||||
MIRT709181 | TBC1D10B | TBC1 domain family member 10B | 2 | 2 | ||||||||
MIRT709835 | PAQR7 | progestin and adipoQ receptor family member 7 | 2 | 2 | ||||||||
MIRT711627 | CORO1C | coronin 1C | 2 | 2 | ||||||||
MIRT712634 | RNF103-CHMP3 | RNF103-CHMP3 readthrough | 2 | 2 | ||||||||
MIRT713694 | CYB5R4 | cytochrome b5 reductase 4 | 2 | 2 | ||||||||
MIRT713752 | SLC9A8 | solute carrier family 9 member A8 | 2 | 2 | ||||||||
MIRT714908 | CHMP3 | charged multivesicular body protein 3 | 2 | 2 | ||||||||
MIRT716371 | CBLL1 | Cbl proto-oncogene like 1 | 2 | 2 | ||||||||
MIRT718303 | XPOT | exportin for tRNA | 2 | 2 | ||||||||
MIRT718713 | ANKRD18A | ankyrin repeat domain 18A | 2 | 2 | ||||||||
MIRT718740 | ATP9A | ATPase phospholipid transporting 9A (putative) | 2 | 2 | ||||||||
MIRT719441 | NPTX2 | neuronal pentraxin 2 | 2 | 2 | ||||||||
MIRT720896 | OTUD4 | OTU deubiquitinase 4 | 2 | 2 | ||||||||
MIRT722448 | RXFP4 | relaxin/insulin like family peptide receptor 4 | 2 | 2 | ||||||||
MIRT723882 | VKORC1 | vitamin K epoxide reductase complex subunit 1 | 2 | 2 | ||||||||
MIRT724586 | SYNJ2BP | synaptojanin 2 binding protein | 2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|