miRTarBase - #MIRT521359


—
pre-miRNA Information
pre-miRNA hsa-mir-4433a   
Genomic Coordinates chr2: 64340759 - 64340839
Description Homo sapiens miR-4433a stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4433a-3p
Sequence 51| ACAGGAGUGGGGGUGGGACAU |71
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs751480515 9 dbSNP
rs557760377 15 dbSNP
rs1479580865 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RPL35A   
Synonyms DBA5, L35A
Description ribosomal protein L35a
Transcript NM_000996   
Expression
Putative miRNA Targets on RPL35A
3'UTR of RPL35A
(miRNA target sites are highlighted)		 
>RPL35A|NM_000996|3'UTR
   1 ACTAACGAAAAATCAATAAATAAATGTGGATTTGTGCTCTTGTATTTTTAAGTGGATTAAAAAACTTACTACCTTAAAAA
  81 AAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uacagggUGGGGGUGAGGACa 5'
                 |::: ::|||:|| 
Target 5' aatgtggATTTGTGCTCTTGt 3'
 23 - 43 114.00 -10.80
2 
miRNA  3' uacaggguggGGGUGA-GGAca 5'
                    |::||| |||  
Target 5' gattaaaaaaCTTACTACCTta 3'
 55 - 76 95.00 -7.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
344530 7 ClinVar
344531 15 ClinVar
901558 22 ClinVar
1204119 136 ClinVar
COSN30503616 7 COSMIC
COSN30120764 8 COSMIC
COSN30111911 12 COSMIC
COSN30184941 17 COSMIC
COSN30486070 74 COSMIC
COSN6761257 119 COSMIC
COSN6761258 131 COSMIC
COSN15719432 162 COSMIC
COSN31778329 227 COSMIC
COSN15987951 333 COSMIC
COSN9543888 528 COSMIC
COSN25927246 760 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs752237864 3 dbSNP
rs116874993 7 dbSNP
rs374865201 8 dbSNP
rs779211931 9 dbSNP
rs1445818273 10 dbSNP
rs746218672 13 dbSNP
rs1372272453 14 dbSNP
rs10022 15 dbSNP
rs1479445154 15 dbSNP
rs1231965333 18 dbSNP
rs370749472 19 dbSNP
rs747121376 21 dbSNP
rs199693579 22 dbSNP
rs748252532 28 dbSNP
rs1312324045 39 dbSNP
rs770048224 42 dbSNP
rs1230514995 43 dbSNP
rs750296895 45 dbSNP
rs1293965407 47 dbSNP
rs897245037 49 dbSNP
rs561776924 53 dbSNP
rs1360123404 59 dbSNP
rs1314608189 68 dbSNP
rs1221922908 69 dbSNP
rs1232138707 70 dbSNP
rs1298991946 74 dbSNP
rs758372835 87 dbSNP
rs1279959579 90 dbSNP
rs1354664766 91 dbSNP
rs1302671492 97 dbSNP
rs1425838067 103 dbSNP
rs1370757336 112 dbSNP
rs1218531388 120 dbSNP
rs1258672897 129 dbSNP
rs1418869575 131 dbSNP
rs146539160 136 dbSNP
rs1210311161 139 dbSNP
rs1266112625 141 dbSNP
rs1269351830 145 dbSNP
rs561846298 149 dbSNP
rs541949307 159 dbSNP
rs890983448 167 dbSNP
rs982499988 170 dbSNP
rs767511885 171 dbSNP
rs140946061 184 dbSNP
rs1230427816 185 dbSNP
rs199712455 194 dbSNP
rs527646072 195 dbSNP
rs980628120 203 dbSNP
rs1453467869 205 dbSNP
rs1031135729 206 dbSNP
rs1346139429 206 dbSNP
rs1294669516 207 dbSNP
rs1161881389 208 dbSNP
rs956499972 211 dbSNP
rs939272243 218 dbSNP
rs1197998038 222 dbSNP
rs1302682581 230 dbSNP
rs992339949 231 dbSNP
rs746855539 233 dbSNP
rs913881293 238 dbSNP
rs1210415806 240 dbSNP
rs545795129 240 dbSNP
rs950230327 241 dbSNP
rs749909017 243 dbSNP
rs1262753264 251 dbSNP
rs1234012098 257 dbSNP
rs79291783 261 dbSNP
rs150372679 262 dbSNP
rs1382128635 264 dbSNP
rs1363354495 269 dbSNP
rs927532278 278 dbSNP
rs1468581553 284 dbSNP
rs1403364065 286 dbSNP
rs941323527 292 dbSNP
rs1038386491 295 dbSNP
rs541919264 297 dbSNP
rs930058369 303 dbSNP
rs550333013 305 dbSNP
rs890952619 316 dbSNP
rs1427833551 317 dbSNP
rs1006720739 322 dbSNP
rs1190191607 333 dbSNP
rs1238184015 335 dbSNP
rs1458830232 337 dbSNP
rs997754345 345 dbSNP
rs1039558860 351 dbSNP
rs1347454716 353 dbSNP
rs1249688338 359 dbSNP
rs903778777 367 dbSNP
rs886740862 368 dbSNP
rs183272907 375 dbSNP
rs1030646290 387 dbSNP
rs956599664 390 dbSNP
rs529531482 392 dbSNP
rs80279119 395 dbSNP
rs971515860 407 dbSNP
rs1461045545 412 dbSNP
rs563730794 420 dbSNP
rs1325347032 423 dbSNP
rs1401066617 427 dbSNP
rs980272841 429 dbSNP
rs111904268 435 dbSNP
rs147082881 435 dbSNP
rs1384350704 439 dbSNP
rs1188083760 441 dbSNP
rs138103972 457 dbSNP
rs539395358 458 dbSNP
rs77209520 460 dbSNP
rs1276919690 461 dbSNP
rs189224941 463 dbSNP
rs1232550928 475 dbSNP
rs112984889 478 dbSNP
rs1341821279 480 dbSNP
rs925399762 482 dbSNP
rs943448244 485 dbSNP
rs369888816 494 dbSNP
rs548803550 498 dbSNP
rs771499183 507 dbSNP
rs536981691 511 dbSNP
rs1182806491 513 dbSNP
rs1259995081 519 dbSNP
rs1163569333 525 dbSNP
rs1473660297 529 dbSNP
rs1047937497 530 dbSNP
rs555517793 532 dbSNP
rs149508637 538 dbSNP
rs1254060020 539 dbSNP
rs1220422836 545 dbSNP
rs1490313064 557 dbSNP
rs759920406 564 dbSNP
rs903707086 570 dbSNP
rs1349010976 577 dbSNP
rs1016599615 580 dbSNP
rs1227365982 584 dbSNP
rs1402577896 587 dbSNP
rs540842558 587 dbSNP
rs1349168572 588 dbSNP
rs1001938504 598 dbSNP
rs1052812801 599 dbSNP
rs1406832494 606 dbSNP
rs553802279 609 dbSNP
rs892127954 624 dbSNP
rs1158230562 625 dbSNP
rs1013260367 629 dbSNP
rs960529242 632 dbSNP
rs1013833684 644 dbSNP
rs1354180436 646 dbSNP
rs1448947006 654 dbSNP
rs1020859312 658 dbSNP
rs1314526369 661 dbSNP
rs556667288 663 dbSNP
rs1413908597 671 dbSNP
rs75634012 674 dbSNP
rs925263216 675 dbSNP
rs1329350487 676 dbSNP
rs1269636533 679 dbSNP
rs1212304356 684 dbSNP
rs969139282 689 dbSNP
rs1366321417 690 dbSNP
rs1274980304 691 dbSNP
rs1001681048 693 dbSNP
rs1271593471 695 dbSNP
rs1312439914 696 dbSNP
rs1438515021 705 dbSNP
rs1034506657 706 dbSNP
rs1324671865 709 dbSNP
rs192899658 711 dbSNP
rs185398926 712 dbSNP
rs923437738 723 dbSNP
rs1414167924 728 dbSNP
rs576848503 729 dbSNP
rs1425924299 739 dbSNP
rs1264605683 744 dbSNP
rs1174459857 746 dbSNP
rs532007775 748 dbSNP
rs879730917 751 dbSNP
rs1189542361 752 dbSNP
rs951376725 755 dbSNP
rs986773296 765 dbSNP
rs908155547 768 dbSNP
rs1129747 769 dbSNP
rs528409543 773 dbSNP
rs761462729 777 dbSNP
rs142746139 779 dbSNP
rs9818493 780 dbSNP
rs1278693986 781 dbSNP
rs975496256 783 dbSNP
rs925130351 787 dbSNP
rs1177373584 796 dbSNP
rs200190004 802 dbSNP
rs1435481438 803 dbSNP
rs1367065566 810 dbSNP
rs1373864481 812 dbSNP
rs1433930728 814 dbSNP
rs548016266 819 dbSNP
rs552654905 820 dbSNP
rs1360026498 821 dbSNP
rs111930485 829 dbSNP
rs1408281742 832 dbSNP
rs1390060180 833 dbSNP
rs1428502555 833 dbSNP
rs1451935073 837 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 6165.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' uacagggugGGGG--UGAGGACa 5'
                   |::|  ||||||| 
Target 5' ---------CUUCAAACUCCUGg 3'
 		1 - 14
2 
miRNA  3' uacagGGUGGGGGUGAGGAca 5'
               | |:||:| :||||  
Target 5' ucaagCAAUCCUCCUUCCUu- 3'
 		17 - 36
Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000464167.1 | 3UTR | CUUCAAACUCCUGGGCUCAAGCAAUCCUCCUUCCUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
256 hsa-miR-4433a-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT088097 SEPT2 septin 2 2 2
MIRT143134 MGRN1 mahogunin ring finger 1 2 2
MIRT153912 NCOA3 nuclear receptor coactivator 3 2 2
MIRT154894 GNAS GNAS complex locus 2 4
MIRT200996 ZNF805 zinc finger protein 805 2 2
MIRT215729 C5ORF51 chromosome 5 open reading frame 51 2 10
MIRT235593 POFUT1 protein O-fucosyltransferase 1 2 2
MIRT263250 SGPL1 sphingosine-1-phosphate lyase 1 2 2
MIRT317951 CDC5L cell division cycle 5 like 2 4
MIRT325572 HIATL1 major facilitator superfamily domain containing 14B 2 4
MIRT354739 LSM3 LSM3 homolog, U6 small nuclear RNA and mRNA degradation associated 2 2
MIRT444552 UBE2D3 ubiquitin conjugating enzyme E2 D3 2 4
MIRT446978 SUSD5 sushi domain containing 5 2 2
MIRT451036 ZNF610 zinc finger protein 610 2 2
MIRT451596 TRPM7 transient receptor potential cation channel subfamily M member 7 2 2
MIRT452025 NLRP6 NLR family pyrin domain containing 6 2 2
MIRT452594 CA6 carbonic anhydrase 6 2 2
MIRT452768 TCEA3 transcription elongation factor A3 2 4
MIRT452959 ZNF844 zinc finger protein 844 2 2
MIRT453191 ACSF2 acyl-CoA synthetase family member 2 2 2
MIRT453382 RHD Rh blood group D antigen 2 2
MIRT453685 CEBPD CCAAT/enhancer binding protein delta 2 2
MIRT455272 DDX39B DExD-box helicase 39B 2 8
MIRT455346 BAMBI BMP and activin membrane bound inhibitor 2 2
MIRT456494 SERAC1 serine active site containing 1 2 2
MIRT456585 NID1 nidogen 1 2 2
MIRT456888 DDA1 DET1 and DDB1 associated 1 2 2
MIRT457123 APOLD1 apolipoprotein L domain containing 1 2 2
MIRT457852 ZNF324B zinc finger protein 324B 2 2
MIRT457987 APAF1 apoptotic peptidase activating factor 1 2 2
MIRT459278 APOBEC3F apolipoprotein B mRNA editing enzyme catalytic subunit 3F 2 2
MIRT459625 SLC25A33 solute carrier family 25 member 33 2 2
MIRT459715 SGK494 uncharacterized serine/threonine-protein kinase SgK494 2 2
MIRT460057 RPL22L1 ribosomal protein L22 like 1 2 2
MIRT460182 UNK unkempt family zinc finger 2 6
MIRT460288 PDE11A phosphodiesterase 11A 2 2
MIRT460841 EGF epidermal growth factor 2 4
MIRT460860 TBC1D19 TBC1 domain family member 19 2 2
MIRT461519 EMC7 ER membrane protein complex subunit 7 2 2
MIRT461729 SLC27A1 solute carrier family 27 member 1 2 4
MIRT461821 SNAP23 synaptosome associated protein 23 2 2
MIRT462066 CCDC77 coiled-coil domain containing 77 2 4
MIRT462084 MSANTD2 Myb/SANT DNA binding domain containing 2 2 2
MIRT462508 MTFMT mitochondrial methionyl-tRNA formyltransferase 2 10
MIRT464239 VCP valosin containing protein 2 2
MIRT465316 TRAF5 TNF receptor associated factor 5 2 2
MIRT466549 TBL1XR1 transducin beta like 1 X-linked receptor 1 2 2
MIRT467128 SRGAP1 SLIT-ROBO Rho GTPase activating protein 1 2 8
MIRT468091 SHCBP1 SHC binding and spindle associated 1 2 2
MIRT469630 RAD21 RAD21 cohesin complex component 2 6
MIRT471097 PIK3C2B phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta 2 2
MIRT472704 MYBL1 MYB proto-oncogene like 1 2 2
MIRT472830 MTMR10 myotubularin related protein 10 2 2
MIRT472872 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 2 2
MIRT472895 MTDH metadherin 2 2
MIRT473728 MAPK1 mitogen-activated protein kinase 1 2 2
MIRT473859 MAP2K4 mitogen-activated protein kinase kinase 4 2 2
MIRT474047 LONRF1 LON peptidase N-terminal domain and ring finger 1 2 2
MIRT474297 LAMC1 laminin subunit gamma 1 2 2
MIRT474658 KLF13 Kruppel like factor 13 2 2
MIRT475234 IKZF3 IKAROS family zinc finger 3 2 2
MIRT475500 HSP90B1 heat shock protein 90 beta family member 1 2 2
MIRT475742 HERPUD1 homocysteine inducible ER protein with ubiquitin like domain 1 2 4
MIRT475793 HDGF heparin binding growth factor 2 2
MIRT477254 ERGIC2 ERGIC and golgi 2 2 2
MIRT478228 DDX52 DExD-box helicase 52 2 2
MIRT478393 DCTN5 dynactin subunit 5 2 2
MIRT478754 CS citrate synthase 2 2
MIRT478827 CRKL CRK like proto-oncogene, adaptor protein 2 4
MIRT480234 C9orf41 carnosine N-methyltransferase 1 2 2
MIRT480597 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 2 2
MIRT484121 C14orf142 GON7, KEOPS complex subunit homolog 2 2
MIRT484689 PACSIN1 protein kinase C and casein kinase substrate in neurons 1 2 2
MIRT486331 C11orf54 chromosome 11 open reading frame 54 2 4
MIRT488599 FAM3C family with sequence similarity 3 member C 2 8
MIRT488833 MRRF mitochondrial ribosome recycling factor 2 2
MIRT492523 RAB15 RAB15, member RAS oncogene family 2 4
MIRT493632 HIC2 HIC ZBTB transcriptional repressor 2 2 2
MIRT500026 ABCF2 ATP binding cassette subfamily F member 2 2 8
MIRT501075 SMAD7 SMAD family member 7 2 8
MIRT503094 BTG2 BTG anti-proliferation factor 2 2 4
MIRT503336 MMAB methylmalonic aciduria (cobalamin deficiency) cblB type 2 2
MIRT505465 STMN1 stathmin 1 2 4
MIRT505726 SERTAD3 SERTA domain containing 3 2 4
MIRT509333 MS4A4A membrane spanning 4-domains A4A 2 2
MIRT509978 KCNMB1 potassium calcium-activated channel subfamily M regulatory beta subunit 1 2 4
MIRT513068 CHST6 carbohydrate sulfotransferase 6 2 2
MIRT513446 EMP1 epithelial membrane protein 1 2 6
MIRT513736 PSD3 pleckstrin and Sec7 domain containing 3 2 4
MIRT513996 CENPQ centromere protein Q 2 4
MIRT516538 MIXL1 Mix paired-like homeobox 2 2
MIRT517606 SAV1 salvador family WW domain containing protein 1 2 2
MIRT518064 CEP89 centrosomal protein 89 2 2
MIRT518119 RNMTL1 mitochondrial rRNA methyltransferase 3 2 2
MIRT518325 WDR92 WD repeat domain 92 2 2
MIRT519048 ABCB11 ATP binding cassette subfamily B member 11 2 2
MIRT520972 SPPL2A signal peptide peptidase like 2A 2 4
MIRT521359 RPL35A ribosomal protein L35a 2 2
MIRT523359 GTF3C6 general transcription factor IIIC subunit 6 2 2
MIRT523801 FAM63A MINDY lysine 48 deubiquitinase 1 2 2
MIRT524622 C7orf73 short transmembrane mitochondrial protein 1 2 2
MIRT525550 PHB2 prohibitin 2 2 4
MIRT529709 ZBTB49 zinc finger and BTB domain containing 49 2 2
MIRT531605 PLEKHA6 pleckstrin homology domain containing A6 2 2
MIRT532387 UMPS uridine monophosphate synthetase 2 2
MIRT534468 SCD stearoyl-CoA desaturase 2 4
MIRT537546 ETNK1 ethanolamine kinase 1 2 2
MIRT541619 C11orf31 selenoprotein H 2 2
MIRT548380 ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) 2 4
MIRT549523 HDDC2 HD domain containing 2 2 2
MIRT549774 SOD2 superoxide dismutase 2 2 2
MIRT550578 SLC2A5 solute carrier family 2 member 5 2 2
MIRT551498 CENPN centromere protein N 2 4
MIRT552301 ITGA3 integrin subunit alpha 3 2 2
MIRT555400 PPM1L protein phosphatase, Mg2+/Mn2+ dependent 1L 2 2
MIRT556399 LUC7L LUC7 like 2 2
MIRT557047 HOXB3 homeobox B3 2 2
MIRT558072 ERO1L endoplasmic reticulum oxidoreductase 1 alpha 1 2
MIRT559659 AHCYL2 adenosylhomocysteinase like 2 2 2
MIRT561239 ZNF354B zinc finger protein 354B 2 2
MIRT566899 LRIG2 leucine rich repeats and immunoglobulin like domains 2 2 2
MIRT568786 FAM120B family with sequence similarity 120B 2 2
MIRT574014 MRPL12 mitochondrial ribosomal protein L12 2 2
MIRT574885 Dnajc6 DnaJ heat shock protein family (Hsp40) member C6 2 2
MIRT575243 Serping1 serine (or cysteine) peptidase inhibitor, clade G, member 1 2 2
MIRT576194 Vsig2 V-set and immunoglobulin domain containing 2 2 2
MIRT576309 Acbd7 acyl-Coenzyme A binding domain containing 7 2 2
MIRT576484 Lhx4 LIM homeobox protein 4 2 3
MIRT576646 Mill2 MHC I like leukocyte 2 1 1
MIRT576708 Kras Kirsten rat sarcoma viral oncogene homolog 2 2
MIRT576855 Socs6 suppressor of cytokine signaling 6 2 2
MIRT576950 Aldoa aldolase A, fructose-bisphosphate 2 2
MIRT617133 ZNF556 zinc finger protein 556 2 4
MIRT617928 ZNF783 zinc finger family member 783 2 2
MIRT618981 MRPS16 mitochondrial ribosomal protein S16 2 2
MIRT621100 SIX3 SIX homeobox 3 2 2
MIRT624537 BROX BRO1 domain and CAAX motif containing 2 2
MIRT625663 C2orf48 chromosome 2 open reading frame 48 2 2
MIRT627059 DCTN6 dynactin subunit 6 2 2
MIRT628319 CLPB ClpB homolog, mitochondrial AAA ATPase chaperonin 2 2
MIRT630859 ENTPD5 ectonucleoside triphosphate diphosphohydrolase 5 2 2
MIRT632295 TMEM65 transmembrane protein 65 2 2
MIRT634115 ZNF207 zinc finger protein 207 2 2
MIRT634736 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT635655 NDST3 N-deacetylase and N-sulfotransferase 3 2 2
MIRT635772 PDCL3 phosducin like 3 2 2
MIRT635911 LILRA2 leukocyte immunoglobulin like receptor A2 2 2
MIRT636365 OGFRL1 opioid growth factor receptor like 1 2 4
MIRT637251 GLRX2 glutaredoxin 2 2 2
MIRT638705 FZD4 frizzled class receptor 4 2 2
MIRT639640 PREX2 phosphatidylinositol-3,4,5-trisphosphate dependent Rac exchange factor 2 2 2
MIRT639676 PPEF2 protein phosphatase with EF-hand domain 2 2 4
MIRT642267 SMIM17 small integral membrane protein 17 2 2
MIRT642372 ZNF581 zinc finger protein 581 2 2
MIRT643545 SLC25A17 solute carrier family 25 member 17 2 2
MIRT647994 PDE12 phosphodiesterase 12 2 2
MIRT649094 NOM1 nucleolar protein with MIF4G domain 1 2 2
MIRT650993 ZNF770 zinc finger protein 770 2 2
MIRT651956 UBE2N ubiquitin conjugating enzyme E2 N 2 2
MIRT652977 SUN2 Sad1 and UNC84 domain containing 2 2 2
MIRT654389 RBM12B RNA binding motif protein 12B 2 2
MIRT655637 OLFML2A olfactomedin like 2A 2 2
MIRT655729 NRXN3 neurexin 3 2 2
MIRT658171 FCHSD1 FCH and double SH3 domains 1 2 2
MIRT660937 ACOX1 acyl-CoA oxidase 1 2 2
MIRT662112 CERKL ceramide kinase like 2 2
MIRT662302 MPV17L MPV17 mitochondrial inner membrane protein like 2 2
MIRT662993 TMEM59 transmembrane protein 59 2 2
MIRT663071 SFR1 SWI5 dependent homologous recombination repair protein 1 2 2
MIRT663704 ABHD17B abhydrolase domain containing 17B 2 2
MIRT663864 MUC20 mucin 20, cell surface associated 2 2
MIRT665185 HAUS5 HAUS augmin like complex subunit 5 2 4
MIRT665402 WEE1 WEE1 G2 checkpoint kinase 2 2
MIRT665688 TNPO3 transportin 3 2 2
MIRT665795 TMEM170A transmembrane protein 170A 2 2
MIRT665847 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 2 2
MIRT666999 PDPN podoplanin 2 2
MIRT667598 LIPC lipase C, hepatic type 2 2
MIRT668576 ELMSAN1 ELM2 and Myb/SANT domain containing 1 2 4
MIRT670960 UGGT1 UDP-glucose glycoprotein glucosyltransferase 1 2 2
MIRT671187 ZNF891 zinc finger protein 891 2 2
MIRT671739 ZNF451 zinc finger protein 451 2 2
MIRT672745 ZNF585B zinc finger protein 585B 2 4
MIRT673446 ZNF583 zinc finger protein 583 2 2
MIRT679843 GPR75 G protein-coupled receptor 75 2 2
MIRT680556 ZNF584 zinc finger protein 584 2 2
MIRT680661 C1orf210 chromosome 1 open reading frame 210 2 2
MIRT681285 RFC2 replication factor C subunit 2 2 2
MIRT683264 ZNF329 zinc finger protein 329 2 2
MIRT684519 C1orf174 chromosome 1 open reading frame 174 2 2
MIRT685065 GEMIN4 gem nuclear organelle associated protein 4 2 2
MIRT685157 DTWD2 DTW domain containing 2 2 2
MIRT685168 ERCC1 ERCC excision repair 1, endonuclease non-catalytic subunit 2 2
MIRT685470 CACNG8 calcium voltage-gated channel auxiliary subunit gamma 8 2 2
MIRT686001 NEK4 NIMA related kinase 4 2 2
MIRT687027 RNF24 ring finger protein 24 2 2
MIRT687543 MOB1B MOB kinase activator 1B 2 2
MIRT687592 MANEAL mannosidase endo-alpha like 2 2
MIRT687753 KIAA1328 KIAA1328 2 2
MIRT688050 GLUL glutamate-ammonia ligase 2 2
MIRT688374 ENPP1 ectonucleotide pyrophosphatase/phosphodiesterase 1 2 2
MIRT688802 CBFA2T3 CBFA2/RUNX1 translocation partner 3 2 2
MIRT688957 ATXN3 ataxin 3 2 2
MIRT689281 C5AR2 complement component 5a receptor 2 2 2
MIRT689988 NNMT nicotinamide N-methyltransferase 2 2
MIRT689997 MMP17 matrix metallopeptidase 17 2 2
MIRT690014 LUZP2 leucine zipper protein 2 2 2
MIRT690161 ELP3 elongator acetyltransferase complex subunit 3 2 2
MIRT690379 ZSWIM7 zinc finger SWIM-type containing 7 2 2
MIRT690563 MICA MHC class I polypeptide-related sequence A 2 2
MIRT691891 EVC EvC ciliary complex subunit 1 2 2
MIRT693107 SCNM1 sodium channel modifier 1 2 2
MIRT693832 ZFP64 ZFP64 zinc finger protein 2 2
MIRT694105 ZNF446 zinc finger protein 446 2 2
MIRT694179 ZNF486 zinc finger protein 486 2 2
MIRT694475 LRTOMT leucine rich transmembrane and O-methyltransferase domain containing 2 2
MIRT694998 GGA2 golgi associated, gamma adaptin ear containing, ARF binding protein 2 2 2
MIRT695031 ALG10B ALG10B, alpha-1,2-glucosyltransferase 2 2
MIRT695163 TCTN2 tectonic family member 2 2 2
MIRT695525 SLC25A34 solute carrier family 25 member 34 2 2
MIRT696067 ZNF264 zinc finger protein 264 2 2
MIRT696616 CRIPT CXXC repeat containing interactor of PDZ3 domain 2 2
MIRT696661 AGXT2 alanine--glyoxylate aminotransferase 2 2 2
MIRT696705 PNPO pyridoxamine 5'-phosphate oxidase 2 2
MIRT697173 INMT indolethylamine N-methyltransferase 2 2
MIRT697303 ZNF652 zinc finger protein 652 2 2
MIRT697491 ZBTB8B zinc finger and BTB domain containing 8B 2 2
MIRT698657 TERF2 telomeric repeat binding factor 2 2 2
MIRT699042 SOAT1 sterol O-acyltransferase 1 2 2
MIRT699185 SLX4IP SLX4 interacting protein 2 2
MIRT699598 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 2
MIRT700150 RNF115 ring finger protein 115 2 2
MIRT700720 PNO1 partner of NOB1 homolog 2 2
MIRT700870 PER2 period circadian clock 2 2 2
MIRT700912 PDXK pyridoxal kinase 2 2
MIRT701095 PAPOLG poly(A) polymerase gamma 2 2
MIRT701194 OTUD3 OTU deubiquitinase 3 2 2
MIRT702203 LPP LIM domain containing preferred translocation partner in lipoma 2 2
MIRT702272 LHX4 LIM homeobox 4 2 3
MIRT703125 GPRC5A G protein-coupled receptor class C group 5 member A 2 2
MIRT703252 GNS glucosamine (N-acetyl)-6-sulfatase 2 2
MIRT703262 GNL3L G protein nucleolar 3 like 2 2
MIRT703440 FYTTD1 forty-two-three domain containing 1 2 2
MIRT704321 DCUN1D5 defective in cullin neddylation 1 domain containing 5 2 2
MIRT704393 CTSS cathepsin S 2 2
MIRT704483 CPT1A carnitine palmitoyltransferase 1A 2 2
MIRT704880 CCSER2 coiled-coil serine rich protein 2 2 2
MIRT704926 CCDC36 coiled-coil domain containing 36 2 2
MIRT705175 BZW1 basic leucine zipper and W2 domains 1 2 2
MIRT706561 EIF2AK2 eukaryotic translation initiation factor 2 alpha kinase 2 2 2
MIRT707048 TRPV2 transient receptor potential cation channel subfamily V member 2 2 2
MIRT711497 PGD phosphogluconate dehydrogenase 2 2
MIRT716644 EPGN epithelial mitogen 2 2
MIRT720083 TNRC6B trinucleotide repeat containing 6B 2 2
MIRT722288 PMPCA peptidase, mitochondrial processing alpha subunit 2 2
MIRT725468 GRAP2 GRB2-related adaptor protein 2 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4433a Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-4433a Paclitaxel 36314 NSC125973 approved resistant cell line (W1)
hsa-mir-4433a Vincristine 5978 approved resistant cell line (W1)
hsa-mir-4433a Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-miR-4433a-3p Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-4433a-3p Imatinib 5291 NSC743414 approved sensitive High Gastrointestinal Stromal Tumor cell line (882R-NC, 882R-OE, 882R-KD)
hsa-miR-4433a-3p Cisplatin 5460033 NSC119875 approved resistant High Pancreatic Cancer cell line (BxPC-3)
hsa-miR-4433a-3p Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-4433a-3p Imatinib 5291 NSC743414 approved sensitive High Chronic Myelogenous Leukemia tissue
hsa-miR-4433a-3p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780CIS)
hsa-miR-4433a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (mitochondrial RNA)
hsa-miR-4433a-3p Paclitaxel 36314 NSC125973 approved resistant cell line (BAS)
hsa-miR-4433a-3p Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-miR-4433a-3p Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-miR-4433a-3p Neoadjuvant chemotherapy sensitive tissue (breast cancer)
hsa-miR-4433a-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-4433a-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)

Error report submission