miRTarBase - #MIRT521371


—
pre-miRNA Information
pre-miRNA hsa-mir-7849   
Genomic Coordinates chr4: 146408583 - 146408688
Description Homo sapiens miR-7849 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-7849-3p
Sequence 64| GACAAUUGUUGAUCUUGGGCCU |85
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1386078731 3 dbSNP
rs144001291 10 dbSNP
rs1334425573 16 dbSNP
rs557644637 20 dbSNP
Putative Targets

Gene Information
Gene Symbol RNF11   
Synonyms CGI-123, SID1669
Description ring finger protein 11
Transcript NM_014372   
Expression
Putative miRNA Targets on RNF11
3'UTR of RNF11
(miRNA target sites are highlighted)		 
>RNF11|NM_014372|3'UTR
   1 GCCAGGGTCTCTTATCTGACTTCAAGTGAACCACCATTTTGGTGGTTTTGATCTTTTGTCACTGAGCCCAAAGAGCCAGG
  81 GATTAGGAATTAAGATCGTGCACAAAAGTTTCCTTAAAATTCCTGGATGGCTGCAGATGTTGGGGGAAAAAGTACGTGAT
 161 ATTTTAGAAACTTAGTGGGAAAAGTAGGATGGTATTTTTATGTAAAGCCTTGACCCAATGTTTAAAAATATAATTGTATT
 241 TAGATCTTGTTATTGCTCCAGTACATAGGAATTGTGTAAAGTGTTAACAGCAGCTGTATTTGTTTAAATTGTGTGTATTG
 321 AAGATTAGGAAAAAGATAGTAGTTATTTTTCCTAAATGAAATAACTTTCTTCTCTTCCCCTTCCCCACCCGAATTCTTTT
 401 CTGAAGTTGCTGGCATTTGGGTCAAGGTTTTATTAAAAGCTACATTTTATAACACTGGCACACACAAAAAAGTAGTTTTA
 481 AGCTTGTTTGCACAGTTCTTTTTTTCCATTGGAAATGGAATTCATTGCCTTAGGTCTTTTTAAATAGTGTATTATTATCG
 561 TTGGGGCTGGCTCTATGCTTGAAAACCAGTTTATTTATAACCTGTTATAAGTGCTATATTCTGTTTGCAGTTAGGAAATG
 641 CAGAATTCAAAGTGATCTCCTAGCTTGTAAGCAAACTGAGATGCACTATCCCTTTTCTATAAAAAATAAGTTAATGTGTC
 721 AAGAAACCAACTCTATTAAGGTGGGGTTTAATATTACCCTTTCCTATGTGTTTTATCTAATTATTTTGGTTGTTAATATG
 801 GTGATAATGGAAAGTCAAGTTAAATTTTAAATATTAAGAATTCTGATTTATTGAGATTGAATTATGCCACCACGTTTATG
 881 TAAAAATGAAGGTGGCACCGTGGTGAGACCTAATGAGAAATAGTTACTCAGTTGTAAAAATTTTGATTTATTCTCTTTCT
 961 TCTGACCTCCTTGCCTCTTGTCTTGAACCATAGCAAAAGGATACTGCATCTCTCATTACTGTAGTGCTGAGGTTATTGAA
1041 GTTATACAAAACACATCTCAGTCTCTGTTTCTTGGAAAGGTATCTATTACATCCTGCTAGCTGACTGACAAAACTAAGCA
1121 GGGAGAATAAAGATAATTGTATTTTATGTTTTGCACACAAACGCAGAATTTGTATAACCATATGACTTCATAGTTGTGAT
1201 CTCAAAAAAGAAGGAATTTCTCCTTTGTTTCTTGCAGTTAATGTAAGAATACTTTAAATCTCTAAGCTTCTGAAGTGTTA
1281 GAGGTAGAGATGGTCTAGTAAAGATGTAGTAGTAATGTTTTATCCATTTAGCATGTGTTTATTTTTTCATATGTACTCAA
1361 AGGTGACTTATTGGTTCACCTCAGTGATATTACAGCTAAAAAAATCATTCATTAGCAAAAGGAAAAGTGGTCTCAACCTA
1441 ACATCAGAAGTGTTTCTTATTATTATTTTATATTGAGTTGAATATTGAACTCTAACAGTTTTCTACATACAAAACACAGT
1521 GTCATGAAGGTTATTCATAATTGCATTATAGAGGAATGTAGTATGTCATAAGTACTTTGTAAAGATTTGACATTCAACTG
1601 TAGTATCCATATGTTGCTTAAATTTCCTTATGAGCCCCATGATGGAAAGACTTAAAGATGAATTTGAGAAAAATTGAAAG
1681 AAATTAGATTATCAGGTTCTGTTAAATTGTTACATGTATCTTGCTTAAATTTCTGTTTATTAATTTATATCCACCCAAGT
1761 ACATAAAGCAAATTTGGAGGAAACAACTGAAGTTGTGCAATATTTTCTGATAATTGCTTTTTTTATTCTTGTGTTTTCTA
1841 CTTAAACATAATGTCTGTGTCATCAAGTATTATAGTCAGACTTTTCTTTTTTTCTAGATTGTTAAAATTGGCAAATGAAC
1921 TTTTTTAAAAATCATCTTCCATGTTGCAGTTAGTCTTTCTTTTCATTACAAGTCTTTCACAGAAGTTTGGTGGTAATATT
2001 GAAAGAACTAGCATTGGGCAGAATGTGTCTTTTTTAGGCACTTTATATTCTCAACATACAATGTTAAGAACCATCAATTT
2081 TGACTTTTACTAAGTTGTTAAATAAAGTTATAATACAGCTGTGAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uccGGGUU-CUAGU-----UGUUAACAg 5'
             ||||| | |:|     |:|||||| 
Target 5' tgaCCCAATGTTTAAAAATATAATTGTa 3'
 211 - 238 143.00 -10.80
2 
miRNA  3' uccgggUUCUAGUUGUUAACAg 5'
                || |  :|:|||||| 
Target 5' agggagAATAAAGATAATTGTa 3'
 1120 - 1141 136.00 -8.13
3 
miRNA  3' uccGGGUU-CUAGUU--------GUUAACAg 5'
             ||:|| ||  ||        ||:|||| 
Target 5' agaCCTAATGAGAAATAGTTACTCAGTTGTa 3'
 906 - 936 129.00 -9.74
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN16136976 17 COSMIC
COSN1105486 24 COSMIC
COSN8638430 64 COSMIC
COSN31530958 77 COSMIC
COSN13550254 98 COSMIC
COSN20073407 99 COSMIC
COSN30125252 102 COSMIC
COSN16129099 143 COSMIC
COSN28867239 152 COSMIC
COSN31550907 175 COSMIC
COSN30135771 191 COSMIC
COSN31546778 373 COSMIC
COSN30542057 410 COSMIC
COSN31578677 673 COSMIC
COSN31603437 855 COSMIC
COSN22216894 857 COSMIC
COSN31548819 892 COSMIC
COSN31577314 917 COSMIC
COSN31541232 925 COSMIC
COSN31533621 1032 COSMIC
COSN31540496 1131 COSMIC
COSN31513709 1171 COSMIC
COSN21871698 1282 COSMIC
COSN16623637 1537 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs750945149 1 dbSNP
rs1157833864 2 dbSNP
rs1388897084 4 dbSNP
rs1381988459 5 dbSNP
rs1268065026 7 dbSNP
rs1429515882 8 dbSNP
rs1383627599 13 dbSNP
rs1441759857 14 dbSNP
rs756661289 15 dbSNP
rs374679731 16 dbSNP
rs752194608 22 dbSNP
rs1304678200 24 dbSNP
rs758126066 26 dbSNP
rs1407466727 36 dbSNP
rs777353077 43 dbSNP
rs751206505 46 dbSNP
rs775914972 51 dbSNP
rs1443710653 57 dbSNP
rs947307962 69 dbSNP
rs1417386064 76 dbSNP
rs76909946 82 dbSNP
rs565470362 95 dbSNP
rs1197760992 96 dbSNP
rs1374638850 98 dbSNP
rs1490288228 99 dbSNP
rs1276052330 102 dbSNP
rs61100121 108 dbSNP
rs1308756685 109 dbSNP
rs1270226284 120 dbSNP
rs1167300546 131 dbSNP
rs564808037 134 dbSNP
rs1213651835 140 dbSNP
rs563193580 148 dbSNP
rs768966978 152 dbSNP
rs1402932818 153 dbSNP
rs774546077 156 dbSNP
rs886196224 157 dbSNP
rs1005049575 168 dbSNP
rs1352856171 169 dbSNP
rs1169883545 172 dbSNP
rs1415076038 176 dbSNP
rs1431802418 193 dbSNP
rs1016868184 219 dbSNP
rs1480323583 231 dbSNP
rs1404922490 232 dbSNP
rs1435441928 233 dbSNP
rs1252910597 236 dbSNP
rs1179499809 243 dbSNP
rs530090663 258 dbSNP
rs1325093364 262 dbSNP
rs963585015 266 dbSNP
rs1232788007 269 dbSNP
rs1203260527 275 dbSNP
rs533326693 277 dbSNP
rs767062438 284 dbSNP
rs1227314955 292 dbSNP
rs772845556 299 dbSNP
rs764524727 300 dbSNP
rs1264629414 311 dbSNP
rs566788322 314 dbSNP
rs868770595 315 dbSNP
rs954673121 319 dbSNP
rs1307381837 327 dbSNP
rs1371141018 328 dbSNP
rs1297531454 336 dbSNP
rs1347166146 337 dbSNP
rs1221770284 338 dbSNP
rs1448926511 342 dbSNP
rs189514417 353 dbSNP
rs1334978670 373 dbSNP
rs367629850 378 dbSNP
rs1465502482 386 dbSNP
rs552438992 391 dbSNP
rs1263546608 397 dbSNP
rs568462622 405 dbSNP
rs1445113389 413 dbSNP
rs957044313 418 dbSNP
rs1378162276 422 dbSNP
rs988641734 426 dbSNP
rs914435228 428 dbSNP
rs370652065 445 dbSNP
rs1201411849 448 dbSNP
rs77924765 453 dbSNP
rs1044311706 459 dbSNP
rs1217759260 460 dbSNP
rs1314893445 466 dbSNP
rs1306221522 467 dbSNP
rs537664477 484 dbSNP
rs1246542984 502 dbSNP
rs11553363 508 dbSNP
rs149441148 510 dbSNP
rs1457418316 523 dbSNP
rs1312957772 525 dbSNP
rs1451979272 526 dbSNP
rs1385999786 528 dbSNP
rs1290852691 532 dbSNP
rs1452158972 533 dbSNP
rs927196240 537 dbSNP
rs564796277 542 dbSNP
rs56890493 548 dbSNP
rs886172458 551 dbSNP
rs1181254928 554 dbSNP
rs530812754 555 dbSNP
rs1262060794 557 dbSNP
rs1187851089 560 dbSNP
rs1484775247 561 dbSNP
rs1259892487 566 dbSNP
rs1037427988 568 dbSNP
rs899317805 576 dbSNP
rs1289467207 585 dbSNP
rs1245425259 588 dbSNP
rs1324709994 590 dbSNP
rs1327088875 593 dbSNP
rs1333345004 594 dbSNP
rs1380703738 599 dbSNP
rs1361724952 609 dbSNP
rs1426906185 617 dbSNP
rs1364321281 618 dbSNP
rs1163487187 625 dbSNP
rs1423464436 626 dbSNP
rs1403698590 627 dbSNP
rs1172132482 629 dbSNP
rs1282720884 638 dbSNP
rs1329973261 639 dbSNP
rs1230433161 660 dbSNP
rs7340123 661 dbSNP
rs1199932445 662 dbSNP
rs1259204027 666 dbSNP
rs1490778479 668 dbSNP
rs535418064 674 dbSNP
rs1221580919 684 dbSNP
rs553716996 687 dbSNP
rs369089634 689 dbSNP
rs1253102185 690 dbSNP
rs1204333550 698 dbSNP
rs1225306057 701 dbSNP
rs1307175511 706 dbSNP
rs1284154164 707 dbSNP
rs996305546 717 dbSNP
rs1343960022 731 dbSNP
rs1303087152 733 dbSNP
rs1267873045 736 dbSNP
rs1029169102 741 dbSNP
rs182062668 746 dbSNP
rs1490819777 759 dbSNP
rs545834885 760 dbSNP
rs760194952 767 dbSNP
rs1031441583 768 dbSNP
rs1472646091 772 dbSNP
rs1160791442 776 dbSNP
rs956798078 778 dbSNP
rs1198628360 780 dbSNP
rs1438373616 783 dbSNP
rs147498188 788 dbSNP
rs1194215772 791 dbSNP
rs1453424739 792 dbSNP
rs1164184816 793 dbSNP
rs1264000960 800 dbSNP
rs915346020 808 dbSNP
rs376927190 834 dbSNP
rs968499410 838 dbSNP
rs979939780 853 dbSNP
rs1240181862 857 dbSNP
rs1338089171 859 dbSNP
rs766442366 861 dbSNP
rs1367921164 874 dbSNP
rs1423255973 875 dbSNP
rs1303131298 881 dbSNP
rs1351123991 895 dbSNP
rs1411771846 900 dbSNP
rs138476185 901 dbSNP
rs544842668 904 dbSNP
rs552332541 909 dbSNP
rs938621883 912 dbSNP
rs1265781354 913 dbSNP
rs563106928 918 dbSNP
rs1056788010 921 dbSNP
rs1220098103 922 dbSNP
rs1418581206 923 dbSNP
rs1243783871 924 dbSNP
rs1205834305 926 dbSNP
rs907504774 937 dbSNP
rs1290987301 949 dbSNP
rs1483060135 964 dbSNP
rs1206163856 969 dbSNP
rs1178446341 970 dbSNP
rs1247875884 976 dbSNP
rs1418143495 978 dbSNP
rs1238881550 981 dbSNP
rs1375545032 991 dbSNP
rs1187865144 993 dbSNP
rs1387447305 994 dbSNP
rs754224012 997 dbSNP
rs1454087146 1001 dbSNP
rs1333079350 1009 dbSNP
rs74849425 1009 dbSNP
rs753787713 1016 dbSNP
rs1386780155 1022 dbSNP
rs1371715798 1024 dbSNP
rs1385762980 1027 dbSNP
rs940389033 1028 dbSNP
rs754936555 1035 dbSNP
rs1237182176 1039 dbSNP
rs1194102661 1040 dbSNP
rs1449104725 1042 dbSNP
rs1296521545 1046 dbSNP
rs1204892942 1048 dbSNP
rs757628551 1053 dbSNP
rs765132505 1064 dbSNP
rs1317461962 1066 dbSNP
rs1247604295 1073 dbSNP
rs1379867171 1076 dbSNP
rs1050595525 1083 dbSNP
rs1430958025 1084 dbSNP
rs1328001607 1087 dbSNP
rs1384675175 1091 dbSNP
rs1399132938 1093 dbSNP
rs890692881 1099 dbSNP
rs1165384489 1100 dbSNP
rs1009590238 1110 dbSNP
rs1413083737 1114 dbSNP
rs1031263990 1137 dbSNP
rs1476539835 1148 dbSNP
rs1206619631 1156 dbSNP
rs143495145 1160 dbSNP
rs34974872 1163 dbSNP
rs558637221 1164 dbSNP
rs576815229 1166 dbSNP
rs1010912840 1168 dbSNP
rs1490610579 1173 dbSNP
rs1022354673 1181 dbSNP
rs1220816687 1184 dbSNP
rs1319436225 1196 dbSNP
rs147171069 1197 dbSNP
rs1200628794 1198 dbSNP
rs1214625180 1207 dbSNP
rs1341087621 1209 dbSNP
rs1268042556 1216 dbSNP
rs1244626371 1223 dbSNP
rs534665791 1233 dbSNP
rs1034213724 1241 dbSNP
rs1277149739 1249 dbSNP
rs959913678 1250 dbSNP
rs993132065 1260 dbSNP
rs1183378906 1261 dbSNP
rs1329666464 1263 dbSNP
rs1411723764 1265 dbSNP
rs1391226243 1280 dbSNP
rs191710775 1284 dbSNP
rs1430783623 1290 dbSNP
rs907789423 1291 dbSNP
rs1169018878 1296 dbSNP
rs1431851360 1298 dbSNP
rs940318067 1304 dbSNP
rs375913847 1306 dbSNP
rs973078646 1306 dbSNP
rs1338869820 1310 dbSNP
rs1439029539 1311 dbSNP
rs1404203819 1316 dbSNP
rs1452265268 1317 dbSNP
rs1217569465 1326 dbSNP
rs11553364 1330 dbSNP
rs552600570 1334 dbSNP
rs1284910128 1341 dbSNP
rs1221429302 1344 dbSNP
rs1050538320 1349 dbSNP
rs1280048917 1364 dbSNP
rs570632964 1367 dbSNP
rs1330968440 1368 dbSNP
rs1216233052 1372 dbSNP
rs531718353 1373 dbSNP
rs1408541561 1380 dbSNP
rs1174777200 1385 dbSNP
rs1432965974 1389 dbSNP
rs549548850 1391 dbSNP
rs1179404881 1397 dbSNP
rs944910177 1398 dbSNP
rs1197651980 1405 dbSNP
rs1223593360 1413 dbSNP
rs1053075696 1417 dbSNP
rs1207824706 1427 dbSNP
rs1311330053 1430 dbSNP
rs1307619626 1439 dbSNP
rs892725290 1444 dbSNP
rs1010902986 1454 dbSNP
rs1264547059 1457 dbSNP
rs1308680708 1457 dbSNP
rs1334956178 1458 dbSNP
rs1465868622 1464 dbSNP
rs748392833 1475 dbSNP
rs769806469 1493 dbSNP
rs1399416460 1506 dbSNP
rs1380207468 1508 dbSNP
rs546959884 1514 dbSNP
rs1244604260 1517 dbSNP
rs1444701382 1517 dbSNP
rs1002260423 1525 dbSNP
rs750646728 1526 dbSNP
rs567952005 1527 dbSNP
rs1185252612 1547 dbSNP
rs1482822687 1552 dbSNP
rs1261044484 1558 dbSNP
rs1351469344 1564 dbSNP
rs1285217573 1570 dbSNP
rs1246881241 1573 dbSNP
rs1361609082 1575 dbSNP
rs1310852900 1579 dbSNP
rs1395631118 1591 dbSNP
rs1035130654 1595 dbSNP
rs745956428 1596 dbSNP
rs960105790 1597 dbSNP
rs992685080 1600 dbSNP
rs1178663579 1602 dbSNP
rs1164706938 1603 dbSNP
rs1015250413 1606 dbSNP
rs1427370772 1607 dbSNP
rs1386514676 1609 dbSNP
rs961976346 1610 dbSNP
rs535734705 1613 dbSNP
rs1160243275 1618 dbSNP
rs1261956902 1623 dbSNP
rs181233941 1627 dbSNP
rs1487179328 1637 dbSNP
rs565627817 1638 dbSNP
rs1223047822 1642 dbSNP
rs1490871026 1644 dbSNP
rs973026767 1646 dbSNP
rs1345515730 1659 dbSNP
rs1308346270 1676 dbSNP
rs1297975170 1686 dbSNP
rs1217196148 1692 dbSNP
rs920287655 1693 dbSNP
rs1304308849 1719 dbSNP
rs1407240919 1739 dbSNP
rs1389175495 1741 dbSNP
rs35241499 1744 dbSNP
rs1291324628 1761 dbSNP
rs553441678 1785 dbSNP
rs931661356 1786 dbSNP
rs1373352116 1787 dbSNP
rs1172015002 1789 dbSNP
rs985818440 1790 dbSNP
rs1422604853 1801 dbSNP
rs1200094303 1810 dbSNP
rs1432673502 1811 dbSNP
rs1490835430 1818 dbSNP
rs1286975072 1825 dbSNP
rs1265148185 1826 dbSNP
rs1361196725 1835 dbSNP
rs1405541443 1842 dbSNP
rs1480966040 1843 dbSNP
rs1253296951 1850 dbSNP
rs1196935178 1851 dbSNP
rs1317709488 1854 dbSNP
rs911649876 1860 dbSNP
rs1320864281 1868 dbSNP
rs758585865 1872 dbSNP
rs568182753 1874 dbSNP
rs756624047 1878 dbSNP
rs1332989745 1881 dbSNP
rs1463691572 1882 dbSNP
rs1399073952 1888 dbSNP
rs1214106033 1893 dbSNP
rs1176943627 1900 dbSNP
rs557860963 1912 dbSNP
rs1375869716 1916 dbSNP
rs1241958833 1917 dbSNP
rs576187216 1927 dbSNP
rs1044014012 1930 dbSNP
rs1176830809 1931 dbSNP
rs1202274083 1934 dbSNP
rs896531887 1936 dbSNP
rs1266834220 1944 dbSNP
rs1263985993 1948 dbSNP
rs1480163305 1954 dbSNP
rs1183116629 1973 dbSNP
rs748359285 1975 dbSNP
rs1410439407 1986 dbSNP
rs1402167338 1987 dbSNP
rs905169584 1987 dbSNP
rs1156649480 1988 dbSNP
rs1240342695 1989 dbSNP
rs1002206413 1991 dbSNP
rs949350884 1999 dbSNP
rs1443899649 2002 dbSNP
rs1375784528 2003 dbSNP
rs1336970739 2009 dbSNP
rs1045629662 2015 dbSNP
rs1399738189 2024 dbSNP
rs897716113 2024 dbSNP
rs896601648 2030 dbSNP
rs1343053593 2055 dbSNP
rs544290048 2074 dbSNP
rs1454289723 2077 dbSNP
rs993361273 2088 dbSNP
rs1176920842 2098 dbSNP
rs1439149668 2099 dbSNP
rs1243989397 2102 dbSNP
rs1279712707 2103 dbSNP
rs1049390369 2111 dbSNP
rs535672745 2112 dbSNP
rs1255850732 2115 dbSNP
rs1206068290 2126 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 26994.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 26994.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000242719.3 | 3UTR | UAUUUUAUGUUUUGCACACAAACGCAGAAUUUGUAUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000242719.3 | 3UTR | UAUUUUAUGUUUUGCACACA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000242719.3 | 3UTR | UAUUUUAUGUUUUGCACACAAACG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000242719.3 | 3UTR | GUAUUUUAUGUUUUGCACACAAACG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
69 hsa-miR-7849-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT062192 WNK1 WNK lysine deficient protein kinase 1 2 2
MIRT064755 CCND2 cyclin D2 2 8
MIRT076594 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 2
MIRT086027 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 2 2
MIRT091394 EIF4A2 eukaryotic translation initiation factor 4A2 2 2
MIRT104730 KLF10 Kruppel like factor 10 2 2
MIRT105345 SLC7A2 solute carrier family 7 member 2 2 2
MIRT105672 PNMA2 paraneoplastic Ma antigen 2 2 6
MIRT173218 TMEM64 transmembrane protein 64 2 2
MIRT228305 SMU1 DNA replication regulator and spliceosomal factor 2 2
MIRT229503 EIF1AX eukaryotic translation initiation factor 1A, X-linked 2 2
MIRT243387 SKIL SKI like proto-oncogene 2 2
MIRT257404 E2F3 E2F transcription factor 3 2 2
MIRT301069 SLC16A14 solute carrier family 16 member 14 2 4
MIRT307327 CTNNB1 catenin beta 1 2 2
MIRT443182 DENND4C DENN domain containing 4C 2 2
MIRT469272 RHOB ras homolog family member B 2 8
MIRT475106 IRF2BP2 interferon regulatory factor 2 binding protein 2 2 4
MIRT484134 C14orf142 GON7, KEOPS complex subunit homolog 2 2
MIRT491117 TMTC1 transmembrane and tetratricopeptide repeat containing 1 2 4
MIRT504856 HAUS3 HAUS augmin like complex subunit 3 2 4
MIRT505544 SNX16 sorting nexin 16 2 6
MIRT506752 LCOR ligand dependent nuclear receptor corepressor 2 8
MIRT507358 FAM129A family with sequence similarity 129 member A 2 6
MIRT507812 CDK6 cyclin dependent kinase 6 2 6
MIRT510730 SON SON DNA binding protein 2 6
MIRT521296 RRAGD Ras related GTP binding D 2 4
MIRT521371 RNF11 ring finger protein 11 2 6
MIRT525860 ARL13B ADP ribosylation factor like GTPase 13B 2 2
MIRT527352 FAM69C family with sequence similarity 69 member C 2 2
MIRT528796 RAB32 RAB32, member RAS oncogene family 2 2
MIRT530417 SULT1B1 sulfotransferase family 1B member 1 2 2
MIRT533425 TWF1 twinfilin actin binding protein 1 2 2
MIRT539512 ACSS3 acyl-CoA synthetase short chain family member 3 2 2
MIRT543660 ZNF589 zinc finger protein 589 2 4
MIRT544833 ZNF639 zinc finger protein 639 2 2
MIRT545266 TRIM36 tripartite motif containing 36 2 4
MIRT545425 SLC39A6 solute carrier family 39 member 6 2 2
MIRT546070 VEZF1 vascular endothelial zinc finger 1 2 2
MIRT546896 PTPRK protein tyrosine phosphatase, receptor type K 2 2
MIRT547932 HNRNPR heterogeneous nuclear ribonucleoprotein R 2 2
MIRT548836 CHD1 chromodomain helicase DNA binding protein 1 2 4
MIRT550937 ZNF100 zinc finger protein 100 2 2
MIRT551840 AASDHPPT aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase 2 2
MIRT553749 TBC1D8 TBC1 domain family member 8 2 2
MIRT554070 SOBP sine oculis binding protein homolog 2 2
MIRT554254 SIX4 SIX homeobox 4 2 2
MIRT558254 DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 2 2
MIRT559252 BBX BBX, HMG-box containing 2 4
MIRT561110 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 2 2
MIRT561412 TSN translin 2 2
MIRT562154 ID4 inhibitor of DNA binding 4, HLH protein 2 2
MIRT563324 ORC4 origin recognition complex subunit 4 2 2
MIRT563985 SLFN11 schlafen family member 11 2 2
MIRT571387 JKAMP JNK1/MAPK8-associated membrane protein 2 2
MIRT575040 Fasl Fas ligand (TNF superfamily, member 6) 1 1
MIRT610374 C9orf64 chromosome 9 open reading frame 64 2 2
MIRT611045 FASLG Fas ligand 2 3
MIRT625440 RMDN1 regulator of microtubule dynamics 1 2 2
MIRT655071 PKIA cAMP-dependent protein kinase inhibitor alpha 2 2
MIRT656139 MSH6 mutS homolog 6 2 2
MIRT667042 PDE3A phosphodiesterase 3A 2 2
MIRT691264 ICOSLG inducible T-cell costimulator ligand 2 2
MIRT699773 SEMA4D semaphorin 4D 2 2
MIRT707809 TSPAN6 tetraspanin 6 2 2
MIRT711125 CYYR1 cysteine and tyrosine rich 1 2 2
MIRT714107 RLIM ring finger protein, LIM domain interacting 2 2
MIRT717792 TGFBR2 transforming growth factor beta receptor 2 2 2
MIRT717929 ZNF546 zinc finger protein 546 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-7849-3p Imatinib 5291 NSC743414 approved sensitive High Chronic Myelogenous Leukemia tissue
hsa-miR-7849-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)

Error report submission