pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-7107 |
Genomic Coordinates | chr12: 121444273 - 121444352 |
Description | Homo sapiens miR-7107 stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | |||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-7107-5p | ||||||||||||||||||||||||||||||
Sequence | 6| UCGGCCUGGGGAGGAGGAAGGG |27 | ||||||||||||||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||||||||||||||
Experiments | Meta-analysis | ||||||||||||||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | QSOX1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonyms | Q6, QSCN6 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Description | quiescin sulfhydryl oxidase 1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Transcript | NM_002826 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Other Transcripts | NM_001004128 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative miRNA Targets on QSOX1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3'UTR of QSOX1 (miRNA target sites are highlighted) |
>QSOX1|NM_002826|3'UTR 1 ACCACCTGGGGAGGAGGCGGGAGAGGGAGCTGCCATCTCTAGGCACCTCAAGCCCCCTGACCCCATTCCCTCCCCTCCCA 81 CCCCTTGCTCCTTGTCTGGCCTAGAAGTGTGGGAAATTCAGGAAAACGAGTTGCTCCAGTGAAGCTTCTTGGGGTTGCTA 161 GGACAGAGAGCTCCTTTGACACAAAAGACAGGAGCAGGGTCCAGGTTCCCCTGCTGTGCAGGGAGGGCAGCCCCGGGCAG 241 TGGGCATAGGGCAGCTCAGTCCCTGGCCTCTTAGCACCACATTCCTGTTTTTCAGCTTATTTGAAGTCCTGCCTCATTCT 321 CACTGGAGCCTCAGTCTCTCCTGCTTGGTCTTGGCCCTCAACTGGGGCAAGTGAAGCCAGAGGAGGGTCCCCCAGCTGGG 401 TGGGCTGGAATGGAACTCCTCACTAGCTGCTGGGGCTCCGCCCACCCTGCTCCCTTCCGGACAATGAAGAAGCCTTTGCA 481 CCCTGGGAGGAAGGACCACCCCGGGCCCTCTATGCCTGGCCAGCCTCCAGCTCCTCAGACCTCCTGGGTGGGGTTTGGCT 561 TCAGGGTGGGGTTTGGAAGCTTCTGGAAGTCGTGCTGGTCTCCCAGGTGAGGCAAGCCATGGTTGCTGGGCTGTAGGGTG 641 AGTGGCTTGCTTGGTGGGACCTGACGAGTTGGTGGCATGGGAAGGATGTGGGTCTCTAGTGCCTTGCCCTGGCTTAGCTG 721 CAGGAGAAGATGGCTGCTTTCACTTCCCCCCATTGAGCTCTGCTCCCTCTGAGCCTGGTCTTTTGTCCTTTTTTATTTTG 801 GTCTCCAAGATGAATGCTCATCTTTGGAGGGTGCCAGGTAGAAGCTAGGGAGGGGAGTGTCTTCTCTCTCCAGGTTTCAC 881 CTTCCAGTGTGCAGAAGTTAGAAGGGTCTGGCGGGGGCAGTGCCTTACACATGCTTGATTCCCACGCTACCCCCTGCCTT 961 GGGAGGTGTGTGGAATAAATTATTTTTGTTAAGGCAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
DRVs in gene 3'UTRs |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SNPs in gene 3'UTRs |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | Hela | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1048188. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_ptb_knockdown
... - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al. - Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Disease | 5768.0 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
CLIP-seq Support 1 for dataset GSM1048188 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | Hela / Hela_AGO2_CLIP_ptb_knockdown |
Location of target site | ENST00000367602.3 | 3UTR | CUUGUAAUCCUAGCACUUUGGGAGGC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23313552 / GSE42701 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM1065667 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_6 |
Location of target site | ENST00000367602.3 | 3UTR | CUCACGCUUGUAAUCCUAGCACUUUGGGAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23446348 / GSE43573 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
144 hsa-miR-7107-5p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT060580 | CCND1 | cyclin D1 | 2 | 4 | ||||||||
MIRT451035 | ZNF610 | zinc finger protein 610 | 2 | 2 | ||||||||
MIRT485711 | CASP16 | caspase 16, pseudogene | 2 | 8 | ||||||||
MIRT488402 | TDRKH | tudor and KH domain containing | 2 | 2 | ||||||||
MIRT492084 | TCF21 | transcription factor 21 | 2 | 2 | ||||||||
MIRT504213 | VAV3 | vav guanine nucleotide exchange factor 3 | 2 | 13 | ||||||||
MIRT505723 | SERTAD3 | SERTA domain containing 3 | 2 | 4 | ||||||||
MIRT509007 | FBXO6 | F-box protein 6 | 2 | 2 | ||||||||
MIRT509843 | FOS | Fos proto-oncogene, AP-1 transcription factor subunit | 2 | 2 | ||||||||
MIRT514761 | RBM4B | RNA binding motif protein 4B | 2 | 2 | ||||||||
MIRT515664 | LRRC27 | leucine rich repeat containing 27 | 2 | 2 | ||||||||
MIRT516316 | F8A2 | coagulation factor VIII associated 2 | 2 | 2 | ||||||||
MIRT516342 | F8A3 | coagulation factor VIII associated 3 | 2 | 2 | ||||||||
MIRT517139 | KCTD21 | potassium channel tetramerization domain containing 21 | 2 | 2 | ||||||||
MIRT518746 | C1orf35 | chromosome 1 open reading frame 35 | 2 | 2 | ||||||||
MIRT519299 | MLH1 | mutL homolog 1 | 2 | 2 | ||||||||
MIRT521527 | QSOX1 | quiescin sulfhydryl oxidase 1 | 2 | 4 | ||||||||
MIRT531756 | TXK | TXK tyrosine kinase | 2 | 2 | ||||||||
MIRT542208 | C14orf142 | GON7, KEOPS complex subunit homolog | 2 | 2 | ||||||||
MIRT542235 | FUT9 | fucosyltransferase 9 | 2 | 2 | ||||||||
MIRT542791 | PLEKHA3 | pleckstrin homology domain containing A3 | 2 | 2 | ||||||||
MIRT554378 | SETD5 | SET domain containing 5 | 2 | 2 | ||||||||
MIRT569908 | PCSK9 | proprotein convertase subtilisin/kexin type 9 | 2 | 2 | ||||||||
MIRT570222 | SLC27A1 | solute carrier family 27 member 1 | 2 | 2 | ||||||||
MIRT570976 | RGS19 | regulator of G protein signaling 19 | 2 | 2 | ||||||||
MIRT573046 | SHMT1 | serine hydroxymethyltransferase 1 | 2 | 2 | ||||||||
MIRT574954 | Vav3 | vav 3 oncogene | 2 | 8 | ||||||||
MIRT609297 | MMAB | methylmalonic aciduria (cobalamin deficiency) cblB type | 2 | 2 | ||||||||
MIRT612990 | GBX2 | gastrulation brain homeobox 2 | 2 | 2 | ||||||||
MIRT613851 | SHB | SH2 domain containing adaptor protein B | 2 | 2 | ||||||||
MIRT613935 | POLR3A | RNA polymerase III subunit A | 2 | 2 | ||||||||
MIRT614243 | WDR53 | WD repeat domain 53 | 2 | 4 | ||||||||
MIRT615158 | SPIB | Spi-B transcription factor | 2 | 2 | ||||||||
MIRT616145 | HS3ST1 | heparan sulfate-glucosamine 3-sulfotransferase 1 | 2 | 2 | ||||||||
MIRT616389 | C1orf87 | chromosome 1 open reading frame 87 | 2 | 2 | ||||||||
MIRT617737 | ATCAY | ATCAY, caytaxin | 2 | 4 | ||||||||
MIRT621449 | TCN2 | transcobalamin 2 | 2 | 2 | ||||||||
MIRT625784 | GCNT1 | glucosaminyl (N-acetyl) transferase 1, core 2 | 2 | 2 | ||||||||
MIRT628556 | MELK | maternal embryonic leucine zipper kinase | 2 | 2 | ||||||||
MIRT632041 | ZNF430 | zinc finger protein 430 | 2 | 2 | ||||||||
MIRT634937 | GTF2H2C | GTF2H2 family member C | 2 | 4 | ||||||||
MIRT637208 | MEAF6 | MYST/Esa1 associated factor 6 | 2 | 2 | ||||||||
MIRT637610 | LOH12CR1 | BLOC-1 related complex subunit 5 | 2 | 2 | ||||||||
MIRT637832 | CACNG8 | calcium voltage-gated channel auxiliary subunit gamma 8 | 2 | 2 | ||||||||
MIRT638107 | ZBTB43 | zinc finger and BTB domain containing 43 | 2 | 2 | ||||||||
MIRT638387 | RAB11FIP1 | RAB11 family interacting protein 1 | 2 | 2 | ||||||||
MIRT641689 | SPCS1 | signal peptidase complex subunit 1 | 2 | 2 | ||||||||
MIRT642611 | APOPT1 | apoptogenic 1, mitochondrial | 2 | 2 | ||||||||
MIRT643850 | LACTB | lactamase beta | 2 | 4 | ||||||||
MIRT649575 | PALD1 | phosphatase domain containing, paladin 1 | 2 | 2 | ||||||||
MIRT649860 | WDR12 | WD repeat domain 12 | 2 | 2 | ||||||||
MIRT651026 | ZNF699 | zinc finger protein 699 | 2 | 2 | ||||||||
MIRT652336 | TMOD3 | tropomodulin 3 | 2 | 4 | ||||||||
MIRT653286 | SMURF2 | SMAD specific E3 ubiquitin protein ligase 2 | 2 | 2 | ||||||||
MIRT656292 | METTL14 | methyltransferase like 14 | 2 | 2 | ||||||||
MIRT656458 | MAPK14 | mitogen-activated protein kinase 14 | 2 | 2 | ||||||||
MIRT659539 | CHCHD5 | coiled-coil-helix-coiled-coil-helix domain containing 5 | 2 | 2 | ||||||||
MIRT661537 | NWD1 | NACHT and WD repeat domain containing 1 | 2 | 2 | ||||||||
MIRT668042 | GTPBP10 | GTP binding protein 10 | 2 | 2 | ||||||||
MIRT668147 | GDPD1 | glycerophosphodiester phosphodiesterase domain containing 1 | 2 | 2 | ||||||||
MIRT668800 | CYP20A1 | cytochrome P450 family 20 subfamily A member 1 | 2 | 2 | ||||||||
MIRT669818 | STOML1 | stomatin like 1 | 2 | 2 | ||||||||
MIRT670490 | DCUN1D2 | defective in cullin neddylation 1 domain containing 2 | 2 | 2 | ||||||||
MIRT670615 | NPHP1 | nephrocystin 1 | 2 | 2 | ||||||||
MIRT670892 | CYTIP | cytohesin 1 interacting protein | 2 | 2 | ||||||||
MIRT670943 | LIPG | lipase G, endothelial type | 2 | 2 | ||||||||
MIRT671268 | MTRNR2L5 | MT-RNR2-like 5 | 2 | 2 | ||||||||
MIRT671903 | GBP4 | guanylate binding protein 4 | 2 | 2 | ||||||||
MIRT672239 | ABHD15 | abhydrolase domain containing 15 | 2 | 2 | ||||||||
MIRT672326 | C9orf3 | chromosome 9 open reading frame 3 | 2 | 2 | ||||||||
MIRT673113 | MFSD2A | major facilitator superfamily domain containing 2A | 2 | 2 | ||||||||
MIRT674412 | GNE | glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase | 2 | 2 | ||||||||
MIRT677718 | IRF1 | interferon regulatory factor 1 | 2 | 2 | ||||||||
MIRT678585 | PPP1R3B | protein phosphatase 1 regulatory subunit 3B | 2 | 2 | ||||||||
MIRT678726 | SRCAP | Snf2 related CREBBP activator protein | 2 | 2 | ||||||||
MIRT679338 | ISG20L2 | interferon stimulated exonuclease gene 20 like 2 | 2 | 2 | ||||||||
MIRT679614 | RRP36 | ribosomal RNA processing 36 | 2 | 2 | ||||||||
MIRT679695 | SLC1A5 | solute carrier family 1 member 5 | 2 | 4 | ||||||||
MIRT679715 | RPL24 | ribosomal protein L24 | 2 | 2 | ||||||||
MIRT680065 | CD96 | CD96 molecule | 2 | 2 | ||||||||
MIRT683379 | ESR2 | estrogen receptor 2 | 2 | 2 | ||||||||
MIRT683683 | MICA | MHC class I polypeptide-related sequence A | 2 | 2 | ||||||||
MIRT683865 | OCIAD1 | OCIA domain containing 1 | 2 | 2 | ||||||||
MIRT684073 | TLR7 | toll like receptor 7 | 2 | 2 | ||||||||
MIRT684126 | CEP104 | centrosomal protein 104 | 2 | 2 | ||||||||
MIRT684485 | GPR137B | G protein-coupled receptor 137B | 2 | 2 | ||||||||
MIRT684736 | DNAJB13 | DnaJ heat shock protein family (Hsp40) member B13 | 2 | 2 | ||||||||
MIRT684778 | MYO1F | myosin IF | 2 | 2 | ||||||||
MIRT685028 | MRI1 | methylthioribose-1-phosphate isomerase 1 | 2 | 2 | ||||||||
MIRT685189 | DCTN5 | dynactin subunit 5 | 2 | 2 | ||||||||
MIRT685307 | ASB16 | ankyrin repeat and SOCS box containing 16 | 2 | 2 | ||||||||
MIRT685514 | MSH3 | mutS homolog 3 | 2 | 2 | ||||||||
MIRT685702 | BHMT2 | betaine--homocysteine S-methyltransferase 2 | 2 | 2 | ||||||||
MIRT685944 | PTGIS | prostaglandin I2 synthase | 2 | 2 | ||||||||
MIRT686311 | VPS53 | VPS53, GARP complex subunit | 2 | 2 | ||||||||
MIRT686686 | TIMM10 | translocase of inner mitochondrial membrane 10 | 2 | 2 | ||||||||
MIRT687641 | LRIF1 | ligand dependent nuclear receptor interacting factor 1 | 2 | 2 | ||||||||
MIRT687923 | HOOK3 | hook microtubule tethering protein 3 | 2 | 2 | ||||||||
MIRT688117 | GEMIN8 | gem nuclear organelle associated protein 8 | 2 | 2 | ||||||||
MIRT688460 | DNAJB4 | DnaJ heat shock protein family (Hsp40) member B4 | 2 | 2 | ||||||||
MIRT688629 | CRISPLD2 | cysteine rich secretory protein LCCL domain containing 2 | 2 | 2 | ||||||||
MIRT688823 | CAPZA2 | capping actin protein of muscle Z-line alpha subunit 2 | 2 | 2 | ||||||||
MIRT689117 | ZBTB25 | zinc finger and BTB domain containing 25 | 2 | 2 | ||||||||
MIRT689166 | ZNF665 | zinc finger protein 665 | 2 | 2 | ||||||||
MIRT690070 | MBD1 | methyl-CpG binding domain protein 1 | 2 | 2 | ||||||||
MIRT690733 | IRAK4 | interleukin 1 receptor associated kinase 4 | 2 | 2 | ||||||||
MIRT691324 | KIAA1841 | KIAA1841 | 2 | 2 | ||||||||
MIRT691517 | ZNF682 | zinc finger protein 682 | 2 | 2 | ||||||||
MIRT691607 | IPP | intracisternal A particle-promoted polypeptide | 2 | 2 | ||||||||
MIRT692314 | RFK | riboflavin kinase | 2 | 2 | ||||||||
MIRT692376 | LY6G5B | lymphocyte antigen 6 family member G5B | 2 | 2 | ||||||||
MIRT692436 | METTL8 | methyltransferase like 8 | 2 | 2 | ||||||||
MIRT692782 | SYNPO2L | synaptopodin 2 like | 2 | 2 | ||||||||
MIRT693136 | THEM4 | thioesterase superfamily member 4 | 2 | 2 | ||||||||
MIRT693422 | TECPR2 | tectonin beta-propeller repeat containing 2 | 2 | 2 | ||||||||
MIRT693871 | COX19 | COX19, cytochrome c oxidase assembly factor | 2 | 2 | ||||||||
MIRT694049 | PRIM1 | DNA primase subunit 1 | 2 | 2 | ||||||||
MIRT694092 | KIAA0930 | KIAA0930 | 2 | 2 | ||||||||
MIRT694190 | ZNF347 | zinc finger protein 347 | 2 | 2 | ||||||||
MIRT695177 | SLC25A33 | solute carrier family 25 member 33 | 2 | 2 | ||||||||
MIRT696180 | GNB5 | G protein subunit beta 5 | 2 | 2 | ||||||||
MIRT697387 | ZMAT3 | zinc finger matrin-type 3 | 2 | 2 | ||||||||
MIRT698924 | SPEM1 | spermatid maturation 1 | 2 | 2 | ||||||||
MIRT699314 | SLC35F5 | solute carrier family 35 member F5 | 2 | 4 | ||||||||
MIRT701106 | PAPD5 | poly(A) RNA polymerase D5, non-canonical | 2 | 2 | ||||||||
MIRT701575 | MYPN | myopalladin | 2 | 2 | ||||||||
MIRT701825 | MRPL37 | mitochondrial ribosomal protein L37 | 2 | 2 | ||||||||
MIRT702047 | METTL21A | methyltransferase like 21A | 2 | 2 | ||||||||
MIRT703034 | HAS2 | hyaluronan synthase 2 | 2 | 4 | ||||||||
MIRT704143 | DNAL1 | dynein axonemal light chain 1 | 2 | 2 | ||||||||
MIRT704759 | CDKN2AIPNL | CDKN2A interacting protein N-terminal like | 2 | 2 | ||||||||
MIRT705079 | C4orf29 | abhydrolase domain containing 18 | 2 | 2 | ||||||||
MIRT705346 | ATP1B3 | ATPase Na+/K+ transporting subunit beta 3 | 2 | 2 | ||||||||
MIRT706104 | ENTPD4 | ectonucleoside triphosphate diphosphohydrolase 4 | 2 | 2 | ||||||||
MIRT709070 | FAHD1 | fumarylacetoacetate hydrolase domain containing 1 | 2 | 2 | ||||||||
MIRT709534 | ZBED1 | zinc finger BED-type containing 1 | 2 | 2 | ||||||||
MIRT712356 | NAT14 | N-acetyltransferase 14 (putative) | 2 | 2 | ||||||||
MIRT713713 | PAOX | polyamine oxidase | 2 | 2 | ||||||||
MIRT714304 | ZNF454 | zinc finger protein 454 | 2 | 2 | ||||||||
MIRT714919 | PPP1R12C | protein phosphatase 1 regulatory subunit 12C | 2 | 2 | ||||||||
MIRT715792 | TBL3 | transducin beta like 3 | 2 | 2 | ||||||||
MIRT717376 | RBM41 | RNA binding motif protein 41 | 2 | 2 | ||||||||
MIRT719069 | ACOX1 | acyl-CoA oxidase 1 | 2 | 2 | ||||||||
MIRT724548 | HAUS2 | HAUS augmin like complex subunit 2 | 2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|