pre-miRNA Information
pre-miRNA hsa-mir-2115   
Genomic Coordinates chr3: 48316360 - 48316459
Description Homo sapiens miR-2115 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-2115-3p
Sequence 58| CAUCAGAAUUCAUGGAGGCUAG |79
Evidence Experimental
Experiments 454
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN31490809 22 COSMIC
COSN31579735 22 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs543123304 18 dbSNP
rs1450988157 21 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PPIL1   
Synonyms CGI-124, CYPL1, PPIase, hCyPX
Description peptidylprolyl isomerase like 1
Transcript NM_016059   
Expression
Putative miRNA Targets on PPIL1
3'UTR of PPIL1
(miRNA target sites are highlighted)
>PPIL1|NM_016059|3'UTR
   1 ACTTGCTACCCTCTTGAGCAGCTCTTCTGAGATGGCCCCAGTGAACCAGCTTCTAGATGACATAGAATGACATGTAATGC
  81 TAAATTCATTTTGGCTTTGCAAGTCATGAAGCTTAGGAGGCCTGGCATCTTGGGTGAGTTAGAGATGGAAGTACATTTTA
 161 ATAGGATGCTTCTTTTCTCTTCCCCCAGTGCCTAGGTTGCCAGAGCATTTGCACAAATGCCCCTGTTTATCAATAGGTGA
 241 CTACTTACTACACATGAACCATAATGCTGCTTCTTGTGCATGTCTGCTCTGATATACGTCGAACAATGTAGCAGCCACTG
 321 TCATTTCTCAGTGGTTTTGCCTAACCAAACTTCTTCCTAAGGAGATTTATATTCTGGCCTACACAGCAGTCCTTGATGGC
 401 TGACAGCCACAGAATTCCAAACCAAGTAGTGTCTGTCAGCCCTCTTAACTCTGTGCACGCCCTATTTCAGTCTTTTACAT
 481 TTGTTCTTCTAGGGAATGTATGCATCTCTATATATATTTTCCCTCTCAAAACCAGAACATCAACAGTGCTGTTTCTGACA
 561 CTTCAGACATCCCACGCAAAGCCACATTGAATTTTTGCCAAATGAAAAACACATCCAACAATCAAGTTTCTAAGAAGGTG
 641 TCAAGTGGGGAATAATAATAATGTATAATAATCAAGAAATTAGTTTATTAAAAGGAAGCAGAAGCATTGACCATTTTTTC
 721 CCAGAGAAGAGGAGAAATCTGTAGTGAGCAAAGGACAGACCATGAATCCTCCTTGAGAAGTAGTACTCTCAGAAAGGAGA
 801 AGCGCCACTCAAGTTCTTTTAACCCAAGACTTTAGAGAAATTAGGTCCAAGATTTTTATATGTTCAGTTGTTTATGTATA
 881 AAAATAACTTTCTGGATTTTGTGGGGAGGAGCAGGAGAGGAAGGAAGTTAATACCTATGTAATACATAGAAACTTCCACA
 961 ATAAAATGCCATTGATGGTTGAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' gaUCGGAGGUACUU------AAGACUac 5'
            | ||||: |||:      ||||||  
Target 5' ctACCCTCT-TGAGCAGCTCTTCTGAga 3'
6 - 32 133.00 -14.30
2
miRNA  3' gaUCGGAGGUACUU-----AAGA-CUAc 5'
            :||| | :||||     |||| ||| 
Target 5' atGGCCCCAGTGAACCAGCTTCTAGATg 3'
32 - 59 128.00 -17.00
3
miRNA  3' gauCGGAG-----GUAC--UUAAGACUAc 5'
             ||:||     ||||   : |||||| 
Target 5' gctGCTTCTTGTGCATGTCTGCTCTGATa 3'
266 - 294 121.00 -12.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26505833 10 COSMIC
COSN31548664 14 COSMIC
COSN26990033 44 COSMIC
COSN30526029 65 COSMIC
COSN20102784 84 COSMIC
COSN31508574 94 COSMIC
COSN31491800 100 COSMIC
COSN31563939 121 COSMIC
COSN30161257 129 COSMIC
COSN7871773 327 COSMIC
COSN30202436 389 COSMIC
COSN31543015 451 COSMIC
COSN29962444 458 COSMIC
COSN28753084 510 COSMIC
COSN31480535 510 COSMIC
COSN31534974 676 COSMIC
COSN31577253 812 COSMIC
COSN31528700 892 COSMIC
COSN31596185 936 COSMIC
COSN31534125 968 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1369619860 5 dbSNP
rs377723904 6 dbSNP
rs1036990995 7 dbSNP
rs771595095 8 dbSNP
rs747674364 10 dbSNP
rs1250969370 13 dbSNP
rs778594412 14 dbSNP
rs1207305796 21 dbSNP
rs754632657 23 dbSNP
rs749620457 24 dbSNP
rs780595778 29 dbSNP
rs756622470 31 dbSNP
rs374029091 34 dbSNP
rs999041504 36 dbSNP
rs768198408 37 dbSNP
rs181580627 38 dbSNP
rs751632638 39 dbSNP
rs764356881 40 dbSNP
rs890803700 54 dbSNP
rs1043730992 57 dbSNP
rs1051172902 62 dbSNP
rs1169896730 63 dbSNP
rs1370605611 72 dbSNP
rs559374122 73 dbSNP
rs1473878259 74 dbSNP
rs932407929 79 dbSNP
rs1292280348 84 dbSNP
rs397822691 86 dbSNP
rs1295320171 87 dbSNP
rs3216837 87 dbSNP
rs397709399 87 dbSNP
rs889155604 88 dbSNP
rs1230925525 95 dbSNP
rs1050494014 106 dbSNP
rs1410250304 110 dbSNP
rs1220425939 118 dbSNP
rs1263606072 127 dbSNP
rs113394669 130 dbSNP
rs921036506 149 dbSNP
rs1489431574 150 dbSNP
rs1191505632 162 dbSNP
rs1260816469 165 dbSNP
rs376035474 169 dbSNP
rs933398264 171 dbSNP
rs1190089653 177 dbSNP
rs1390467069 179 dbSNP
rs922389297 183 dbSNP
rs541134865 185 dbSNP
rs867787921 187 dbSNP
rs1353684665 200 dbSNP
rs976599333 203 dbSNP
rs1458882070 205 dbSNP
rs989883792 212 dbSNP
rs936856503 215 dbSNP
rs766992980 220 dbSNP
rs978377750 225 dbSNP
rs939903770 233 dbSNP
rs967337411 234 dbSNP
rs1386866092 248 dbSNP
rs1407046910 248 dbSNP
rs1298588400 250 dbSNP
rs908439921 252 dbSNP
rs1243783135 253 dbSNP
rs1314969506 254 dbSNP
rs115998546 264 dbSNP
rs1222179788 270 dbSNP
rs1163600456 272 dbSNP
rs1463368553 273 dbSNP
rs1210434502 276 dbSNP
rs1248192572 277 dbSNP
rs1443649626 281 dbSNP
rs1024996090 289 dbSNP
rs1473932275 291 dbSNP
rs1423927052 292 dbSNP
rs1413810800 295 dbSNP
rs984465652 297 dbSNP
rs952408484 298 dbSNP
rs992144354 300 dbSNP
rs116622182 301 dbSNP
rs1304852849 303 dbSNP
rs1033761267 306 dbSNP
rs1223351074 310 dbSNP
rs1476692002 311 dbSNP
rs1231553565 314 dbSNP
rs991161921 317 dbSNP
rs1327007243 323 dbSNP
rs959802425 343 dbSNP
rs1229944955 356 dbSNP
rs1268547779 357 dbSNP
rs1460567574 359 dbSNP
rs1207544950 363 dbSNP
rs1238891456 367 dbSNP
rs995547757 371 dbSNP
rs1035794143 374 dbSNP
rs1201375419 379 dbSNP
rs1452704121 388 dbSNP
rs143510745 395 dbSNP
rs998966170 396 dbSNP
rs1428990400 400 dbSNP
rs898330412 405 dbSNP
rs774078109 416 dbSNP
rs1413169107 417 dbSNP
rs1289771817 420 dbSNP
rs1178492775 423 dbSNP
rs1211969331 431 dbSNP
rs967974865 434 dbSNP
rs1360036215 436 dbSNP
rs1441485819 443 dbSNP
rs188374952 455 dbSNP
rs891013396 458 dbSNP
rs555320473 459 dbSNP
rs1050982784 460 dbSNP
rs759209626 462 dbSNP
rs899490165 482 dbSNP
rs1012276793 492 dbSNP
rs541821302 494 dbSNP
rs114579443 510 dbSNP
rs1280288281 511 dbSNP
rs1312413448 512 dbSNP
rs1249011879 518 dbSNP
rs544927723 518 dbSNP
rs1483773821 523 dbSNP
rs1183507317 527 dbSNP
rs1268876477 532 dbSNP
rs553065114 535 dbSNP
rs762784366 540 dbSNP
rs1193293526 541 dbSNP
rs773176576 544 dbSNP
rs1409636880 561 dbSNP
rs1042928978 564 dbSNP
rs1166747539 565 dbSNP
rs1372447988 566 dbSNP
rs1430535599 574 dbSNP
rs1331666844 575 dbSNP
rs945548853 576 dbSNP
rs1433947550 587 dbSNP
rs1276409069 597 dbSNP
rs1459453390 601 dbSNP
rs186337368 602 dbSNP
rs1390179855 604 dbSNP
rs1272101113 612 dbSNP
rs1036474821 616 dbSNP
rs1159198054 625 dbSNP
rs11553705 629 dbSNP
rs918192861 636 dbSNP
rs1289712982 638 dbSNP
rs1450410521 660 dbSNP
rs1224180995 662 dbSNP
rs939849395 666 dbSNP
rs908408413 670 dbSNP
rs1475312779 676 dbSNP
rs992362543 677 dbSNP
rs1186881905 683 dbSNP
rs570479739 697 dbSNP
rs1048298244 706 dbSNP
rs558698474 713 dbSNP
rs1163011923 720 dbSNP
rs926588130 734 dbSNP
rs536865478 735 dbSNP
rs991129240 739 dbSNP
rs1350230290 740 dbSNP
rs1192283061 741 dbSNP
rs963088568 744 dbSNP
rs879741218 756 dbSNP
rs1248755173 758 dbSNP
rs928372691 763 dbSNP
rs1015444991 774 dbSNP
rs977616236 774 dbSNP
rs1228422723 780 dbSNP
rs1004476697 781 dbSNP
rs1283119824 784 dbSNP
rs1315367809 788 dbSNP
rs569904820 791 dbSNP
rs1464716046 803 dbSNP
rs1029617008 804 dbSNP
rs1465524453 809 dbSNP
rs1345419942 813 dbSNP
rs1302646650 825 dbSNP
rs1473845287 826 dbSNP
rs1164916495 827 dbSNP
rs1438654679 836 dbSNP
rs953775234 840 dbSNP
rs780107194 844 dbSNP
rs1456445563 845 dbSNP
rs996762789 846 dbSNP
rs1318308735 853 dbSNP
rs899500407 858 dbSNP
rs1028967225 860 dbSNP
rs1435398503 864 dbSNP
rs1054095449 868 dbSNP
rs999968297 875 dbSNP
rs1246426737 877 dbSNP
rs1320651595 878 dbSNP
rs1329083536 911 dbSNP
rs548081317 912 dbSNP
rs1270444445 915 dbSNP
rs1330042254 927 dbSNP
rs1200059333 937 dbSNP
rs901868204 944 dbSNP
rs1429393658 946 dbSNP
rs1444195336 954 dbSNP
rs529995753 957 dbSNP
rs1046607 958 dbSNP
rs1036445262 961 dbSNP
rs945569765 972 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 51645.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 51645.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000373699.5 | 3UTR | UGUUUAUCAAUAGGUGACUACUUACUACACAUGAACCAUAAUGCUGCUUCUUGUGCAUGUCUGCUCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000373699.5 | 3UTR | UUUAUCAAUAGGUGACUACUUACUACACAUGAACCAUAAUGCUGCUUCUUGUGCAUGUCUGCUCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
UCEC 0.998 0.02 1.000 0.5 3 Click to see details
LIHC 0.89 0.05 0.800 0.1 4 Click to see details
STAD 0.952 0.1 1.000 0.5 3 Click to see details
LUSC 0.249 0.19 0.271 0.16 15 Click to see details
HNSC -0.197 0.25 -0.262 0.18 14 Click to see details
BRCA -0.089 0.32 -0.075 0.34 31 Click to see details
BLCA -0.099 0.43 -0.086 0.44 6 Click to see details
BLCA -0.099 0.43 -0.086 0.44 6 Click to see details
BLCA -0.099 0.43 -0.086 0.44 6 Click to see details
BLCA -0.099 0.43 -0.086 0.44 6 Click to see details
BLCA -0.099 0.43 -0.086 0.44 6 Click to see details
BLCA -0.099 0.43 -0.086 0.44 6 Click to see details
BLCA -0.099 0.43 -0.086 0.44 6 Click to see details
80 hsa-miR-2115-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT057089 DDIT4 DNA damage inducible transcript 4 2 2
MIRT071216 FCF1 FCF1, rRNA-processing protein 2 2
MIRT226901 RAD23B RAD23 homolog B, nucleotide excision repair protein 2 2
MIRT235961 BACH1 BTB domain and CNC homolog 1 2 2
MIRT294569 ZNF460 zinc finger protein 460 2 4
MIRT321046 RAC1 Rac family small GTPase 1 2 4
MIRT359666 NUS1 NUS1 dehydrodolichyl diphosphate synthase subunit 2 8
MIRT366451 KLHL15 kelch like family member 15 2 2
MIRT405375 ZBTB18 zinc finger and BTB domain containing 18 2 2
MIRT441794 TCEAL5 transcription elongation factor A like 5 2 2
MIRT443295 TCEAL3 transcription elongation factor A like 3 2 2
MIRT455275 DDX39B DExD-box helicase 39B 2 2
MIRT458523 C5orf22 chromosome 5 open reading frame 22 2 2
MIRT464960 TWIST1 twist family bHLH transcription factor 1 2 2
MIRT466848 STX6 syntaxin 6 2 2
MIRT469252 RHOB ras homolog family member B 2 2
MIRT469825 RAB14 RAB14, member RAS oncogene family 2 4
MIRT470047 PTGFRN prostaglandin F2 receptor inhibitor 2 2
MIRT471420 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT472024 NPM1 nucleophosmin 1 2 2
MIRT484156 CENPN centromere protein N 2 2
MIRT485490 HMGN2 high mobility group nucleosomal binding domain 2 2 2
MIRT490462 PROSER2 proline and serine rich 2 2 2
MIRT493069 MTCH1 mitochondrial carrier 1 2 2
MIRT493573 HSP90AA1 heat shock protein 90 alpha family class A member 1 2 8
MIRT494919 NDUFC2-KCTD14 NDUFC2-KCTD14 readthrough 2 2
MIRT500439 ZMAT3 zinc finger matrin-type 3 2 2
MIRT500931 SRPR SRP receptor alpha subunit 2 4
MIRT501551 POC1B-GALNT4 POC1B-GALNT4 readthrough 2 2
MIRT501809 NEURL1B neuralized E3 ubiquitin protein ligase 1B 2 2
MIRT502415 GALNT4 polypeptide N-acetylgalactosaminyltransferase 4 2 2
MIRT506504 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT507861 CCNE2 cyclin E2 2 2
MIRT510511 YOD1 YOD1 deubiquitinase 2 6
MIRT516073 RAB42 RAB42, member RAS oncogene family 2 2
MIRT519030 KYNU kynureninase 2 6
MIRT521762 PPIL1 peptidylprolyl isomerase like 1 2 4
MIRT522898 KCNJ3 potassium voltage-gated channel subfamily J member 3 2 4
MIRT527370 MGARP mitochondria localized glutamic acid rich protein 2 2
MIRT530691 C8orf46 chromosome 8 open reading frame 46 2 2
MIRT530867 TRUB1 TruB pseudouridine synthase family member 1 2 2
MIRT531832 MTPAP mitochondrial poly(A) polymerase 2 4
MIRT533035 ZBTB5 zinc finger and BTB domain containing 5 2 2
MIRT533165 WIPF2 WAS/WASL interacting protein family member 2 2 2
MIRT533464 TRIM71 tripartite motif containing 71 2 2
MIRT534331 SHCBP1 SHC binding and spindle associated 1 2 2
MIRT539372 ADSS adenylosuccinate synthase 2 6
MIRT545951 ZBTB10 zinc finger and BTB domain containing 10 2 2
MIRT553283 TSR1 TSR1, ribosome maturation factor 2 2
MIRT553532 TMEM185B transmembrane protein 185B 2 4
MIRT556480 LIPA lipase A, lysosomal acid type 2 2
MIRT556975 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT557697 GATA6 GATA binding protein 6 2 2
MIRT558901 CCDC58 coiled-coil domain containing 58 2 2
MIRT559224 BLMH bleomycin hydrolase 2 2
MIRT559827 SLPI secretory leukocyte peptidase inhibitor 2 2
MIRT563435 SLC3A2 solute carrier family 3 member 2 2 2
MIRT569270 PCDH11X protocadherin 11 X-linked 2 2
MIRT571386 JKAMP JNK1/MAPK8-associated membrane protein 2 2
MIRT572567 AFF1 AF4/FMR2 family member 1 2 2
MIRT610400 AR androgen receptor 2 2
MIRT611058 ZNF621 zinc finger protein 621 2 2
MIRT635118 TMEM233 transmembrane protein 233 2 2
MIRT641617 DEFB118 defensin beta 118 2 2
MIRT642146 CHORDC1 cysteine and histidine rich domain containing 1 2 2
MIRT647295 C8orf33 chromosome 8 open reading frame 33 2 2
MIRT648155 MPLKIP M-phase specific PLK1 interacting protein 2 2
MIRT652780 TENM3 teneurin transmembrane protein 3 2 2
MIRT657356 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 2 2
MIRT658718 ELN elastin 2 2
MIRT662441 RALGAPA1 Ral GTPase activating protein catalytic alpha subunit 1 2 2
MIRT665302 ZBTB38 zinc finger and BTB domain containing 38 2 2
MIRT699898 RUNX1 runt related transcription factor 1 2 2
MIRT700921 PDS5A PDS5 cohesin associated factor A 2 2
MIRT700992 PDE3A phosphodiesterase 3A 2 2
MIRT707397 DCAF4L1 DDB1 and CUL4 associated factor 4 like 1 2 2
MIRT711895 INSIG2 insulin induced gene 2 2 2
MIRT712072 XRCC5 X-ray repair cross complementing 5 2 2
MIRT716121 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT724470 SMAD2 SMAD family member 2 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-2115 Docetaxel+Cisplatin+5-Fluorouracil sensitive tissue (hypopharyngeal squamous cell carcinoma)
hsa-mir-2115 Decitabine 451668 approved sensitive tissue (esopheageal cancer)
hsa-miR-2115-3p Imatinib 5291 NSC743414 approved resistant High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-2115-3p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-2115-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-2115-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-2115-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-2115-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-2115-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)

Error report submission