miRTarBase - #MIRT523169


—
pre-miRNA Information
pre-miRNA hsa-mir-6737   
Genomic Coordinates chr1: 153962351 - 153962420
Description Homo sapiens miR-6737 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-6737-5p
Sequence 6| UUGGGGUGGUCGGCCCUGGAG |26
Evidence Experimental
Experiments Meta-analysis
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs766338599 4 dbSNP
rs765728788 7 dbSNP
rs757341439 9 dbSNP
rs539511149 11 dbSNP
rs764259486 12 dbSNP
rs988937601 21 dbSNP
Putative Targets

Gene Information
Gene Symbol HIST3H3   
Synonyms H3.4, H3/g, H3FT, H3t
Description histone cluster 3 H3
Transcript NM_003493   
Expression
Putative miRNA Targets on HIST3H3
3'UTR of HIST3H3
(miRNA target sites are highlighted)		 
>HIST3H3|NM_003493|3'UTR
   1 GAGGGCTATCTCGCCACCTGAGAGGTTGCGCAACGTTCACCCCAAAGGCTCTTTTAAGAGCCACCCACCT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gagguCCCG--GCUGGUGGGGUu 5'
               | ||  || :||||||| 
Target 5' aggttGCGCAACGTTCACCCCAa 3'
 23 - 45 150.00 -19.20
2 
miRNA  3' gaggUCCCG-----GCUGGUGGGGUu 5'
              |||||     || |||||: | 
Target 5' ---gAGGGCTATCTCG-CCACCTGAg 3'
 1 - 22 108.00 -18.40
3 
miRNA  3' gaggucccggCU-GGUGGGguu 5'
                    || ||||||   
Target 5' gctcttttaaGAGCCACCCacc 3'
 48 - 69 107.00 -15.92
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30477411 18 COSMIC
COSN30536537 23 COSMIC
COSN7986542 29 COSMIC
COSN26978875 30 COSMIC
COSN30182429 35 COSMIC
COSN30472210 40 COSMIC
COSN30165847 48 COSMIC
COSN30153744 55 COSMIC
COSN30185487 69 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs371210381 1 dbSNP
rs773231016 4 dbSNP
rs769567577 8 dbSNP
rs1199322935 12 dbSNP
rs376689247 13 dbSNP
rs780890873 15 dbSNP
rs543240992 16 dbSNP
rs370467281 17 dbSNP
rs1266493220 18 dbSNP
rs375752720 19 dbSNP
rs749863422 20 dbSNP
rs764686882 22 dbSNP
rs753240133 24 dbSNP
rs749845388 25 dbSNP
rs372508619 29 dbSNP
rs759918684 30 dbSNP
rs969644587 31 dbSNP
rs554749991 34 dbSNP
rs185324895 35 dbSNP
rs773212063 36 dbSNP
rs1048038897 39 dbSNP
rs748101693 40 dbSNP
rs1333379716 41 dbSNP
rs776537953 43 dbSNP
rs369956929 44 dbSNP
rs746743703 45 dbSNP
rs779716010 46 dbSNP
rs571588126 47 dbSNP
rs745500445 48 dbSNP
rs368646350 49 dbSNP
rs778350730 50 dbSNP
rs376448367 51 dbSNP
rs1175752108 59 dbSNP
rs897404180 62 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 8290.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gaggucccggcuGGUGGGGUu 5'
                      :||||||| 
Target 5' ------------UCACCCCAa 3'
 		1 - 9
Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000366696.1 | 3UTR | UCACCCCAAAGGCUCUUUUAAGAGCCACC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
67 hsa-miR-6737-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT066215 MARCH9 membrane associated ring-CH-type finger 9 2 2
MIRT074413 TNRC6A trinucleotide repeat containing 6A 2 2
MIRT125300 MID1IP1 MID1 interacting protein 1 2 2
MIRT153951 NCOA3 nuclear receptor coactivator 3 2 2
MIRT452776 FAM136A family with sequence similarity 136 member A 2 2
MIRT452977 CABP4 calcium binding protein 4 2 2
MIRT454128 FOXRED2 FAD dependent oxidoreductase domain containing 2 2 2
MIRT455242 DDX39B DExD-box helicase 39B 2 10
MIRT459007 UQCRH ubiquinol-cytochrome c reductase hinge protein 2 2
MIRT459463 MUC17 mucin 17, cell surface associated 2 4
MIRT460871 UBE2S ubiquitin conjugating enzyme E2 S 2 2
MIRT461264 COX10 COX10, heme A:farnesyltransferase cytochrome c oxidase assembly factor 2 2
MIRT464540 UBTF upstream binding transcription factor, RNA polymerase I 2 2
MIRT465268 TRIM28 tripartite motif containing 28 2 2
MIRT465871 TMEM43 transmembrane protein 43 2 4
MIRT466228 TMED10 transmembrane p24 trafficking protein 10 2 2
MIRT468417 SETD1B SET domain containing 1B 2 2
MIRT468684 SEC22C SEC22 homolog C, vesicle trafficking protein 2 4
MIRT473399 MDM4 MDM4, p53 regulator 2 2
MIRT473517 MAX MYC associated factor X 2 2
MIRT474511 KLHDC8A kelch domain containing 8A 2 2
MIRT475801 HDGF heparin binding growth factor 2 2
MIRT479493 CDH6 cadherin 6 2 2
MIRT480770 BMP2 bone morphogenetic protein 2 2 2
MIRT481418 ASB6 ankyrin repeat and SOCS box containing 6 2 2
MIRT482966 CSTF2 cleavage stimulation factor subunit 2 2 2
MIRT483380 SPATA6 spermatogenesis associated 6 2 4
MIRT483677 CYP11A1 cytochrome P450 family 11 subfamily A member 1 2 2
MIRT484328 EPN1 epsin 1 2 4
MIRT484963 UCK1 uridine-cytidine kinase 1 2 2
MIRT485908 PGPEP1 pyroglutamyl-peptidase I 2 4
MIRT488149 PRRC2B proline rich coiled-coil 2B 2 4
MIRT488943 CYP2W1 cytochrome P450 family 2 subfamily W member 1 2 6
MIRT491835 ZBTB7A zinc finger and BTB domain containing 7A 2 4
MIRT493026 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 2 2
MIRT499374 PLCG2 phospholipase C gamma 2 2 11
MIRT499723 USH1G USH1 protein network component sans 2 4
MIRT500349 ZNF385A zinc finger protein 385A 2 2
MIRT509574 HIST2H2AB histone cluster 2 H2A family member b 2 4
MIRT512794 GLRX glutaredoxin 2 2
MIRT513291 SETBP1 SET binding protein 1 2 2
MIRT515697 ZNF321P zinc finger protein 321, pseudogene 2 2
MIRT518255 LEAP2 liver enriched antimicrobial peptide 2 2 2
MIRT522026 PAQR3 progestin and adipoQ receptor family member 3 2 4
MIRT523169 HIST3H3 histone cluster 3 H3 2 2
MIRT524036 DNAJC8 DnaJ heat shock protein family (Hsp40) member C8 2 2
MIRT533476 TRIM71 tripartite motif containing 71 2 2
MIRT541488 ADM adrenomedullin 2 2
MIRT553987 SRPR SRP receptor alpha subunit 2 2
MIRT571445 YKT6 YKT6 v-SNARE homolog 2 2
MIRT574889 Plcg2 phospholipase C, gamma 2 2 7
MIRT607544 GLI2 GLI family zinc finger 2 2 2
MIRT607688 MAPK10 mitogen-activated protein kinase 10 2 2
MIRT610072 CRLF1 cytokine receptor like factor 1 2 2
MIRT610573 CACUL1 CDK2 associated cullin domain 1 2 2
MIRT614041 THBS2 thrombospondin 2 2 2
MIRT626318 LRTOMT leucine rich transmembrane and O-methyltransferase domain containing 2 2
MIRT634005 RIF1 replication timing regulatory factor 1 2 2
MIRT639619 FGF19 fibroblast growth factor 19 2 2
MIRT647343 RPH3AL rabphilin 3A like (without C2 domains) 2 2
MIRT689704 ATXN2 ataxin 2 2 2
MIRT691170 APOL6 apolipoprotein L6 2 2
MIRT693165 NPR1 natriuretic peptide receptor 1 2 2
MIRT711727 NUPL2 nucleoporin like 2 2 2
MIRT711806 ELN elastin 2 2
MIRT721546 FXN frataxin 2 2
MIRT722979 GDE1 glycerophosphodiester phosphodiesterase 1 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-6737 Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-6737 Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-6737-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-6737-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-6737-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-6737-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-6737-5p Paclitaxel 36314 NSC125973 approved resistant cell line (A2780)
hsa-miR-6737-5p Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-6737-5p Docetaxel+Cisplatin+5-Fluorouracil resistant tissue (hypopharyngeal squamous cell carcinoma)

Error report submission