miRTarBase - #MIRT523209


—
pre-miRNA Information
pre-miRNA hsa-mir-3921   
Genomic Coordinates chr3: 99964314 - 99964398
Description Homo sapiens miR-3921 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3921
Sequence 52| UCUCUGAGUACCAUAUGCCUUGU |74
Evidence Experimental
Experiments Illumina
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN7769671 6 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs758695096 5 dbSNP
rs539077798 6 dbSNP
rs954620527 10 dbSNP
rs1437951547 17 dbSNP
Putative Targets

Gene Information
Gene Symbol HIST1H3E   
Synonyms H3.1, H3/d, H3FD
Description histone cluster 1 H3 family member e
Transcript NM_003532   
Expression
Putative miRNA Targets on HIST1H3E
3'UTR of HIST1H3E
(miRNA target sites are highlighted)		 
>HIST1H3E|NM_003532|3'UTR
   1 ATTGTTTTGAGTACAAACCTTAAATCCAAAGGCTCTTCTCAGAGCCAACCA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ugUUCCGUAUACCAUGAGUCUCu 5'
            ||||| | |  | ||||||| 
Target 5' caAAGGC-TCT--T-CTCAGAGc 3'
 27 - 45 151.00 -14.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30159599 5 COSMIC
COSN30639833 9 COSMIC
COSN14213482 10 COSMIC
COSN30168374 16 COSMIC
COSN31597932 32 COSMIC
COSN30152255 41 COSMIC
COSN30697125 47 COSMIC
COSN31536906 52 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs773277981 1 dbSNP
rs760778419 2 dbSNP
rs1230358775 3 dbSNP
rs1313973074 4 dbSNP
rs751671835 5 dbSNP
rs1225893159 6 dbSNP
rs920571116 7 dbSNP
rs529783969 8 dbSNP
rs771180198 9 dbSNP
rs368171978 10 dbSNP
rs1484051584 12 dbSNP
rs1313689874 13 dbSNP
rs1193935238 17 dbSNP
rs777137696 19 dbSNP
rs1436862490 20 dbSNP
rs757613334 24 dbSNP
rs759970749 24 dbSNP
rs546277720 27 dbSNP
rs950209648 28 dbSNP
rs753162584 30 dbSNP
rs763205911 32 dbSNP
rs774369429 34 dbSNP
rs750002449 36 dbSNP
rs755705143 37 dbSNP
rs765927305 38 dbSNP
rs767851095 38 dbSNP
rs546137162 39 dbSNP
rs1435774344 40 dbSNP
rs750607982 40 dbSNP
rs1271867359 41 dbSNP
rs756516716 41 dbSNP
rs1303727935 42 dbSNP
rs755028807 43 dbSNP
rs201983434 44 dbSNP
rs1271140960 46 dbSNP
rs748020556 47 dbSNP
rs758091819 48 dbSNP
rs778081496 49 dbSNP
rs532694665 51 dbSNP
rs745936646 52 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 8353.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ugUUCCGUAUACCAUGAGUCucu 5'
            ||||| | |  | |||||   
Target 5' caAAGGC-UCU--U-CUCAG--- 3'
 		7 - 22
Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000360408.1 | 3UTR | UAAAUCCAAAGGCUCUUCUCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
Click to see details
77 hsa-miR-3921 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT118184 ZNF544 zinc finger protein 544 2 2
MIRT332934 PRKAB2 protein kinase AMP-activated non-catalytic subunit beta 2 2 2
MIRT442165 ARL10 ADP ribosylation factor like GTPase 10 2 2
MIRT442388 CLVS2 clavesin 2 2 2
MIRT442594 SIX1 SIX homeobox 1 2 2
MIRT448015 HLA-DOA major histocompatibility complex, class II, DO alpha 2 2
MIRT448062 MMP15 matrix metallopeptidase 15 2 2
MIRT489018 C1QTNF6 C1q and TNF related 6 2 2
MIRT494457 BTG2 BTG anti-proliferation factor 2 2 2
MIRT495651 SLC35B2 solute carrier family 35 member B2 2 2
MIRT504018 ACSL6 acyl-CoA synthetase long chain family member 6 2 2
MIRT506778 KLHL15 kelch like family member 15 2 4
MIRT507230 FOXN2 forkhead box N2 2 4
MIRT512551 MFN2 mitofusin 2 2 6
MIRT512843 A1CF APOBEC1 complementation factor 2 6
MIRT513943 DDX3X DEAD-box helicase 3, X-linked 2 8
MIRT516104 GADL1 glutamate decarboxylase like 1 2 4
MIRT519832 ZFP69B ZFP69 zinc finger protein B 2 4
MIRT523209 HIST1H3E histone cluster 1 H3 family member e 2 2
MIRT525007 ACTN4 actinin alpha 4 2 6
MIRT528859 PKP1 plakophilin 1 2 2
MIRT529061 ZNF675 zinc finger protein 675 2 2
MIRT531720 TARS threonyl-tRNA synthetase 2 2
MIRT534038 STK4 serine/threonine kinase 4 2 2
MIRT543849 APIP APAF1 interacting protein 2 2
MIRT545865 ZNF264 zinc finger protein 264 2 4
MIRT556038 MXD1 MAX dimerization protein 1 2 2
MIRT561346 ZBTB18 zinc finger and BTB domain containing 18 2 2
MIRT562706 ZNF415 zinc finger protein 415 2 2
MIRT563224 ZNF286A zinc finger protein 286A 2 2
MIRT563861 ZNF616 zinc finger protein 616 2 4
MIRT563880 PAGR1 PAXIP1 associated glutamate rich protein 1 2 2
MIRT564653 ZNF487P zinc finger protein 487 1 1
MIRT566596 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 2
MIRT570879 ZFP1 ZFP1 zinc finger protein 2 2
MIRT573069 TRIB1 tribbles pseudokinase 1 2 2
MIRT573940 ZNF708 zinc finger protein 708 2 2
MIRT575967 Slfn5 schlafen 5 2 5
MIRT607294 CD300E CD300e molecule 2 4
MIRT608188 ERBB2 erb-b2 receptor tyrosine kinase 2 2 2
MIRT609538 ADPRH ADP-ribosylarginine hydrolase 2 2
MIRT610153 PRMT8 protein arginine methyltransferase 8 2 4
MIRT611572 SLFN5 schlafen family member 5 2 7
MIRT613336 AGO2 argonaute 2, RISC catalytic component 2 4
MIRT616561 ZNF512B zinc finger protein 512B 2 2
MIRT617239 SPATS2 spermatogenesis associated serine rich 2 2 2
MIRT618012 SLC9A3R2 SLC9A3 regulator 2 2 2
MIRT618479 IL17REL interleukin 17 receptor E like 2 2
MIRT619100 IFI44L interferon induced protein 44 like 2 2
MIRT622266 SH3TC2 SH3 domain and tetratricopeptide repeats 2 2 2
MIRT623081 NME6 NME/NM23 nucleoside diphosphate kinase 6 2 2
MIRT625622 LILRB2 leukocyte immunoglobulin like receptor B2 2 2
MIRT627845 PLEKHA6 pleckstrin homology domain containing A6 2 2
MIRT630460 GMPS guanine monophosphate synthase 2 2
MIRT630525 BAZ2A bromodomain adjacent to zinc finger domain 2A 2 4
MIRT631503 TAF8 TATA-box binding protein associated factor 8 2 2
MIRT634538 MRPS17 mitochondrial ribosomal protein S17 2 2
MIRT638808 DCTN3 dynactin subunit 3 2 2
MIRT641304 SLAMF1 signaling lymphocytic activation molecule family member 1 2 2
MIRT648348 PPP1R16B protein phosphatase 1 regulatory subunit 16B 2 2
MIRT649706 ZNF175 zinc finger protein 175 2 2
MIRT652555 TLX1 T-cell leukemia homeobox 1 2 2
MIRT655563 P2RX7 purinergic receptor P2X 7 2 2
MIRT659066 DEPTOR DEP domain containing MTOR interacting protein 2 2
MIRT660342 BCAT1 branched chain amino acid transaminase 1 2 2
MIRT664331 RAB8A RAB8A, member RAS oncogene family 2 2
MIRT688935 ATXN7L3B ataxin 7 like 3B 2 2
MIRT689972 ZNF185 zinc finger protein 185 with LIM domain 2 2
MIRT699515 SKIL SKI like proto-oncogene 2 2
MIRT699976 RREB1 ras responsive element binding protein 1 2 2
MIRT702675 IRS2 insulin receptor substrate 2 2 2
MIRT709358 ULK2 unc-51 like autophagy activating kinase 2 2 2
MIRT709838 PAQR7 progestin and adipoQ receptor family member 7 2 2
MIRT718717 ANKRD18A ankyrin repeat domain 18A 2 2
MIRT718880 PDIA3 protein disulfide isomerase family A member 3 2 2
MIRT724106 TMEM199 transmembrane protein 199 2 2
MIRT724764 PSG4 pregnancy specific beta-1-glycoprotein 4 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-3921 Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-3921 Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (SGC7901)
hsa-miR-3921 Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-3921 Paclitaxel 36314 NSC125973 approved resistant cell line (BAS)
hsa-miR-3921 Doxorubicin 31703 NSC123127 approved resistant cell line (BAS)
hsa-miR-3921 Tamoxifen+Fulvestrant sensitive cell line (LCC9)
hsa-miR-3921 Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-3921 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-3921 Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide/Methotrexate/Gemcitabine resistant cell line (Bats-72)

Error report submission