miRTarBase - #MIRT523210


—
pre-miRNA Information
pre-miRNA hsa-mir-4653   
Genomic Coordinates chr7: 101159473 - 101159555
Description Homo sapiens miR-4653 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4653-5p
Sequence 10| UCUCUGAGCAAGGCUUAACACC |31
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs566953516 2 dbSNP
rs1307365749 4 dbSNP
rs1226652366 6 dbSNP
rs1216592229 12 dbSNP
rs1283699546 15 dbSNP
rs934609749 20 dbSNP
rs1377199291 21 dbSNP
rs1282994534 22 dbSNP
Putative Targets

Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
B8DF7B miR-4653 Predictive Biomarker (PRD) Transcriptomic Data . . . .
Gene Information
Gene Symbol HIST1H3E   
Synonyms H3.1, H3/d, H3FD
Description histone cluster 1 H3 family member e
Transcript NM_003532   
Expression
Putative miRNA Targets on HIST1H3E
3'UTR of HIST1H3E
(miRNA target sites are highlighted)		 
>HIST1H3E|NM_003532|3'UTR
   1 ATTGTTTTGAGTACAAACCTTAAATCCAAAGGCTCTTCTCAGAGCCAACCA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ccacaaUUCGGAACGAGUCUCu 5'
                |:||: | ||||||| 
Target 5' atccaaAGGCTCTTCTCAGAGc 3'
 24 - 45 156.00 -15.50
2 
miRNA  3' ccacaauucggAACGAGUCUCu 5'
                     |||:|: ||| 
Target 5' ----------aTTGTTTTGAGt 3'
 1 - 12 91.00 -6.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30159599 5 COSMIC
COSN30639833 9 COSMIC
COSN14213482 10 COSMIC
COSN30168374 16 COSMIC
COSN31597932 32 COSMIC
COSN30152255 41 COSMIC
COSN30697125 47 COSMIC
COSN31536906 52 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs773277981 1 dbSNP
rs760778419 2 dbSNP
rs1230358775 3 dbSNP
rs1313973074 4 dbSNP
rs751671835 5 dbSNP
rs1225893159 6 dbSNP
rs920571116 7 dbSNP
rs529783969 8 dbSNP
rs771180198 9 dbSNP
rs368171978 10 dbSNP
rs1484051584 12 dbSNP
rs1313689874 13 dbSNP
rs1193935238 17 dbSNP
rs777137696 19 dbSNP
rs1436862490 20 dbSNP
rs757613334 24 dbSNP
rs759970749 24 dbSNP
rs546277720 27 dbSNP
rs950209648 28 dbSNP
rs753162584 30 dbSNP
rs763205911 32 dbSNP
rs774369429 34 dbSNP
rs750002449 36 dbSNP
rs755705143 37 dbSNP
rs765927305 38 dbSNP
rs767851095 38 dbSNP
rs546137162 39 dbSNP
rs1435774344 40 dbSNP
rs750607982 40 dbSNP
rs1271867359 41 dbSNP
rs756516716 41 dbSNP
rs1303727935 42 dbSNP
rs755028807 43 dbSNP
rs201983434 44 dbSNP
rs1271140960 46 dbSNP
rs748020556 47 dbSNP
rs758091819 48 dbSNP
rs778081496 49 dbSNP
rs532694665 51 dbSNP
rs745936646 52 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 8353.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ccacaaUUCGGAACGAGUCucu 5'
                |:||: | |||||   
Target 5' auccaaAGGCUCUUCUCAG--- 3'
 		4 - 22
Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000360408.1 | 3UTR | UAAAUCCAAAGGCUCUUCUCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
78 hsa-miR-4653-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT118186 ZNF544 zinc finger protein 544 2 2
MIRT332935 PRKAB2 protein kinase AMP-activated non-catalytic subunit beta 2 2 2
MIRT442166 ARL10 ADP ribosylation factor like GTPase 10 2 2
MIRT442387 CLVS2 clavesin 2 2 2
MIRT442595 SIX1 SIX homeobox 1 2 2
MIRT448014 HLA-DOA major histocompatibility complex, class II, DO alpha 2 2
MIRT448061 MMP15 matrix metallopeptidase 15 2 2
MIRT489017 C1QTNF6 C1q and TNF related 6 2 2
MIRT494456 BTG2 BTG anti-proliferation factor 2 2 2
MIRT495650 SLC35B2 solute carrier family 35 member B2 2 2
MIRT504016 ACSL6 acyl-CoA synthetase long chain family member 6 2 2
MIRT506777 KLHL15 kelch like family member 15 2 4
MIRT507229 FOXN2 forkhead box N2 2 4
MIRT512550 MFN2 mitofusin 2 2 6
MIRT512842 A1CF APOBEC1 complementation factor 2 6
MIRT513944 DDX3X DEAD-box helicase 3, X-linked 2 8
MIRT516103 GADL1 glutamate decarboxylase like 1 2 4
MIRT519831 ZFP69B ZFP69 zinc finger protein B 2 4
MIRT523210 HIST1H3E histone cluster 1 H3 family member e 2 2
MIRT525008 ACTN4 actinin alpha 4 2 6
MIRT528858 PKP1 plakophilin 1 2 2
MIRT529062 ZNF675 zinc finger protein 675 2 2
MIRT531719 TARS threonyl-tRNA synthetase 2 2
MIRT534039 STK4 serine/threonine kinase 4 2 2
MIRT543848 APIP APAF1 interacting protein 2 2
MIRT545866 ZNF264 zinc finger protein 264 2 4
MIRT556037 MXD1 MAX dimerization protein 1 2 2
MIRT557081 HOXB3 homeobox B3 2 2
MIRT561345 ZBTB18 zinc finger and BTB domain containing 18 2 2
MIRT562705 ZNF415 zinc finger protein 415 2 2
MIRT563223 ZNF286A zinc finger protein 286A 2 2
MIRT563860 ZNF616 zinc finger protein 616 2 4
MIRT563879 PAGR1 PAXIP1 associated glutamate rich protein 1 2 2
MIRT564652 ZNF487P zinc finger protein 487 1 1
MIRT566595 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 2
MIRT570878 ZFP1 ZFP1 zinc finger protein 2 2
MIRT573067 TRIB1 tribbles pseudokinase 1 2 2
MIRT573941 ZNF708 zinc finger protein 708 2 2
MIRT575966 Slfn5 schlafen 5 2 5
MIRT607293 CD300E CD300e molecule 2 4
MIRT608187 ERBB2 erb-b2 receptor tyrosine kinase 2 2 2
MIRT609537 ADPRH ADP-ribosylarginine hydrolase 2 2
MIRT610152 PRMT8 protein arginine methyltransferase 8 2 4
MIRT611571 SLFN5 schlafen family member 5 2 7
MIRT613335 AGO2 argonaute 2, RISC catalytic component 2 4
MIRT616560 ZNF512B zinc finger protein 512B 2 2
MIRT617240 SPATS2 spermatogenesis associated serine rich 2 2 2
MIRT618011 SLC9A3R2 SLC9A3 regulator 2 2 2
MIRT618478 IL17REL interleukin 17 receptor E like 2 2
MIRT619099 IFI44L interferon induced protein 44 like 2 2
MIRT622265 SH3TC2 SH3 domain and tetratricopeptide repeats 2 2 2
MIRT623080 NME6 NME/NM23 nucleoside diphosphate kinase 6 2 2
MIRT625621 LILRB2 leukocyte immunoglobulin like receptor B2 2 2
MIRT627844 PLEKHA6 pleckstrin homology domain containing A6 2 2
MIRT630459 GMPS guanine monophosphate synthase 2 2
MIRT630524 BAZ2A bromodomain adjacent to zinc finger domain 2A 2 4
MIRT631502 TAF8 TATA-box binding protein associated factor 8 2 2
MIRT634537 MRPS17 mitochondrial ribosomal protein S17 2 2
MIRT638807 DCTN3 dynactin subunit 3 2 2
MIRT641303 SLAMF1 signaling lymphocytic activation molecule family member 1 2 2
MIRT648347 PPP1R16B protein phosphatase 1 regulatory subunit 16B 2 2
MIRT649705 ZNF175 zinc finger protein 175 2 2
MIRT652554 TLX1 T-cell leukemia homeobox 1 2 2
MIRT655564 P2RX7 purinergic receptor P2X 7 2 2
MIRT659065 DEPTOR DEP domain containing MTOR interacting protein 2 2
MIRT660341 BCAT1 branched chain amino acid transaminase 1 2 2
MIRT664330 RAB8A RAB8A, member RAS oncogene family 2 2
MIRT688934 ATXN7L3B ataxin 7 like 3B 2 2
MIRT689971 ZNF185 zinc finger protein 185 with LIM domain 2 2
MIRT699514 SKIL SKI like proto-oncogene 2 2
MIRT699975 RREB1 ras responsive element binding protein 1 2 2
MIRT702676 IRS2 insulin receptor substrate 2 2 2
MIRT709357 ULK2 unc-51 like autophagy activating kinase 2 2 2
MIRT709837 PAQR7 progestin and adipoQ receptor family member 7 2 2
MIRT718716 ANKRD18A ankyrin repeat domain 18A 2 2
MIRT718879 PDIA3 protein disulfide isomerase family A member 3 2 2
MIRT724105 TMEM199 transmembrane protein 199 2 2
MIRT724763 PSG4 pregnancy specific beta-1-glycoprotein 4 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4653 Paclitaxel 36314 NSC125973 approved sensitive High Nasopharyngeal Cancer cell line (CNE-1)
hsa-mir-4653 Paclitaxel 36314 NSC125973 approved sensitive High Nasopharyngeal Cancer cell line (CNE-1)
hsa-mir-4653 Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-4653-5p Gefitinib 123631 NSC715055 approved resistant cell line (PC9)

Error report submission