pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4653 |
Genomic Coordinates | chr7: 101159473 - 101159555 |
Description | Homo sapiens miR-4653 stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | ||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4653-5p | |||||||||||||||||||||||||||
Sequence | 10| UCUCUGAGCAAGGCUUAACACC |31 | |||||||||||||||||||||||||||
Evidence | Experimental | |||||||||||||||||||||||||||
Experiments | Illumina | |||||||||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||||||||
Putative Targets |
Biomarker Information |
|
---|
Gene Information | ||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | HIST1H3E | |||||||||||||||
Synonyms | H3.1, H3/d, H3FD | |||||||||||||||
Description | histone cluster 1 H3 family member e | |||||||||||||||
Transcript | NM_003532 | |||||||||||||||
Expression | ||||||||||||||||
Putative miRNA Targets on HIST1H3E | ||||||||||||||||
3'UTR of HIST1H3E (miRNA target sites are highlighted) |
>HIST1H3E|NM_003532|3'UTR 1 ATTGTTTTGAGTACAAACCTTAAATCCAAAGGCTCTTCTCAGAGCCAACCA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
|||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
|||||||||||||||
DRVs in gene 3'UTRs | ||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293 | ||||||
Disease | 8353.0 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
CLIP-seq Support 1 for dataset GSM1065667 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_6 |
Location of target site | ENST00000360408.1 | 3UTR | UAAAUCCAAAGGCUCUUCUCAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23446348 / GSE43573 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
78 hsa-miR-4653-5p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT118186 | ZNF544 | zinc finger protein 544 | 2 | 2 | ||||||||
MIRT332935 | PRKAB2 | protein kinase AMP-activated non-catalytic subunit beta 2 | 2 | 2 | ||||||||
MIRT442166 | ARL10 | ADP ribosylation factor like GTPase 10 | 2 | 2 | ||||||||
MIRT442387 | CLVS2 | clavesin 2 | 2 | 2 | ||||||||
MIRT442595 | SIX1 | SIX homeobox 1 | 2 | 2 | ||||||||
MIRT448014 | HLA-DOA | major histocompatibility complex, class II, DO alpha | 2 | 2 | ||||||||
MIRT448061 | MMP15 | matrix metallopeptidase 15 | 2 | 2 | ||||||||
MIRT489017 | C1QTNF6 | C1q and TNF related 6 | 2 | 2 | ||||||||
MIRT494456 | BTG2 | BTG anti-proliferation factor 2 | 2 | 2 | ||||||||
MIRT495650 | SLC35B2 | solute carrier family 35 member B2 | 2 | 2 | ||||||||
MIRT504016 | ACSL6 | acyl-CoA synthetase long chain family member 6 | 2 | 2 | ||||||||
MIRT506777 | KLHL15 | kelch like family member 15 | 2 | 4 | ||||||||
MIRT507229 | FOXN2 | forkhead box N2 | 2 | 4 | ||||||||
MIRT512550 | MFN2 | mitofusin 2 | 2 | 6 | ||||||||
MIRT512842 | A1CF | APOBEC1 complementation factor | 2 | 6 | ||||||||
MIRT513944 | DDX3X | DEAD-box helicase 3, X-linked | 2 | 8 | ||||||||
MIRT516103 | GADL1 | glutamate decarboxylase like 1 | 2 | 4 | ||||||||
MIRT519831 | ZFP69B | ZFP69 zinc finger protein B | 2 | 4 | ||||||||
MIRT523210 | HIST1H3E | histone cluster 1 H3 family member e | 2 | 2 | ||||||||
MIRT525008 | ACTN4 | actinin alpha 4 | 2 | 6 | ||||||||
MIRT528858 | PKP1 | plakophilin 1 | 2 | 2 | ||||||||
MIRT529062 | ZNF675 | zinc finger protein 675 | 2 | 2 | ||||||||
MIRT531719 | TARS | threonyl-tRNA synthetase | 2 | 2 | ||||||||
MIRT534039 | STK4 | serine/threonine kinase 4 | 2 | 2 | ||||||||
MIRT543848 | APIP | APAF1 interacting protein | 2 | 2 | ||||||||
MIRT545866 | ZNF264 | zinc finger protein 264 | 2 | 4 | ||||||||
MIRT556037 | MXD1 | MAX dimerization protein 1 | 2 | 2 | ||||||||
MIRT557081 | HOXB3 | homeobox B3 | 2 | 2 | ||||||||
MIRT561345 | ZBTB18 | zinc finger and BTB domain containing 18 | 2 | 2 | ||||||||
MIRT562705 | ZNF415 | zinc finger protein 415 | 2 | 2 | ||||||||
MIRT563223 | ZNF286A | zinc finger protein 286A | 2 | 2 | ||||||||
MIRT563860 | ZNF616 | zinc finger protein 616 | 2 | 4 | ||||||||
MIRT563879 | PAGR1 | PAXIP1 associated glutamate rich protein 1 | 2 | 2 | ||||||||
MIRT564652 | ZNF487P | zinc finger protein 487 | 1 | 1 | ||||||||
MIRT566595 | NUFIP2 | NUFIP2, FMR1 interacting protein 2 | 2 | 2 | ||||||||
MIRT570878 | ZFP1 | ZFP1 zinc finger protein | 2 | 2 | ||||||||
MIRT573067 | TRIB1 | tribbles pseudokinase 1 | 2 | 2 | ||||||||
MIRT573941 | ZNF708 | zinc finger protein 708 | 2 | 2 | ||||||||
MIRT575966 | Slfn5 | schlafen 5 | 2 | 5 | ||||||||
MIRT607293 | CD300E | CD300e molecule | 2 | 4 | ||||||||
MIRT608187 | ERBB2 | erb-b2 receptor tyrosine kinase 2 | 2 | 2 | ||||||||
MIRT609537 | ADPRH | ADP-ribosylarginine hydrolase | 2 | 2 | ||||||||
MIRT610152 | PRMT8 | protein arginine methyltransferase 8 | 2 | 4 | ||||||||
MIRT611571 | SLFN5 | schlafen family member 5 | 2 | 7 | ||||||||
MIRT613335 | AGO2 | argonaute 2, RISC catalytic component | 2 | 4 | ||||||||
MIRT616560 | ZNF512B | zinc finger protein 512B | 2 | 2 | ||||||||
MIRT617240 | SPATS2 | spermatogenesis associated serine rich 2 | 2 | 2 | ||||||||
MIRT618011 | SLC9A3R2 | SLC9A3 regulator 2 | 2 | 2 | ||||||||
MIRT618478 | IL17REL | interleukin 17 receptor E like | 2 | 2 | ||||||||
MIRT619099 | IFI44L | interferon induced protein 44 like | 2 | 2 | ||||||||
MIRT622265 | SH3TC2 | SH3 domain and tetratricopeptide repeats 2 | 2 | 2 | ||||||||
MIRT623080 | NME6 | NME/NM23 nucleoside diphosphate kinase 6 | 2 | 2 | ||||||||
MIRT625621 | LILRB2 | leukocyte immunoglobulin like receptor B2 | 2 | 2 | ||||||||
MIRT627844 | PLEKHA6 | pleckstrin homology domain containing A6 | 2 | 2 | ||||||||
MIRT630459 | GMPS | guanine monophosphate synthase | 2 | 2 | ||||||||
MIRT630524 | BAZ2A | bromodomain adjacent to zinc finger domain 2A | 2 | 4 | ||||||||
MIRT631502 | TAF8 | TATA-box binding protein associated factor 8 | 2 | 2 | ||||||||
MIRT634537 | MRPS17 | mitochondrial ribosomal protein S17 | 2 | 2 | ||||||||
MIRT638807 | DCTN3 | dynactin subunit 3 | 2 | 2 | ||||||||
MIRT641303 | SLAMF1 | signaling lymphocytic activation molecule family member 1 | 2 | 2 | ||||||||
MIRT648347 | PPP1R16B | protein phosphatase 1 regulatory subunit 16B | 2 | 2 | ||||||||
MIRT649705 | ZNF175 | zinc finger protein 175 | 2 | 2 | ||||||||
MIRT652554 | TLX1 | T-cell leukemia homeobox 1 | 2 | 2 | ||||||||
MIRT655564 | P2RX7 | purinergic receptor P2X 7 | 2 | 2 | ||||||||
MIRT659065 | DEPTOR | DEP domain containing MTOR interacting protein | 2 | 2 | ||||||||
MIRT660341 | BCAT1 | branched chain amino acid transaminase 1 | 2 | 2 | ||||||||
MIRT664330 | RAB8A | RAB8A, member RAS oncogene family | 2 | 2 | ||||||||
MIRT688934 | ATXN7L3B | ataxin 7 like 3B | 2 | 2 | ||||||||
MIRT689971 | ZNF185 | zinc finger protein 185 with LIM domain | 2 | 2 | ||||||||
MIRT699514 | SKIL | SKI like proto-oncogene | 2 | 2 | ||||||||
MIRT699975 | RREB1 | ras responsive element binding protein 1 | 2 | 2 | ||||||||
MIRT702676 | IRS2 | insulin receptor substrate 2 | 2 | 2 | ||||||||
MIRT709357 | ULK2 | unc-51 like autophagy activating kinase 2 | 2 | 2 | ||||||||
MIRT709837 | PAQR7 | progestin and adipoQ receptor family member 7 | 2 | 2 | ||||||||
MIRT718716 | ANKRD18A | ankyrin repeat domain 18A | 2 | 2 | ||||||||
MIRT718879 | PDIA3 | protein disulfide isomerase family A member 3 | 2 | 2 | ||||||||
MIRT724105 | TMEM199 | transmembrane protein 199 | 2 | 2 | ||||||||
MIRT724763 | PSG4 | pregnancy specific beta-1-glycoprotein 4 | 2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|