miRTarBase - #MIRT523297


—
pre-miRNA Information
pre-miRNA hsa-mir-4260   
Genomic Coordinates chr1: 209623444 - 209623510
Description Homo sapiens miR-4260 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4260
Sequence 11| CUUGGGGCAUGGAGUCCCA |29
Evidence Experimental
Experiments SOLiD
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSM7908770 6 COSMIC
COSN30117883 7 COSMIC
COSN26730871 12 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs372999583 2 dbSNP
rs1367351910 8 dbSNP
rs1266505194 15 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol HIST1H1B   
Synonyms H1, H1.5, H1B, H1F5, H1s-3
Description histone cluster 1 H1 family member b
Transcript NM_005322   
Expression
Putative miRNA Targets on HIST1H1B
3'UTR of HIST1H1B
(miRNA target sites are highlighted)		 
>HIST1H1B|NM_005322|3'UTR
   1 GAAGCTGGCGTGTGAAAACCGCAACAAAGCCCCAAAGGCTCTTTTCAGAGCCACCCA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' acccugaGGUACGGGGUUc 5'
                 | | ||||||| 
Target 5' accgcaaCAAAGCCCCAAa 3'
 18 - 36 144.00 -11.40
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs761830069 1 dbSNP
rs1346618835 4 dbSNP
rs745982828 5 dbSNP
rs373228054 7 dbSNP
rs774294960 7 dbSNP
rs1232856731 9 dbSNP
rs200694888 10 dbSNP
rs757437247 12 dbSNP
rs1166525921 19 dbSNP
rs1433581952 19 dbSNP
rs1045222657 20 dbSNP
rs777396714 21 dbSNP
rs1335218065 22 dbSNP
rs1416550005 24 dbSNP
rs1311541960 25 dbSNP
rs1400256331 28 dbSNP
rs758258162 30 dbSNP
rs1430473128 31 dbSNP
rs752629759 32 dbSNP
rs1377404061 33 dbSNP
rs551601447 36 dbSNP
rs765296415 39 dbSNP
rs1412473921 41 dbSNP
rs1241466922 44 dbSNP
rs759048851 49 dbSNP
rs1443929505 51 dbSNP
rs189943002 52 dbSNP
rs1415441547 55 dbSNP
rs1279260525 58 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 3009.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' acccugagguacGGGGUUc 5'
                      |||||| 
Target 5' ------------CCCCAAa 3'
 		1 - 7
Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000331442.3 | 3UTR | CCCCAAAGGCUCUUUUCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
66 hsa-miR-4260 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT074404 TNRC6A trinucleotide repeat containing 6A 2 2
MIRT289774 PER1 period circadian clock 1 2 2
MIRT442576 HOXD9 homeobox D9 2 2
MIRT443878 CNKSR3 CNKSR family member 3 2 2
MIRT449080 XPO6 exportin 6 2 2
MIRT450294 DRAXIN dorsal inhibitory axon guidance protein 2 2
MIRT461785 FXR2 FMR1 autosomal homolog 2 2 2
MIRT463931 WNT10B Wnt family member 10B 2 2
MIRT464860 UBB ubiquitin B 2 8
MIRT467619 SLC7A5 solute carrier family 7 member 5 2 2
MIRT469649 RAC1 Rac family small GTPase 1 2 2
MIRT473421 MDM4 MDM4, p53 regulator 2 2
MIRT473646 MARCKSL1 MARCKS like 1 2 2
MIRT474213 LCOR ligand dependent nuclear receptor corepressor 2 2
MIRT474335 KMT2D lysine methyltransferase 2D 2 2
MIRT474871 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 2 2
MIRT477440 ELOVL5 ELOVL fatty acid elongase 5 2 2
MIRT478432 DAZAP2 DAZ associated protein 2 2 2
MIRT479851 CCDC6 coiled-coil domain containing 6 2 2
MIRT482507 ACTB actin beta 2 2
MIRT485473 IGF1R insulin like growth factor 1 receptor 2 8
MIRT485670 CCDC64 BICD family like cargo adaptor 1 2 4
MIRT485902 PGPEP1 pyroglutamyl-peptidase I 2 4
MIRT488143 PRRC2B proline rich coiled-coil 2B 2 4
MIRT489455 MSC musculin 2 2
MIRT509568 HIST2H2AB histone cluster 2 H2A family member b 2 4
MIRT513093 DYNAP dynactin associated protein 2 2
MIRT513256 CALM3 calmodulin 3 2 2
MIRT514356 UBBP4 ubiquitin B pseudogene 4 2 6
MIRT522019 PAQR3 progestin and adipoQ receptor family member 3 2 4
MIRT523164 HIST3H3 histone cluster 3 H3 2 2
MIRT523297 HIST1H1B histone cluster 1 H1 family member b 2 2
MIRT524782 BAG5 BCL2 associated athanogene 5 2 2
MIRT530921 SCIN scinderin 2 2
MIRT533302 USP44 ubiquitin specific peptidase 44 2 2
MIRT552782 YIPF4 Yip1 domain family member 4 2 4
MIRT553981 SRPR SRP receptor alpha subunit 2 2
MIRT563126 ZNF215 zinc finger protein 215 2 2
MIRT569025 IL21R interleukin 21 receptor 2 2
MIRT573413 RPL18A ribosomal protein L18a 2 2
MIRT574877 Dnajc6 DnaJ heat shock protein family (Hsp40) member C6 2 3
MIRT607538 GLI2 GLI family zinc finger 2 2 2
MIRT607682 MAPK10 mitogen-activated protein kinase 10 2 3
MIRT623791 GK5 glycerol kinase 5 (putative) 2 2
MIRT628834 FAM151B family with sequence similarity 151 member B 2 2
MIRT635547 LEPREL1 prolyl 3-hydroxylase 2 2 2
MIRT635698 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 2 2
MIRT635906 ARPC1B actin related protein 2/3 complex subunit 1B 2 2
MIRT649985 MSI1 musashi RNA binding protein 1 2 2
MIRT654900 POMGNT1 protein O-linked mannose N-acetylglucosaminyltransferase 1 (beta 1,2-) 2 2
MIRT655116 PHF7 PHD finger protein 7 2 2
MIRT658958 DNAJC6 DnaJ heat shock protein family (Hsp40) member C6 2 3
MIRT659665 CDC42EP4 CDC42 effector protein 4 2 2
MIRT668946 CNBP CCHC-type zinc finger nucleic acid binding protein 2 2
MIRT691164 APOL6 apolipoprotein L6 2 2
MIRT692696 MEAF6 MYST/Esa1 associated factor 6 2 2
MIRT693245 HBS1L HBS1 like translational GTPase 2 2
MIRT695203 SCAMP3 secretory carrier membrane protein 3 2 2
MIRT701957 MINK1 misshapen like kinase 1 2 2
MIRT706802 APOL4 apolipoprotein L4 2 2
MIRT716899 CACNB2 calcium voltage-gated channel auxiliary subunit beta 2 2 2
MIRT717632 HLX H2.0 like homeobox 2 2
MIRT719052 ZNF281 zinc finger protein 281 2 2
MIRT722973 GDE1 glycerophosphodiester phosphodiesterase 1 2 2
MIRT723643 RPTN repetin 2 2
MIRT734708 NR3C2 nuclear receptor subfamily 3 group C member 2 4 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4260 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-4260 Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-4260 Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-4260 Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-4260 Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide resistant cell line (Bads-200)

Error report submission