pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-6737 |
Genomic Coordinates | chr1: 153962351 - 153962420 |
Description | Homo sapiens miR-6737 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | ||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-6737-5p | |||||||||||||||||||||
Sequence | 6| UUGGGGUGGUCGGCCCUGGAG |26 | |||||||||||||||||||||
Evidence | Experimental | |||||||||||||||||||||
Experiments | Meta-analysis | |||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | DNAJC8 | ||||||||||||||||||||
Synonyms | HSPC331, SPF31 | ||||||||||||||||||||
Description | DnaJ heat shock protein family (Hsp40) member C8 | ||||||||||||||||||||
Transcript | NM_014280 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on DNAJC8 | |||||||||||||||||||||
3'UTR of DNAJC8 (miRNA target sites are highlighted) |
>DNAJC8|NM_014280|3'UTR 1 CCGCCCAAGGTCACAGGCACAGAACCTTTCCCCTGCTATCTCCCTTCCTGCTTCGAAGGACTCATTCTTTCCTCCCACTT 81 CCACCCCAACATAGAGTAGTATTTGCTTTTTAGTCCATTTTGTTTTCAATACGATTTAATATCGATCAGAGTAATTCTTT 161 TGTACATTGAAATGAGGGGCTTGGTTTAAAAAAAGACCTTTCCCTCTCCCTGCCCCTAGAACAACCAGTATTAGAAGGTG 241 CCACCATTGGTGCTGCCTTCTCTTCCCACAGCCTGTAACTCAGTGTTTTGTACTTCACTGAATTGTGATGGTTAGAAACT 321 TCGTGGATAGTTTGTGGAAATCATCCAATTAAACATACTGCTTAAAACAGTGTTGCTGTGACTTCAGAGACAAGCCTGGA 401 AGGGGCACCTTAGGAAGCCCCTTCGCTTCAGTTGCTCGCTTCTGGGTGTGCTCCCTTCGAAGGCCCAGATAAGACAGGGA 481 ACACTTGTGAGCACACAGAGCAGCATCTGATGCCCTGTGGTGTTTGGCATGTGCCCCCTGTCTACTGACCAATCAGTGTG 561 GCATGAGGCCCACGCCACCCAAACCTTTCACTTTCCAAAGAGCTAGCCGTCCTCCACCCAGTACCATGTCCTAGCCTGTC 641 TGCATTTGTTAGTGGTAATATTCTTTATGTATAATAAATTTTTATACCCAAGCCATTGATGTACTTTTCCTTGTACTCTC 721 CCTTGTGGGTCCCTTGTCTGGCTTGGCTGAACCCCAAAATGCTTTGGGGTTGGACAGACCTGGCTGAACCTTAGTTTCTT 801 CATCTATGAAATGGGAATATGAATTACTGCAGCAGCTTTTAGGGCAGATTTGCCATGGCATATACAAGGTAACTACCATA 881 GTGCTCCTTGGGTATTGCCAATATCCTATTATTTCTGTGTAAAATGAAGATACTGATTGTTTTGAGGATTAAATGAAGTA 961 ATATATGAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|
miRNA:Target | ---- | |||||||||
Validation Method |
|
|||||||||
Conditions | HEK293 | |||||||||
Disease | 22826.0 | |||||||||
Location of target site | 3'UTR | |||||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | |||||||||
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
|||||||||
miRNA-target interactions (Provided by authors) |
|
|||||||||
Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
CLIP-seq Support 1 for dataset GSM1065667 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_6 |
Location of target site | ENST00000263697.4 | 3UTR | ACUCAUUCUUUCCUCCCACUUCCACCCCAACAUAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23446348 / GSE43573 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
67 hsa-miR-6737-5p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT066215 | MARCH9 | membrane associated ring-CH-type finger 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT074413 | TNRC6A | trinucleotide repeat containing 6A | ![]() |
![]() |
2 | 2 | ||||||
MIRT125300 | MID1IP1 | MID1 interacting protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT153951 | NCOA3 | nuclear receptor coactivator 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT452776 | FAM136A | family with sequence similarity 136 member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT452977 | CABP4 | calcium binding protein 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT454128 | FOXRED2 | FAD dependent oxidoreductase domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT455242 | DDX39B | DExD-box helicase 39B | ![]() |
![]() |
2 | 10 | ||||||
MIRT459007 | UQCRH | ubiquinol-cytochrome c reductase hinge protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT459463 | MUC17 | mucin 17, cell surface associated | ![]() |
![]() |
2 | 4 | ||||||
MIRT460871 | UBE2S | ubiquitin conjugating enzyme E2 S | ![]() |
![]() |
2 | 2 | ||||||
MIRT461264 | COX10 | COX10, heme A:farnesyltransferase cytochrome c oxidase assembly factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT464540 | UBTF | upstream binding transcription factor, RNA polymerase I | ![]() |
![]() |
2 | 2 | ||||||
MIRT465268 | TRIM28 | tripartite motif containing 28 | ![]() |
![]() |
2 | 2 | ||||||
MIRT465871 | TMEM43 | transmembrane protein 43 | ![]() |
![]() |
2 | 4 | ||||||
MIRT466228 | TMED10 | transmembrane p24 trafficking protein 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT468417 | SETD1B | SET domain containing 1B | ![]() |
![]() |
2 | 2 | ||||||
MIRT468684 | SEC22C | SEC22 homolog C, vesicle trafficking protein | ![]() |
![]() |
2 | 4 | ||||||
MIRT473399 | MDM4 | MDM4, p53 regulator | ![]() |
![]() |
2 | 2 | ||||||
MIRT473517 | MAX | MYC associated factor X | ![]() |
![]() |
2 | 2 | ||||||
MIRT474511 | KLHDC8A | kelch domain containing 8A | ![]() |
![]() |
2 | 2 | ||||||
MIRT475801 | HDGF | heparin binding growth factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT479493 | CDH6 | cadherin 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT480770 | BMP2 | bone morphogenetic protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT481418 | ASB6 | ankyrin repeat and SOCS box containing 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT482966 | CSTF2 | cleavage stimulation factor subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT483380 | SPATA6 | spermatogenesis associated 6 | ![]() |
![]() |
2 | 4 | ||||||
MIRT483677 | CYP11A1 | cytochrome P450 family 11 subfamily A member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT484328 | EPN1 | epsin 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT484963 | UCK1 | uridine-cytidine kinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT485908 | PGPEP1 | pyroglutamyl-peptidase I | ![]() |
![]() |
2 | 4 | ||||||
MIRT488149 | PRRC2B | proline rich coiled-coil 2B | ![]() |
![]() |
2 | 4 | ||||||
MIRT488943 | CYP2W1 | cytochrome P450 family 2 subfamily W member 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT491835 | ZBTB7A | zinc finger and BTB domain containing 7A | ![]() |
![]() |
2 | 4 | ||||||
MIRT493026 | NAA50 | N(alpha)-acetyltransferase 50, NatE catalytic subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT499374 | PLCG2 | phospholipase C gamma 2 | ![]() |
![]() |
2 | 11 | ||||||
MIRT499723 | USH1G | USH1 protein network component sans | ![]() |
![]() |
2 | 4 | ||||||
MIRT500349 | ZNF385A | zinc finger protein 385A | ![]() |
![]() |
2 | 2 | ||||||
MIRT509574 | HIST2H2AB | histone cluster 2 H2A family member b | ![]() |
![]() |
2 | 4 | ||||||
MIRT512794 | GLRX | glutaredoxin | ![]() |
![]() |
2 | 2 | ||||||
MIRT513291 | SETBP1 | SET binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT515697 | ZNF321P | zinc finger protein 321, pseudogene | ![]() |
![]() |
2 | 2 | ||||||
MIRT518255 | LEAP2 | liver enriched antimicrobial peptide 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT522026 | PAQR3 | progestin and adipoQ receptor family member 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT523169 | HIST3H3 | histone cluster 3 H3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT524036 | DNAJC8 | DnaJ heat shock protein family (Hsp40) member C8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT533476 | TRIM71 | tripartite motif containing 71 | ![]() |
![]() |
2 | 2 | ||||||
MIRT541488 | ADM | adrenomedullin | ![]() |
![]() |
2 | 2 | ||||||
MIRT553987 | SRPR | SRP receptor alpha subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT571445 | YKT6 | YKT6 v-SNARE homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT574889 | Plcg2 | phospholipase C, gamma 2 | ![]() |
![]() |
2 | 7 | ||||||
MIRT607544 | GLI2 | GLI family zinc finger 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT607688 | MAPK10 | mitogen-activated protein kinase 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT610072 | CRLF1 | cytokine receptor like factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT610573 | CACUL1 | CDK2 associated cullin domain 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT614041 | THBS2 | thrombospondin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT626318 | LRTOMT | leucine rich transmembrane and O-methyltransferase domain containing | ![]() |
![]() |
2 | 2 | ||||||
MIRT634005 | RIF1 | replication timing regulatory factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT639619 | FGF19 | fibroblast growth factor 19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT647343 | RPH3AL | rabphilin 3A like (without C2 domains) | ![]() |
![]() |
2 | 2 | ||||||
MIRT689704 | ATXN2 | ataxin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT691170 | APOL6 | apolipoprotein L6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT693165 | NPR1 | natriuretic peptide receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT711727 | NUPL2 | nucleoporin like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT711806 | ELN | elastin | ![]() |
![]() |
2 | 2 | ||||||
MIRT721546 | FXN | frataxin | ![]() |
![]() |
2 | 2 | ||||||
MIRT722979 | GDE1 | glycerophosphodiester phosphodiesterase 1 | ![]() |
![]() |
2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|