miRTarBase - #MIRT525111


—
pre-miRNA Information
pre-miRNA hsa-mir-378f   
Genomic Coordinates chr1: 23929070 - 23929147
Description Homo sapiens miR-378f stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-378f
Sequence 52| ACUGGACUUGGAGCCAGAAG |71
Evidence Experimental
Experiments Illumina
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 18 1 + 23929138 29233923 MiREDiBase
A-to-I 19 1 + 23929139 29233923 MiREDiBase
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PRKD2   
Synonyms HSPC187, PKD2, nPKC-D2
Description protein kinase D2
Transcript NM_001079880   
Other Transcripts NM_001079881 , NM_001079882 , NM_016457   
Expression
Putative miRNA Targets on PRKD2
3'UTR of PRKD2
(miRNA target sites are highlighted)		 
>PRKD2|NM_001079880|3'UTR
   1 GGTCCTGTGCCCTCGTCCAGCTGCTGCCCTCCACAGCGGTTCTTCACAGGATCCCAGCAATGAACTGTTCTAGGGAAAGT
  81 GGCTTCCTGCCCAAACTGGATGGGACACGTGGGGAGTGGGGTGGGGGGAGCTATTTCCAAGGCCCCTCCCTGTTTCCCCA
 161 GCAATTAAAACGGACTCATCTCTGGCCCCATGGCCTTGATCTCAGCAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gaaGAC-CGAGGUUCAGGUCa 5'
             ||| || ||  |||||| 
Target 5' gtcCTGTGC-CCTCGTCCAGc 3'
 2 - 21 124.00 -17.20
2 
miRNA  3' gaaGACCGAGGUUCAGGuca 5'
             ||  :|||||| ||   
Target 5' gagCTATTTCCAAGGCCcct 3'
 128 - 147 93.00 -11.12
3 
miRNA  3' gaagACCGAGGUUCAGGUca 5'
              |||||:|  | |||  
Target 5' aaagTGGCTTCCTGCCCAaa 3'
 76 - 95 84.00 -13.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26990403 5 COSMIC
COSN31503012 45 COSMIC
COSN31610486 144 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs751055362 1 dbSNP
rs1337367925 4 dbSNP
rs1352472977 5 dbSNP
rs766000085 7 dbSNP
rs917914802 9 dbSNP
rs1267618333 12 dbSNP
rs1026229538 14 dbSNP
rs1325306605 20 dbSNP
rs762700966 29 dbSNP
rs1013297973 30 dbSNP
rs370839622 31 dbSNP
rs551631016 37 dbSNP
rs776604558 38 dbSNP
rs768510420 45 dbSNP
rs745899218 46 dbSNP
rs1480408671 47 dbSNP
rs1270294009 48 dbSNP
rs1302440694 52 dbSNP
rs1002377520 56 dbSNP
rs531927911 62 dbSNP
rs1411768690 67 dbSNP
rs990784054 78 dbSNP
rs903580742 80 dbSNP
rs1182003283 86 dbSNP
rs1044309553 90 dbSNP
rs1315344783 94 dbSNP
rs1320269082 96 dbSNP
rs1245649083 99 dbSNP
rs1462798199 107 dbSNP
rs1009676731 108 dbSNP
rs959415460 109 dbSNP
rs1198393768 111 dbSNP
rs184443951 118 dbSNP
rs1415740259 123 dbSNP
rs1027502233 127 dbSNP
rs892752528 129 dbSNP
rs542634633 133 dbSNP
rs1390730284 144 dbSNP
rs770090219 147 dbSNP
rs1327010630 150 dbSNP
rs934203444 153 dbSNP
rs1449096643 155 dbSNP
rs529337714 156 dbSNP
rs1380791413 162 dbSNP
rs1452384720 164 dbSNP
rs560561198 171 dbSNP
rs748494655 176 dbSNP
rs963531039 177 dbSNP
rs1223778932 189 dbSNP
rs1014792592 190 dbSNP
rs1320612255 191 dbSNP
rs1270331175 192 dbSNP
rs1306378954 197 dbSNP
rs1004799579 199 dbSNP
rs1238868204 201 dbSNP
rs1459659484 203 dbSNP
rs890378508 207 dbSNP
rs1248406164 208 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 25865.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gaagaccgAGGUUCAGGUCa 5'
                  |:|:||||||| 
Target 5' ------agUUCGAGUCCAGu 3'
 		1 - 14
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000601806.1 | 3UTR | AGUUCGAGUCCAGUUUGGG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
27 hsa-miR-378f Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT463100 ZNF609 zinc finger protein 609 2 2
MIRT469371 REST RE1 silencing transcription factor 2 6
MIRT495441 KCNJ6 potassium voltage-gated channel subfamily J member 6 2 2
MIRT513606 VPS37B VPS37B, ESCRT-I subunit 2 2
MIRT520414 TXNL1 thioredoxin like 1 2 4
MIRT525111 PRKD2 protein kinase D2 2 2
MIRT525979 SPA17 sperm autoantigenic protein 17 2 2
MIRT527002 ARL8B ADP ribosylation factor like GTPase 8B 2 2
MIRT529215 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT529835 ARGFX arginine-fifty homeobox 2 2
MIRT532300 HAUS3 HAUS augmin like complex subunit 3 2 2
MIRT537577 ESYT2 extended synaptotagmin 2 2 2
MIRT543140 AKT1 AKT serine/threonine kinase 1 2 2
MIRT554924 RAP1B RAP1B, member of RAS oncogene family 2 2
MIRT564970 WTAP WT1 associated protein 2 2
MIRT570115 CACNG8 calcium voltage-gated channel auxiliary subunit gamma 8 2 2
MIRT652734 TGFB2 transforming growth factor beta 2 2 2
MIRT655948 NDST1 N-deacetylase and N-sulfotransferase 1 2 2
MIRT655997 MYRF myelin regulatory factor 2 2
MIRT684875 P4HB prolyl 4-hydroxylase subunit beta 2 2
MIRT692969 LGSN lengsin, lens protein with glutamine synthetase domain 2 2
MIRT693737 ACACA acetyl-CoA carboxylase alpha 2 2
MIRT710991 PPARGC1B PPARG coactivator 1 beta 2 2
MIRT712247 RCC2 regulator of chromosome condensation 2 2 2
MIRT718602 DCTPP1 dCTP pyrophosphatase 1 2 2
MIRT723499 WDR33 WD repeat domain 33 2 2
MIRT725448 HIPK3 homeodomain interacting protein kinase 3 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-378f Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-378f Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-378f Doxorubicin 31703 NSC123127 approved sensitive High Triple-Negative Breast Cancer cell line (MDA-MB-231, MDA-MB-468)
hsa-miR-378f Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (SW480, HCT-116)
hsa-miR-378f Erlotinib 176870 NSC718781 approved resistant High Head And Neck Squamous Cell Carcinoma cell line (HN6)
hsa-mir-378f Androstenedione+Anastrozole sensitive cell line (MCF-7)
hsa-miR-378f Osimertinib 71496458 NSC779217 approved sensitive cell line (PC9)
hsa-miR-378f Doxorubicin 31703 NSC123127 approved sensitive cell line (BAS)
hsa-miR-378f Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-378f Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-378f Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)
hsa-miR-378f Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR3)

Error report submission