miRTarBase - #MIRT525117


—
pre-miRNA Information
pre-miRNA hsa-mir-4254   
Genomic Coordinates chr1: 31758660 - 31758735
Description Homo sapiens miR-4254 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4254
Sequence 44| GCCUGGAGCUACUCCACCAUCUC |66
Evidence Experimental
Experiments SOLiD
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1415016281 1 dbSNP
rs564274475 8 dbSNP
rs12731294 9 dbSNP
rs780735773 13 dbSNP
rs1207241221 19 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PRKD2   
Synonyms HSPC187, PKD2, nPKC-D2
Description protein kinase D2
Transcript NM_001079880   
Other Transcripts NM_001079881 , NM_001079882 , NM_016457   
Expression
Putative miRNA Targets on PRKD2
3'UTR of PRKD2
(miRNA target sites are highlighted)		 
>PRKD2|NM_001079880|3'UTR
   1 GGTCCTGTGCCCTCGTCCAGCTGCTGCCCTCCACAGCGGTTCTTCACAGGATCCCAGCAATGAACTGTTCTAGGGAAAGT
  81 GGCTTCCTGCCCAAACTGGATGGGACACGTGGGGAGTGGGGTGGGGGGAGCTATTTCCAAGGCCCCTCCCTGTTTCCCCA
 161 GCAATTAAAACGGACTCATCTCTGGCCCCATGGCCTTGATCTCAGCAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cuCUA-CCACCUC-AUCGAGGUCCg 5'
            |:| || |||| || :|||| | 
Target 5' ggGGTGGGGGGAGCTATTTCCAAGg 3'
 118 - 142 121.00 -24.10
2 
miRNA  3' cucuaccACCUCAUCGAGGUCCg 5'
                 || | | |:||:||| 
Target 5' ccagcaaTGAACT-GTTCTAGGg 3'
 54 - 75 119.00 -9.60
3 
miRNA  3' cucuaccaccucaucGAGGUccg 5'
                         |||||   
Target 5' cgtccagctgctgccCTCCAcag 3'
 14 - 36 100.00 -6.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26990403 5 COSMIC
COSN31503012 45 COSMIC
COSN31610486 144 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs751055362 1 dbSNP
rs1337367925 4 dbSNP
rs1352472977 5 dbSNP
rs766000085 7 dbSNP
rs917914802 9 dbSNP
rs1267618333 12 dbSNP
rs1026229538 14 dbSNP
rs1325306605 20 dbSNP
rs762700966 29 dbSNP
rs1013297973 30 dbSNP
rs370839622 31 dbSNP
rs551631016 37 dbSNP
rs776604558 38 dbSNP
rs768510420 45 dbSNP
rs745899218 46 dbSNP
rs1480408671 47 dbSNP
rs1270294009 48 dbSNP
rs1302440694 52 dbSNP
rs1002377520 56 dbSNP
rs531927911 62 dbSNP
rs1411768690 67 dbSNP
rs990784054 78 dbSNP
rs903580742 80 dbSNP
rs1182003283 86 dbSNP
rs1044309553 90 dbSNP
rs1315344783 94 dbSNP
rs1320269082 96 dbSNP
rs1245649083 99 dbSNP
rs1462798199 107 dbSNP
rs1009676731 108 dbSNP
rs959415460 109 dbSNP
rs1198393768 111 dbSNP
rs184443951 118 dbSNP
rs1415740259 123 dbSNP
rs1027502233 127 dbSNP
rs892752528 129 dbSNP
rs542634633 133 dbSNP
rs1390730284 144 dbSNP
rs770090219 147 dbSNP
rs1327010630 150 dbSNP
rs934203444 153 dbSNP
rs1449096643 155 dbSNP
rs529337714 156 dbSNP
rs1380791413 162 dbSNP
rs1452384720 164 dbSNP
rs560561198 171 dbSNP
rs748494655 176 dbSNP
rs963531039 177 dbSNP
rs1223778932 189 dbSNP
rs1014792592 190 dbSNP
rs1320612255 191 dbSNP
rs1270331175 192 dbSNP
rs1306378954 197 dbSNP
rs1004799579 199 dbSNP
rs1238868204 201 dbSNP
rs1459659484 203 dbSNP
rs890378508 207 dbSNP
rs1248406164 208 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 25865.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' cucuaccaccucaucgAGGUCcg 5'
                          |||||  
Target 5' --------aguucgagUCCAGuu 3'
 		1 - 15
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000601806.1 | 3UTR | AGUUCGAGUCCAGUUUGGG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
THCA 0.148 0.43 0.400 0.3 4 Click to see details
THCA 0.148 0.43 0.400 0.3 4 Click to see details
THCA 0.148 0.43 0.400 0.3 4 Click to see details
57 hsa-miR-4254 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT061595 BTG2 BTG anti-proliferation factor 2 2 4
MIRT306302 ABCC5 ATP binding cassette subfamily C member 5 2 2
MIRT353697 ACTR2 ARP2 actin related protein 2 homolog 2 2
MIRT442351 RAB6B RAB6B, member RAS oncogene family 2 2
MIRT448535 RIMS4 regulating synaptic membrane exocytosis 4 2 2
MIRT449881 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 2
MIRT457644 ZNF69 zinc finger protein 69 2 2
MIRT458620 TRIM72 tripartite motif containing 72 2 2
MIRT470963 PKM pyruvate kinase, muscle 2 2
MIRT476285 GMFB glia maturation factor beta 2 10
MIRT477615 EFNA3 ephrin A3 2 2
MIRT482761 TMEM126B transmembrane protein 126B 2 2
MIRT492535 PSMD11 proteasome 26S subunit, non-ATPase 11 2 2
MIRT502995 CCDC71L coiled-coil domain containing 71 like 2 8
MIRT508467 HOXB6 homeobox B6 2 4
MIRT520190 WBP2 WW domain binding protein 2 2 2
MIRT525117 PRKD2 protein kinase D2 2 2
MIRT525773 SOD2 superoxide dismutase 2 2 2
MIRT526411 TFAM transcription factor A, mitochondrial 2 2
MIRT528152 AGTPBP1 ATP/GTP binding protein 1 2 2
MIRT534111 SOGA3 SOGA family member 3 2 2
MIRT538026 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 2
MIRT539288 ANGEL2 angel homolog 2 2 2
MIRT541103 RAF1 Raf-1 proto-oncogene, serine/threonine kinase 2 2
MIRT550999 SUOX sulfite oxidase 2 2
MIRT562165 HOXA13 homeobox A13 2 2
MIRT570122 CACNG8 calcium voltage-gated channel auxiliary subunit gamma 8 2 2
MIRT571104 DENND4B DENN domain containing 4B 2 2
MIRT574099 VASN vasorin 2 2
MIRT611153 ZNF486 zinc finger protein 486 2 2
MIRT612252 STX1B syntaxin 1B 2 4
MIRT614808 RIOK3 RIO kinase 3 2 2
MIRT622153 SORBS2 sorbin and SH3 domain containing 2 2 2
MIRT624286 CRCP CGRP receptor component 2 2
MIRT624875 ABCC12 ATP binding cassette subfamily C member 12 2 2
MIRT627479 STRN striatin 2 2
MIRT641273 AMDHD2 amidohydrolase domain containing 2 2 2
MIRT645622 TSPAN6 tetraspanin 6 2 2
MIRT650226 SIGLEC9 sialic acid binding Ig like lectin 9 2 2
MIRT657507 HBEGF heparin binding EGF like growth factor 2 2
MIRT660811 AHCY adenosylhomocysteinase 2 2
MIRT667439 METTL14 methyltransferase like 14 2 2
MIRT693744 ACACA acetyl-CoA carboxylase alpha 2 2
MIRT697852 UBE2Z ubiquitin conjugating enzyme E2 Z 2 2
MIRT698719 SUMO2 small ubiquitin-like modifier 2 2 2
MIRT699980 RREB1 ras responsive element binding protein 1 2 2
MIRT700689 POLR3D RNA polymerase III subunit D 2 2
MIRT703267 GNL3L G protein nucleolar 3 like 2 2
MIRT703787 FAM102B family with sequence similarity 102 member B 2 2
MIRT711277 SDR9C7 short chain dehydrogenase/reductase family 9C member 7 2 2
MIRT711863 TRAF2 TNF receptor associated factor 2 2 2
MIRT712451 KHNYN KH and NYN domain containing 2 2
MIRT714449 UBXN2A UBX domain protein 2A 2 2
MIRT718846 SNX20 sorting nexin 20 2 2
MIRT721333 IFNAR2 interferon alpha and beta receptor subunit 2 2 2
MIRT723315 PRKCH protein kinase C eta 2 2
MIRT736659 CYP2B6 cytochrome P450 family 2 subfamily B member 6 1 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4254 Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-4254 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-4254 Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-4254 Sunitinib 5329102 NSC750690 approved sensitive tissue
hsa-miR-4254 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-4254 Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide resistant cell line (Bads-200)
hsa-miR-4254 Cisplatin 5460033 NSC119875 approved resistant cell line (OVSAHO)

Error report submission