miRTarBase - #MIRT525495


—
pre-miRNA Information
pre-miRNA hsa-mir-4763   
Genomic Coordinates chr22: 46113566 - 46113657
Description Homo sapiens miR-4763 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4763-5p
Sequence 19| CGCCUGCCCAGCCCUCCUGCU |39
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs374776264 1 dbSNP
rs1174502793 2 dbSNP
rs966122637 3 dbSNP
rs891363409 6 dbSNP
rs1303008773 8 dbSNP
rs1446379219 11 dbSNP
rs1410535134 13 dbSNP
rs1424733379 14 dbSNP
rs1372551711 16 dbSNP
rs756995936 17 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CD63   
Synonyms LAMP-3, ME491, MLA1, OMA81H, TSPAN30
Description CD63 molecule
Transcript NM_001780   
Expression
Putative miRNA Targets on CD63
3'UTR of CD63
(miRNA target sites are highlighted)		 
>CD63|NM_001780|3'UTR
   1 GGGTCTGGTCTCCTCAGCCTCCTCATCTGGGGGAGTGGAATAGTATCCTCCAGGTTTTTCAATTAAACGGATTATTTTTT
  81 CAGACCGAAAAGAGATGGTCTGAGTTTGTCTTAGAGTG
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ucguccucccgacccGUCCGc 5'
                         ||||: 
Target 5' tggaatagtatcctcCAGGTt 3'
 36 - 56 84.00 -6.40
2 
miRNA  3' ucguccucccgacccGUCCGc 5'
                         ||| | 
Target 5' -gggtctggtctcctCAGCCt 3'
 1 - 20 68.00 -7.22
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30543092 22 COSMIC
COSN30160656 39 COSMIC
COSN30490535 51 COSMIC
COSN30504602 62 COSMIC
COSN30139818 74 COSMIC
COSN26969901 87 COSMIC
COSN31514493 99 COSMIC
COSN30101517 112 COSMIC
rs4759190 101 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs927545532 1 dbSNP
rs1281479789 2 dbSNP
rs982131335 4 dbSNP
rs1225141989 10 dbSNP
rs1350990999 12 dbSNP
rs1302228306 17 dbSNP
rs1270079156 19 dbSNP
rs764567916 22 dbSNP
rs1372832171 24 dbSNP
rs748229397 25 dbSNP
rs200326274 28 dbSNP
rs766020356 29 dbSNP
rs760217320 30 dbSNP
rs1402492424 31 dbSNP
rs368848583 33 dbSNP
rs1424246995 39 dbSNP
rs1173237553 40 dbSNP
rs771693264 42 dbSNP
rs761576474 44 dbSNP
rs774179005 47 dbSNP
rs1310512684 51 dbSNP
rs1318236164 52 dbSNP
rs201691826 53 dbSNP
rs563710906 54 dbSNP
rs985973960 57 dbSNP
rs1006691422 59 dbSNP
rs889644574 60 dbSNP
rs374793611 63 dbSNP
rs373963725 68 dbSNP
rs1221909452 70 dbSNP
rs529992950 86 dbSNP
rs1037113923 87 dbSNP
rs572237359 94 dbSNP
rs1282015195 97 dbSNP
rs4759190 101 dbSNP
rs1222272739 102 dbSNP
rs866914914 104 dbSNP
rs1245896755 114 dbSNP
rs1476955711 120 dbSNP
rs1183826983 122 dbSNP
rs1297738877 142 dbSNP
rs775701924 150 dbSNP
rs1156283251 151 dbSNP
rs112903230 152 dbSNP
rs1003558165 155 dbSNP
rs1407563137 157 dbSNP
rs1049232284 166 dbSNP
rs1349595103 172 dbSNP
rs1403503539 173 dbSNP
rs545275721 175 dbSNP
rs927470853 176 dbSNP
rs1351370449 185 dbSNP
rs1045971510 188 dbSNP
rs1023596889 193 dbSNP
rs192822211 199 dbSNP
rs907021152 203 dbSNP
rs1277827424 204 dbSNP
rs1416949771 212 dbSNP
rs1013048536 216 dbSNP
rs1165373526 218 dbSNP
rs887535515 219 dbSNP
rs755836388 221 dbSNP
rs989234473 224 dbSNP
rs1184461939 226 dbSNP
rs541180342 227 dbSNP
rs1179643785 236 dbSNP
rs1369690745 237 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 967.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ucgUCCUC--CCGACCCGUCCgc 5'
             ||| |  ||:||||||||  
Target 5' cgaAGGUGUUGGUUGGGCAGG-- 3'
 		2 - 22
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000548898.1 | 3UTR | GCGAAGGUGUUGGUUGGGCAGG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
69 hsa-miR-4763-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT116035 DEPDC1 DEP domain containing 1 2 2
MIRT347197 SIN3B SIN3 transcription regulator family member B 2 2
MIRT443248 C9orf170 chromosome 9 open reading frame 170 2 2
MIRT475164 IP6K1 inositol hexakisphosphate kinase 1 2 2
MIRT495486 VTI1B vesicle transport through interaction with t-SNAREs 1B 2 2
MIRT496755 TGIF2 TGFB induced factor homeobox 2 2 2
MIRT496863 C21orf2 chromosome 21 open reading frame 2 2 2
MIRT499264 NBPF11 NBPF member 11 2 2
MIRT499517 MAFK MAF bZIP transcription factor K 2 2
MIRT512952 MKI67 marker of proliferation Ki-67 2 2
MIRT514656 NUP93 nucleoporin 93 2 2
MIRT517986 SLC16A13 solute carrier family 16 member 13 2 2
MIRT522816 KLHL9 kelch like family member 9 2 4
MIRT525495 CD63 CD63 molecule 2 2
MIRT528111 FOXH1 forkhead box H1 2 2
MIRT531683 MYO3A myosin IIIA 2 2
MIRT534806 RAB37 RAB37, member RAS oncogene family 2 2
MIRT573041 SHMT1 serine hydroxymethyltransferase 1 2 2
MIRT576720 Wars tryptophanyl-tRNA synthetase 2 2
MIRT609727 MLXIPL MLX interacting protein like 2 2
MIRT610843 FAM180B family with sequence similarity 180 member B 2 4
MIRT614735 STAT5A signal transducer and activator of transcription 5A 2 2
MIRT616981 EPOR erythropoietin receptor 2 2
MIRT617265 MMAB methylmalonic aciduria (cobalamin deficiency) cblB type 2 2
MIRT619405 INTS7 integrator complex subunit 7 2 2
MIRT621832 TIMM8A translocase of inner mitochondrial membrane 8A 2 2
MIRT621893 TAF13 TATA-box binding protein associated factor 13 2 2
MIRT630263 SMIM14 small integral membrane protein 14 2 2
MIRT634879 SENP8 SUMO/sentrin peptidase family member, NEDD8 specific 2 2
MIRT636863 ARSE arylsulfatase E (chondrodysplasia punctata 1) 2 2
MIRT637653 ADAT1 adenosine deaminase, tRNA specific 1 2 2
MIRT637699 ZNF439 zinc finger protein 439 2 2
MIRT637759 GATAD1 GATA zinc finger domain containing 1 2 2
MIRT638193 TAOK1 TAO kinase 1 2 2
MIRT638996 ADO 2-aminoethanethiol dioxygenase 2 2
MIRT642221 RABAC1 Rab acceptor 1 2 2
MIRT643327 ATCAY ATCAY, caytaxin 2 4
MIRT643419 ERVMER34-1 endogenous retrovirus group MER34 member 1, envelope 2 2
MIRT644499 RNF14 ring finger protein 14 2 2
MIRT644603 NT5DC3 5'-nucleotidase domain containing 3 2 2
MIRT644795 C21orf59 chromosome 21 open reading frame 59 2 2
MIRT648732 HIST1H2BD histone cluster 1 H2B family member d 2 2
MIRT653856 SHE Src homology 2 domain containing E 2 2
MIRT654129 RPL14 ribosomal protein L14 2 4
MIRT658876 DSN1 DSN1 homolog, MIS12 kinetochore complex component 2 2
MIRT671624 C20orf144 chromosome 20 open reading frame 144 2 4
MIRT677367 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT677579 TRIM65 tripartite motif containing 65 2 2
MIRT678220 MACC1 MACC1, MET transcriptional regulator 2 2
MIRT679613 RRP36 ribosomal RNA processing 36 2 2
MIRT686081 PNPLA3 patatin like phospholipase domain containing 3 2 2
MIRT691817 ICA1L islet cell autoantigen 1 like 2 2
MIRT693869 COX19 COX19, cytochrome c oxidase assembly factor 2 2
MIRT694544 BPNT1 3'(2'), 5'-bisphosphate nucleotidase 1 2 2
MIRT694926 ANKS4B ankyrin repeat and sterile alpha motif domain containing 4B 2 2
MIRT697758 USP37 ubiquitin specific peptidase 37 2 2
MIRT697891 UBE2B ubiquitin conjugating enzyme E2 B 2 2
MIRT701569 MYPN myopalladin 2 2
MIRT703081 GPRIN3 GPRIN family member 3 2 2
MIRT708104 IGF2BP1 insulin like growth factor 2 mRNA binding protein 1 2 2
MIRT708320 NT5C 5', 3'-nucleotidase, cytosolic 2 2
MIRT709878 TRAF1 TNF receptor associated factor 1 2 2
MIRT713545 GJB1 gap junction protein beta 1 2 2
MIRT716275 NUP85 nucleoporin 85 2 2
MIRT716621 CRCP CGRP receptor component 2 2
MIRT717987 C9orf171 cilia and flagella associated protein 77 2 2
MIRT718438 RAB11B RAB11B, member RAS oncogene family 2 2
MIRT722544 AGPAT4 1-acylglycerol-3-phosphate O-acyltransferase 4 2 2
MIRT724013 F2RL1 F2R like trypsin receptor 1 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4763 Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-mir-4763 Doxorubicin 31703 NSC123127 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-mir-4763 Fluorouracil 3385 NSC19893 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-mir-4763 Vincristine 5978 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-mir-4763 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-4763 Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-miR-4763-5p Anthracycline 30323 NSC82151 approved resistant High Breast Cancer tissue
hsa-miR-4763-5p Fluorouracil 3385 NSC19893 approved resistant High Breast Cancer tissue
hsa-miR-4763-5p Cyclophosphamide 2907 NSC26271 approved resistant High Breast Cancer tissue
hsa-miR-4763-5p Methotrexate 126941 NSC740 approved resistant High Breast Cancer tissue
hsa-miR-4763-5p Taxol 36314 NSC125973 approved resistant High Breast Cancer tissue
hsa-miR-4763-5p Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-4763-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-4763-5p Tamoxifen 2733525 NSC180973 approved sensitive cell line (LCC2)
hsa-miR-4763-5p Platinum 23939 sensitive tissue (non-small cell lung cancer)
hsa-miR-4763-5p Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-4763-5p Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-4763-5p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)

Error report submission