pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4280 |
Genomic Coordinates | chr5: 87114879 - 87114954 |
Description | Homo sapiens miR-4280 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4280 | ||||||||||||||||||
Sequence | 11| GAGUGUAGUUCUGAGCAGAGC |31 | ||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||
Experiments | SOLiD | ||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | C11orf74 | ||||||||||
Synonyms | HEPIS, NWC | ||||||||||
Description | chromosome 11 open reading frame 74 | ||||||||||
Transcript | NM_138787 | ||||||||||
Expression | |||||||||||
Putative miRNA Targets on C11orf74 | |||||||||||
3'UTR of C11orf74 (miRNA target sites are highlighted) |
>C11orf74|NM_138787|3'UTR 1 TTCACAGAGGCATTTTGTGTGTGTGTGCTTATTTTAATTTTGTTCTTATTCTAGCAACATTAGAATAAAAGATAAACCTA 81 CTATAATTCCCTTTGTGGAAATTTAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||
DRVs in gene 3'UTRs | |||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | hESCs (WA-09) | ||||||
Disease | 119710.0 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine
... - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al. - Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
|
CLIP-seq Support 1 for dataset SRR359787 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | hESCs (WA-09) / 4-thiouridine, RNase T1 |
Location of target site | ENST00000534635.1 | 3UTR | UACAUUUUCUUUAUCCAUCCAUCAA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 22012620 / SRX103431 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
67 hsa-miR-4280 Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT065612 | DAZAP2 | DAZ associated protein 2 | ![]() |
![]() |
2 | 10 | ||||||
MIRT084985 | BACH1 | BTB domain and CNC homolog 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT088053 | UBXN2A | UBX domain protein 2A | ![]() |
![]() |
2 | 4 | ||||||
MIRT097327 | SCAMP1 | secretory carrier membrane protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT099148 | MYLIP | myosin regulatory light chain interacting protein | ![]() |
![]() |
2 | 12 | ||||||
MIRT127042 | FAM208B | family with sequence similarity 208 member B | ![]() |
![]() |
2 | 4 | ||||||
MIRT140479 | BNIP2 | BCL2 interacting protein 2 | ![]() |
![]() |
2 | 6 | ||||||
MIRT154889 | GNAS | GNAS complex locus | ![]() |
![]() |
2 | 4 | ||||||
MIRT187983 | MBD6 | methyl-CpG binding domain protein 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT190440 | EIF5 | eukaryotic translation initiation factor 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT240673 | GAPVD1 | GTPase activating protein and VPS9 domains 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT295049 | EVI5L | ecotropic viral integration site 5 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT324749 | ACER2 | alkaline ceramidase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT366075 | FAM127A | retrotransposon Gag like 8C | ![]() |
![]() |
2 | 4 | ||||||
MIRT442625 | LOX | lysyl oxidase | ![]() |
![]() |
2 | 2 | ||||||
MIRT445224 | TYRP1 | tyrosinase related protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT448967 | CCNT2 | cyclin T2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT450137 | PFN4 | profilin family member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT464350 | USP46 | ubiquitin specific peptidase 46 | ![]() |
![]() |
2 | 2 | ||||||
MIRT470460 | PPP1R15B | protein phosphatase 1 regulatory subunit 15B | ![]() |
![]() |
2 | 2 | ||||||
MIRT473691 | MAPK8 | mitogen-activated protein kinase 8 | ![]() |
![]() |
2 | 4 | ||||||
MIRT480188 | CALM2 | calmodulin 2 | ![]() |
![]() |
2 | 6 | ||||||
MIRT486355 | PCBD2 | pterin-4 alpha-carbinolamine dehydratase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT486708 | TROVE2 | TROVE domain family member 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT488337 | SCD | stearoyl-CoA desaturase | ![]() |
![]() |
2 | 2 | ||||||
MIRT489322 | PEX26 | peroxisomal biogenesis factor 26 | ![]() |
![]() |
2 | 2 | ||||||
MIRT491791 | ZNF24 | zinc finger protein 24 | ![]() |
![]() |
2 | 2 | ||||||
MIRT491970 | USP37 | ubiquitin specific peptidase 37 | ![]() |
![]() |
2 | 2 | ||||||
MIRT492029 | TWF1 | twinfilin actin binding protein 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT492063 | TMEM245 | transmembrane protein 245 | ![]() |
![]() |
2 | 2 | ||||||
MIRT492247 | SLC39A9 | solute carrier family 39 member 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT492254 | SLC35F5 | solute carrier family 35 member F5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT492592 | PPIL4 | peptidylprolyl isomerase like 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT493436 | KAT7 | lysine acetyltransferase 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT493470 | IPMK | inositol polyphosphate multikinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT493639 | HECTD1 | HECT domain E3 ubiquitin protein ligase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT493919 | FAM127B | retrotransposon Gag like 8A | ![]() |
![]() |
2 | 4 | ||||||
MIRT494639 | ARNTL | aryl hydrocarbon receptor nuclear translocator like | ![]() |
![]() |
2 | 2 | ||||||
MIRT500032 | ABCF2 | ATP binding cassette subfamily F member 2 | ![]() |
![]() |
2 | 8 | ||||||
MIRT504589 | ADH1B | alcohol dehydrogenase 1B (class I), beta polypeptide | ![]() |
![]() |
2 | 4 | ||||||
MIRT505535 | SP4 | Sp4 transcription factor | ![]() |
![]() |
2 | 6 | ||||||
MIRT507539 | DNAJB6 | DnaJ heat shock protein family (Hsp40) member B6 | ![]() |
![]() |
2 | 6 | ||||||
MIRT508846 | TMCO1 | transmembrane and coiled-coil domains 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT510488 | YWHAZ | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta | ![]() |
![]() |
2 | 2 | ||||||
MIRT511402 | IFNAR2 | interferon alpha and beta receptor subunit 2 | ![]() |
![]() |
2 | 6 | ||||||
MIRT523252 | HIST1H2AH | histone cluster 1 H2A family member h | ![]() |
![]() |
2 | 2 | ||||||
MIRT525939 | C11orf74 | chromosome 11 open reading frame 74 | ![]() |
![]() |
2 | 2 | ||||||
MIRT531453 | HSD17B12 | hydroxysteroid 17-beta dehydrogenase 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT533317 | UNKL | unkempt family like zinc finger | ![]() |
![]() |
2 | 2 | ||||||
MIRT541034 | STRBP | spermatid perinuclear RNA binding protein | ![]() |
![]() |
2 | 8 | ||||||
MIRT546734 | RNF217 | ring finger protein 217 | ![]() |
![]() |
2 | 2 | ||||||
MIRT555125 | PTPRJ | protein tyrosine phosphatase, receptor type J | ![]() |
![]() |
2 | 2 | ||||||
MIRT556105 | MOAP1 | modulator of apoptosis 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT560205 | AK4 | adenylate kinase 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT561087 | LLPH | LLP homolog, long-term synaptic facilitation | ![]() |
![]() |
2 | 2 | ||||||
MIRT566967 | LBR | lamin B receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT567344 | H3F3B | H3 histone family member 3B | ![]() |
![]() |
2 | 2 | ||||||
MIRT567863 | DCAF12 | DDB1 and CUL4 associated factor 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT574449 | SCML2 | Scm polycomb group protein like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT575700 | Map1b | microtubule-associated protein 1B | ![]() |
![]() |
2 | 2 | ||||||
MIRT651432 | YIPF6 | Yip1 domain family member 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT659728 | CCDC93 | coiled-coil domain containing 93 | ![]() |
![]() |
2 | 2 | ||||||
MIRT686937 | SFT2D3 | SFT2 domain containing 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT699385 | SLC30A6 | solute carrier family 30 member 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT710287 | CSNK1G3 | casein kinase 1 gamma 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT715123 | PANK3 | pantothenate kinase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT721847 | VLDLR | very low density lipoprotein receptor | ![]() |
![]() |
2 | 2 |
miRNA-Drug Associations | ||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|