miRTarBase - #MIRT526045


—
pre-miRNA Information
pre-miRNA hsa-mir-4720   
Genomic Coordinates chr16: 81385018 - 81385093
Description Homo sapiens miR-4720 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4720-5p
Sequence 4| CCUGGCAUAUUUGGUAUAACUU |25
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs750386566 4 dbSNP
rs532921899 5 dbSNP
rs1025678089 6 dbSNP
rs1435476609 11 dbSNP
rs1426449829 13 dbSNP
rs1349517705 17 dbSNP
rs1448030025 20 dbSNP
Putative Targets

Gene Information
Gene Symbol GMDS   
Synonyms GMD, SDR3E1
Description GDP-mannose 4,6-dehydratase
Transcript NM_001500   
Expression
Putative miRNA Targets on GMDS
3'UTR of GMDS
(miRNA target sites are highlighted)		 
>GMDS|NM_001500|3'UTR
   1 GCAGCGCCTCGGAGCCCGGCCCGCCCTCCGGCTACAATCCCCGCAGAGTCTCCGGTGCAGACGCGCTGCGGGGATGGGGA
  81 GCGGCGTGCCAATCTGCGGGTCCCCTGCGGCCCCTGCTGCCGCTGCGCTGTCCCGGCCGCAAGAGCGGGGCCGCCCCGCC
 161 GAGGTTTGTAGCAGCCGGGATGTGACCCTCCAGGGTTTGGGTCGCTTTGCGTTTGTCGAAGCCTCCTCTGAATGGCTTTG
 241 TGAAATCAAGATGTTTTAATCACATTCACTTTACTTGAAATTATGTTGTTACACAACAAATTGTGGGGCCTTCAAATTGT
 321 TTTTCTCTTTTCATATTAAAAATGGTCTTTCTGTGAACTAGCATTCACA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uucaauaugguuuaUACGGUcc 5'
                        :|||||  
Target 5' ggatggggagcggcGTGCCAat 3'
 72 - 93 104.00 -5.40
2 
miRNA  3' uucAAUAUGGU---UUAUACGGUcc 5'
             ||:|| ||   :: |||: |  
Target 5' ggtTTGTAGCAGCCGGGATGTGAcc 3'
 163 - 187 87.00 -11.26
3 
miRNA  3' uucaauaugguuuauACGGUcc 5'
                         ||||:  
Target 5' ccctgcggcccctgcTGCCGct 3'
 103 - 124 84.00 -7.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26977566 3 COSMIC
COSN30646100 5 COSMIC
COSN30115703 11 COSMIC
COSN30535454 17 COSMIC
COSN30152650 21 COSMIC
COSN26977567 54 COSMIC
COSN30519685 62 COSMIC
COSN30514046 64 COSMIC
COSN30485002 79 COSMIC
COSN30494570 82 COSMIC
COSN20066643 85 COSMIC
COSN30731346 86 COSMIC
COSN8399546 88 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs773734720 1 dbSNP
rs373648806 3 dbSNP
rs1264181923 5 dbSNP
rs1418286029 6 dbSNP
rs370392895 10 dbSNP
rs1195169742 12 dbSNP
rs377724013 15 dbSNP
rs1251884249 16 dbSNP
rs1205240664 17 dbSNP
rs745537117 22 dbSNP
rs778646182 23 dbSNP
rs1172274823 27 dbSNP
rs1375452684 29 dbSNP
rs750198844 30 dbSNP
rs1288913513 31 dbSNP
rs1012499494 37 dbSNP
rs767363853 38 dbSNP
rs1236820630 42 dbSNP
rs1369090302 43 dbSNP
rs370417535 48 dbSNP
rs761385469 49 dbSNP
rs770868153 49 dbSNP
rs749050492 50 dbSNP
rs894939211 54 dbSNP
rs1056300372 55 dbSNP
rs973002141 61 dbSNP
rs561815374 62 dbSNP
rs1394635500 65 dbSNP
rs542029145 70 dbSNP
rs1047077638 71 dbSNP
rs140328641 74 dbSNP
rs1192122454 76 dbSNP
rs920164353 77 dbSNP
rs1038584007 86 dbSNP
rs942868068 87 dbSNP
rs911372446 94 dbSNP
rs1364965503 100 dbSNP
rs770974623 101 dbSNP
rs1455320347 102 dbSNP
rs986970601 104 dbSNP
rs1434481871 109 dbSNP
rs1395998338 112 dbSNP
rs1157903129 113 dbSNP
rs1201478950 115 dbSNP
rs112980684 121 dbSNP
rs540166962 128 dbSNP
rs187565637 132 dbSNP
rs977718872 134 dbSNP
rs577452912 135 dbSNP
rs1021727370 139 dbSNP
rs553758041 143 dbSNP
rs1278099364 149 dbSNP
rs1228041042 152 dbSNP
rs967650798 153 dbSNP
rs1022633525 156 dbSNP
rs1209990993 157 dbSNP
rs1348523378 158 dbSNP
rs1282137888 160 dbSNP
rs1013039587 161 dbSNP
rs1179395799 162 dbSNP
rs1252088152 162 dbSNP
rs1471295166 164 dbSNP
rs1012141821 165 dbSNP
rs1180795953 176 dbSNP
rs1418169485 177 dbSNP
rs1462685856 178 dbSNP
rs894478418 186 dbSNP
rs533734488 187 dbSNP
rs1236656333 190 dbSNP
rs1334176126 192 dbSNP
rs1306621075 194 dbSNP
rs568170124 195 dbSNP
rs939255341 196 dbSNP
rs906465114 203 dbSNP
rs1357666141 204 dbSNP
rs1002980561 205 dbSNP
rs548259932 210 dbSNP
rs1289622939 211 dbSNP
rs1308407014 214 dbSNP
rs1207269257 222 dbSNP
rs543579401 229 dbSNP
rs1311149028 233 dbSNP
rs1482995691 234 dbSNP
rs1203898852 237 dbSNP
rs773286409 249 dbSNP
rs1376614220 261 dbSNP
rs537935292 265 dbSNP
rs770438454 265 dbSNP
rs1179713030 270 dbSNP
rs1412835627 272 dbSNP
rs1428953507 273 dbSNP
rs1452131013 274 dbSNP
rs1172231551 285 dbSNP
rs1368704518 294 dbSNP
rs907284471 303 dbSNP
rs763408027 309 dbSNP
rs1159473944 313 dbSNP
rs1446127965 315 dbSNP
rs1473373202 319 dbSNP
rs1362892129 342 dbSNP
rs994177875 347 dbSNP
rs1216728787 351 dbSNP
rs770000974 352 dbSNP
rs1342143745 361 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 2762.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' uuCAAU--AUGGUUUA--UACGGUCc 5'
            ||||  |:|| |||  ||||||| 
Target 5' --GUUAAGUGCCUAAUACAUGCCAG- 3'
 		1 - 23
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000530927.1 | 3UTR | GUUAAGUGCCUAAUACAUGCCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
40 hsa-miR-4720-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT064869 ZBTB18 zinc finger and BTB domain containing 18 2 2
MIRT099937 SOX4 SRY-box 4 2 2
MIRT204534 SLC39A10 solute carrier family 39 member 10 2 4
MIRT221679 ZNRF2 zinc and ring finger 2 2 2
MIRT296659 MRGBP MRG domain binding protein 2 6
MIRT331634 AASDHPPT aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase 2 2
MIRT337078 RER1 retention in endoplasmic reticulum sorting receptor 1 2 2
MIRT497580 PTCHD4 patched domain containing 4 2 2
MIRT498838 NAPEPLD N-acyl phosphatidylethanolamine phospholipase D 2 4
MIRT502561 EBAG9 estrogen receptor binding site associated, antigen, 9 2 2
MIRT508128 AMD1 adenosylmethionine decarboxylase 1 2 2
MIRT511875 GOLGA7 golgin A7 2 6
MIRT512924 UBL4A ubiquitin like 4A 2 2
MIRT513833 KLHL15 kelch like family member 15 2 6
MIRT515889 FAM182B family with sequence similarity 182 member B 2 2
MIRT520201 WASL Wiskott-Aldrich syndrome like 2 2
MIRT526045 GMDS GDP-mannose 4,6-dehydratase 2 2
MIRT533601 TNPO1 transportin 1 2 2
MIRT535539 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 6
MIRT541150 PABPC1 poly(A) binding protein cytoplasmic 1 2 4
MIRT549609 TMEM101 transmembrane protein 101 2 2
MIRT552630 ZBTB41 zinc finger and BTB domain containing 41 2 2
MIRT555503 PNISR PNN interacting serine and arginine rich protein 2 2
MIRT560225 PCNA proliferating cell nuclear antigen 2 2
MIRT561671 RAPGEF2 Rap guanine nucleotide exchange factor 2 2 2
MIRT562103 ITGB1 integrin subunit beta 1 2 2
MIRT570710 E2F3 E2F transcription factor 3 2 2
MIRT570802 CKAP2L cytoskeleton associated protein 2 like 2 2
MIRT615261 DPF2 double PHD fingers 2 2 2
MIRT615389 ZNF747 zinc finger protein 747 2 2
MIRT616621 KCNJ11 potassium voltage-gated channel subfamily J member 11 2 4
MIRT641085 ZKSCAN2 zinc finger with KRAB and SCAN domains 2 2 2
MIRT654971 PLEKHA2 pleckstrin homology domain containing A2 2 2
MIRT667033 PDE3A phosphodiesterase 3A 2 2
MIRT677217 RASSF6 Ras association domain family member 6 2 2
MIRT699243 SLC6A8 solute carrier family 6 member 8 2 2
MIRT711673 TRMT5 tRNA methyltransferase 5 2 2
MIRT713922 CACNA2D1 calcium voltage-gated channel auxiliary subunit alpha2delta 1 2 2
MIRT722736 BRMS1 breast cancer metastasis suppressor 1 2 2
MIRT724997 CDC27 cell division cycle 27 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4720-5p Gefitinib 123631 NSC715055 approved sensitive High Non-Small Cell Lung Cancer cell line (PC-9)
hsa-miR-4720-5p Yuanhuadine 6440572 sensitive High Non-Small Cell Lung Cancer cell line (PC-9)
hsa-miR-4720-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-4720-5p Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-4720-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-4720-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-4720-5p Paclitaxel 36314 NSC125973 approved resistant cell line (BAS)
hsa-miR-4720-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)

Error report submission