miRTarBase - #MIRT526049


—
pre-miRNA Information
pre-miRNA hsa-mir-3622a   
Genomic Coordinates chr8: 27701677 - 27701759
Description Homo sapiens miR-3622a stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3622a-5p
Sequence 14| CAGGCACGGGAGCUCAGGUGAG |35
Evidence Experimental
Experiments Illumina
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 2 8 + 27701691 29233923 MiREDiBase
A-to-I 6 8 + 27701695 29233923 MiREDiBase
A-to-I 16 8 + 27701705 28550310, 29233923 MiREDiBase
A-to-I 21 8 + 27701710 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs551845360 1 dbSNP
rs946438979 3 dbSNP
rs1044808718 7 dbSNP
rs66683138 8 dbSNP
rs1157333896 10 dbSNP
rs1439657384 12 dbSNP
rs530939348 17 dbSNP
rs1232922758 20 dbSNP
rs1448152954 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol GMDS   
Synonyms GMD, SDR3E1
Description GDP-mannose 4,6-dehydratase
Transcript NM_001500   
Expression
Putative miRNA Targets on GMDS
3'UTR of GMDS
(miRNA target sites are highlighted)		 
>GMDS|NM_001500|3'UTR
   1 GCAGCGCCTCGGAGCCCGGCCCGCCCTCCGGCTACAATCCCCGCAGAGTCTCCGGTGCAGACGCGCTGCGGGGATGGGGA
  81 GCGGCGTGCCAATCTGCGGGTCCCCTGCGGCCCCTGCTGCCGCTGCGCTGTCCCGGCCGCAAGAGCGGGGCCGCCCCGCC
 161 GAGGTTTGTAGCAGCCGGGATGTGACCCTCCAGGGTTTGGGTCGCTTTGCGTTTGTCGAAGCCTCCTCTGAATGGCTTTG
 241 TGAAATCAAGATGTTTTAATCACATTCACTTTACTTGAAATTATGTTGTTACACAACAAATTGTGGGGCCTTCAAATTGT
 321 TTTTCTCTTTTCATATTAAAAATGGTCTTTCTGTGAACTAGCATTCACA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gaguggaCUCGAGGGCACGGac 5'
                 ||||   ||||||  
Target 5' ggatgggGAGC-GGCGTGCCaa 3'
 72 - 92 126.00 -15.40
2 
miRNA  3' gaGUGGAC-UCGAGGGC-ACGGac 5'
            | |||| :|| ||:| ||||  
Target 5' gtCCCCTGCGGCCCCTGCTGCCgc 3'
 100 - 123 104.00 -21.50
3 
miRNA  3' gagugGACUC-GAGGGCACGgac 5'
               | ||| |||| ||||   
Target 5' ccccgCAGAGTCTCCGGTGCaga 3'
 39 - 61 97.00 -19.22
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26977566 3 COSMIC
COSN30646100 5 COSMIC
COSN30115703 11 COSMIC
COSN30535454 17 COSMIC
COSN30152650 21 COSMIC
COSN26977567 54 COSMIC
COSN30519685 62 COSMIC
COSN30514046 64 COSMIC
COSN30485002 79 COSMIC
COSN30494570 82 COSMIC
COSN20066643 85 COSMIC
COSN30731346 86 COSMIC
COSN8399546 88 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs773734720 1 dbSNP
rs373648806 3 dbSNP
rs1264181923 5 dbSNP
rs1418286029 6 dbSNP
rs370392895 10 dbSNP
rs1195169742 12 dbSNP
rs377724013 15 dbSNP
rs1251884249 16 dbSNP
rs1205240664 17 dbSNP
rs745537117 22 dbSNP
rs778646182 23 dbSNP
rs1172274823 27 dbSNP
rs1375452684 29 dbSNP
rs750198844 30 dbSNP
rs1288913513 31 dbSNP
rs1012499494 37 dbSNP
rs767363853 38 dbSNP
rs1236820630 42 dbSNP
rs1369090302 43 dbSNP
rs370417535 48 dbSNP
rs761385469 49 dbSNP
rs770868153 49 dbSNP
rs749050492 50 dbSNP
rs894939211 54 dbSNP
rs1056300372 55 dbSNP
rs973002141 61 dbSNP
rs561815374 62 dbSNP
rs1394635500 65 dbSNP
rs542029145 70 dbSNP
rs1047077638 71 dbSNP
rs140328641 74 dbSNP
rs1192122454 76 dbSNP
rs920164353 77 dbSNP
rs1038584007 86 dbSNP
rs942868068 87 dbSNP
rs911372446 94 dbSNP
rs1364965503 100 dbSNP
rs770974623 101 dbSNP
rs1455320347 102 dbSNP
rs986970601 104 dbSNP
rs1434481871 109 dbSNP
rs1395998338 112 dbSNP
rs1157903129 113 dbSNP
rs1201478950 115 dbSNP
rs112980684 121 dbSNP
rs540166962 128 dbSNP
rs187565637 132 dbSNP
rs977718872 134 dbSNP
rs577452912 135 dbSNP
rs1021727370 139 dbSNP
rs553758041 143 dbSNP
rs1278099364 149 dbSNP
rs1228041042 152 dbSNP
rs967650798 153 dbSNP
rs1022633525 156 dbSNP
rs1209990993 157 dbSNP
rs1348523378 158 dbSNP
rs1282137888 160 dbSNP
rs1013039587 161 dbSNP
rs1179395799 162 dbSNP
rs1252088152 162 dbSNP
rs1471295166 164 dbSNP
rs1012141821 165 dbSNP
rs1180795953 176 dbSNP
rs1418169485 177 dbSNP
rs1462685856 178 dbSNP
rs894478418 186 dbSNP
rs533734488 187 dbSNP
rs1236656333 190 dbSNP
rs1334176126 192 dbSNP
rs1306621075 194 dbSNP
rs568170124 195 dbSNP
rs939255341 196 dbSNP
rs906465114 203 dbSNP
rs1357666141 204 dbSNP
rs1002980561 205 dbSNP
rs548259932 210 dbSNP
rs1289622939 211 dbSNP
rs1308407014 214 dbSNP
rs1207269257 222 dbSNP
rs543579401 229 dbSNP
rs1311149028 233 dbSNP
rs1482995691 234 dbSNP
rs1203898852 237 dbSNP
rs773286409 249 dbSNP
rs1376614220 261 dbSNP
rs537935292 265 dbSNP
rs770438454 265 dbSNP
rs1179713030 270 dbSNP
rs1412835627 272 dbSNP
rs1428953507 273 dbSNP
rs1452131013 274 dbSNP
rs1172231551 285 dbSNP
rs1368704518 294 dbSNP
rs907284471 303 dbSNP
rs763408027 309 dbSNP
rs1159473944 313 dbSNP
rs1446127965 315 dbSNP
rs1473373202 319 dbSNP
rs1362892129 342 dbSNP
rs994177875 347 dbSNP
rs1216728787 351 dbSNP
rs770000974 352 dbSNP
rs1342143745 361 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 2762.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gaguggacucgagggCACGGAc 5'
                         |||||| 
Target 5' ----------guuaaGUGCCUa 3'
 		1 - 12
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000530927.1 | 3UTR | GUUAAGUGCCUAAUACAUGCCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
THCA 0.047 0.46 -0.095 0.41 8 Click to see details
THCA 0.047 0.46 -0.095 0.41 8 Click to see details
THCA 0.047 0.46 -0.095 0.41 8 Click to see details
THCA 0.047 0.46 -0.095 0.41 8 Click to see details
THCA 0.047 0.46 -0.095 0.41 8 Click to see details
THCA 0.047 0.46 -0.095 0.41 8 Click to see details
THCA 0.047 0.46 -0.095 0.41 8 Click to see details
61 hsa-miR-3622a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT166678 ZSWIM6 zinc finger SWIM-type containing 6 2 2
MIRT452081 ATP6V0B ATPase H+ transporting V0 subunit b 2 2
MIRT457039 S1PR3 sphingosine-1-phosphate receptor 3 2 2
MIRT471975 NR3C1 nuclear receptor subfamily 3 group C member 1 2 2
MIRT474065 LMNB2 lamin B2 2 2
MIRT475862 H6PD hexose-6-phosphate dehydrogenase/glucose 1-dehydrogenase 2 2
MIRT476191 GOLGA8A golgin A8 family member A 2 2
MIRT476521 GABRB1 gamma-aminobutyric acid type A receptor beta1 subunit 2 2
MIRT483046 C15orf52 chromosome 15 open reading frame 52 2 4
MIRT495541 EIF3H eukaryotic translation initiation factor 3 subunit H 2 2
MIRT495892 CLOCK clock circadian regulator 2 2
MIRT495992 LTBP2 latent transforming growth factor beta binding protein 2 2 2
MIRT496001 EMP1 epithelial membrane protein 1 2 2
MIRT496208 PLEKHG2 pleckstrin homology and RhoGEF domain containing G2 2 2
MIRT496427 ACTRT3 actin related protein T3 2 2
MIRT496438 ZNF704 zinc finger protein 704 2 2
MIRT496473 SDE2 SDE2 telomere maintenance homolog 2 2
MIRT496555 TBX15 T-box 15 2 2
MIRT497202 CECR1 adenosine deaminase 2 2 2
MIRT507632 CREBZF CREB/ATF bZIP transcription factor 2 2
MIRT513377 MGAT4A mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme A 2 2
MIRT523460 GOLGA8J golgin A8 family member J 2 2
MIRT523465 GOLGA8I golgin A8 family member I, pseudogene 1 1
MIRT526049 GMDS GDP-mannose 4,6-dehydratase 2 2
MIRT533122 YIPF4 Yip1 domain family member 4 2 2
MIRT534183 SLC8A1 solute carrier family 8 member A1 2 2
MIRT556618 LCOR ligand dependent nuclear receptor corepressor 2 2
MIRT563361 WHSC1 nuclear receptor binding SET domain protein 2 2 2
MIRT563868 FAM206A family with sequence similarity 206 member A 2 2
MIRT564360 PPWD1 peptidylprolyl isomerase domain and WD repeat containing 1 2 2
MIRT564661 ZNF449 zinc finger protein 449 2 2
MIRT564805 ZBTB33 zinc finger and BTB domain containing 33 2 2
MIRT564867 ZBED3 zinc finger BED-type containing 3 2 2
MIRT565340 TMEM104 transmembrane protein 104 2 2
MIRT566439 PHF16 jade family PHD finger 3 2 2
MIRT567587 FCHSD2 FCH and double SH3 domains 2 2 2
MIRT569597 C3orf62 chromosome 3 open reading frame 62 2 2
MIRT569700 FMNL3 formin like 3 2 2
MIRT575957 Nanos1 nanos homolog 1 (Drosophila) 2 3
MIRT576516 Slc35e2 solute carrier family 35, member E2 2 2
MIRT608480 RRP36 ribosomal RNA processing 36 2 2
MIRT614335 NANOS1 nanos C2HC-type zinc finger 1 2 3
MIRT630816 ATAT1 alpha tubulin acetyltransferase 1 2 4
MIRT631708 C1QTNF6 C1q and TNF related 6 2 2
MIRT632369 SRRD SRR1 domain containing 2 2
MIRT633471 DSN1 DSN1 homolog, MIS12 kinetochore complex component 2 2
MIRT634478 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 2
MIRT667336 MTHFD1L methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1 like 2 2
MIRT667654 LFNG LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase 2 2
MIRT671046 SS18 SS18, nBAF chromatin remodeling complex subunit 2 2
MIRT672823 VEZT vezatin, adherens junctions transmembrane protein 2 2
MIRT673049 SGPL1 sphingosine-1-phosphate lyase 1 2 2
MIRT673435 APAF1 apoptotic peptidase activating factor 1 2 2
MIRT676096 DPP9 dipeptidyl peptidase 9 2 2
MIRT678059 RPL7L1 ribosomal protein L7 like 1 2 2
MIRT679783 GOLGA2 golgin A2 2 2
MIRT684219 C9orf64 chromosome 9 open reading frame 64 2 2
MIRT697642 WRN Werner syndrome RecQ like helicase 2 2
MIRT706595 C1RL complement C1r subcomponent like 2 2
MIRT706603 CCS copper chaperone for superoxide dismutase 2 2
MIRT717647 HLX H2.0 like homeobox 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-3622a Doxorubicin 31703 NSC123127 approved resistant High Hepatocellular Carcinoma cell line (HepG2)
hsa-mir-3622a Paclitaxel 36314 NSC125973 approved resistant cell line (W1)
hsa-miR-3622a-5p Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-3622a-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-3622a-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-3622a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-3622a-5p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-3622a-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-3622a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (MGC-803)
hsa-miR-3622a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-3622a-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-3622a-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-3622a-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (Panc1-GR3)
hsa-miR-3622a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)

Error report submission