miRTarBase - #MIRT526233


—
pre-miRNA Information
pre-miRNA hsa-mir-2355   
Genomic Coordinates chr2: 207109987 - 207110073
Description Homo sapiens miR-2355 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-2355-5p
Sequence 11| AUCCCCAGAUACAAUGGACAA |31
Evidence Experimental
Experiments SOLiD
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 1 2 - 207110063 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1268296297 4 dbSNP
rs1361046879 5 dbSNP
rs1219551997 6 dbSNP
rs1295756820 12 dbSNP
rs1345273529 15 dbSNP
rs977145706 15 dbSNP
rs1209629984 20 dbSNP
rs759940260 21 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol C2orf15   
Synonyms -
Description chromosome 2 open reading frame 15
Transcript NM_144706   
Expression
Putative miRNA Targets on C2orf15
3'UTR of C2orf15
(miRNA target sites are highlighted)		 
>C2orf15|NM_144706|3'UTR
   1 AGCAATTTGTACGTATTACCAAAGAAACCAAAAACTGCCTTTGACTAAGGGGGGTGTTGAAAGAGAACTTAACCTTATTA
  81 GGAAACCCTGACAAAATGATGGAAGACTATTGCCTTATTTTGCACTATTTGTGAATCATCTTACACTGCATTTTTTTATG
 161 ATGCTTATTCAAAAGGCAGTTGCTTTAGGGTGAAAAAGCCTTCCAAGATTCAAAGCAGATTTCTCTGGTATTATATTATA
 241 TCCTTCTTAAAAACCAGAGTTTTTAAGTAACAGTATTTGAATGGCATCAAAACATTTTCATTTTAATGTATTTCTTTAAC
 321 AAGTGGTTAAAAAAAGTGTCCAAGCAGCCGGGCGCAGTGGCTCACACCTGTAATCCCAGCACTTTGGGAGGCCAAGGCGG
 401 GTCAATCACCTGAGGTCAGGAGTTCGCAACCAGCCTGGCCAATATGGTGAGACCCCATCTCTACTAAAAATGCAAAAAGT
 481 TAGCCAGGCATGGTGGTGGGCACCTGTGATCCCAGCTACCTGGGAGGCTGAGGAAGGAGAATCGCTTGAACCCTGGAGGC
 561 GGAGGCTGCACTGAGCTGAGGTCATGCCATTGTACTCCAGCCTGGGCAACAAGAGCAAAACTCCGTCTCAAAAAAAAAAA
 641 AAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' aacaGGUAACAU-A-----GACCCCUa 5'
              |||||||| |     ||||| | 
Target 5' catgCCATTGTACTCCAGCCTGGGCAa 3'
 583 - 609 129.00 -14.32
2 
miRNA  3' aacAGGUAACAUAGACCCcua 5'
             |||    || |||||   
Target 5' tgaTCCCAGCTACCTGGGagg 3'
 507 - 527 110.00 -11.70
3 
miRNA  3' aacAGGUAACAU-AGACCCCUa 5'
             ||  ||| |  |||| |: 
Target 5' gaaTCGCTTGAACCCTGGAGGc 3'
 539 - 560 102.00 -8.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN14017258 14 COSMIC
COSN30122587 54 COSMIC
COSN5270497 55 COSMIC
COSN30129399 66 COSMIC
COSN31552825 123 COSMIC
COSN5270498 123 COSMIC
COSN9394469 353 COSMIC
COSN22787739 467 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs751665325 1 dbSNP
rs1488812718 5 dbSNP
rs756640722 6 dbSNP
rs144085307 8 dbSNP
rs185415798 9 dbSNP
rs1289183743 12 dbSNP
rs111826595 13 dbSNP
rs376071599 14 dbSNP
rs1282496043 15 dbSNP
rs1391302908 25 dbSNP
rs879069731 29 dbSNP
rs1305548089 31 dbSNP
rs779926644 36 dbSNP
rs1234859315 38 dbSNP
rs1280529582 41 dbSNP
rs368152150 42 dbSNP
rs1208412705 46 dbSNP
rs768100089 48 dbSNP
rs763094198 49 dbSNP
rs764730615 49 dbSNP
rs774062161 49 dbSNP
rs1047188023 50 dbSNP
rs374028854 51 dbSNP
rs1173854357 52 dbSNP
rs886207080 55 dbSNP
rs112564961 57 dbSNP
rs868706269 61 dbSNP
rs1176326017 64 dbSNP
rs1016001642 66 dbSNP
rs1194579823 70 dbSNP
rs145478469 75 dbSNP
rs1019521672 87 dbSNP
rs894836972 96 dbSNP
rs572375617 97 dbSNP
rs1257041155 101 dbSNP
rs899672668 102 dbSNP
rs1321490798 108 dbSNP
rs997085437 108 dbSNP
rs1032400688 109 dbSNP
rs541068536 110 dbSNP
rs1262506051 115 dbSNP
rs10201856 123 dbSNP
rs528283161 129 dbSNP
rs1385490942 132 dbSNP
rs1268225889 140 dbSNP
rs971586412 151 dbSNP
rs981586725 154 dbSNP
rs1384052203 158 dbSNP
rs1032282244 159 dbSNP
rs1020956112 180 dbSNP
rs1322499148 186 dbSNP
rs1403750866 191 dbSNP
rs970752490 217 dbSNP
rs956221551 219 dbSNP
rs1466621074 227 dbSNP
rs990675884 229 dbSNP
rs914661580 231 dbSNP
rs1475256880 232 dbSNP
rs190897202 233 dbSNP
rs1383608901 235 dbSNP
rs1460068515 242 dbSNP
rs1242591272 247 dbSNP
rs926866651 255 dbSNP
rs974707659 256 dbSNP
rs772557123 258 dbSNP
rs923198051 274 dbSNP
rs1213832769 278 dbSNP
rs1356778578 283 dbSNP
rs1285630898 287 dbSNP
rs1277981040 293 dbSNP
rs1350455077 294 dbSNP
rs1309392217 308 dbSNP
rs1206047731 310 dbSNP
rs1448262533 311 dbSNP
rs933201870 327 dbSNP
rs1327423860 329 dbSNP
rs1047621120 336 dbSNP
rs77235418 337 dbSNP
rs1270601984 344 dbSNP
rs938159459 350 dbSNP
rs182852568 351 dbSNP
rs563849747 352 dbSNP
rs148829737 354 dbSNP
rs931038465 355 dbSNP
rs1046838534 358 dbSNP
rs886765873 362 dbSNP
rs1231167727 364 dbSNP
rs1037894786 365 dbSNP
rs894856723 370 dbSNP
rs1425031508 371 dbSNP
rs1011873133 377 dbSNP
rs571446360 378 dbSNP
rs1219925924 385 dbSNP
rs538583283 393 dbSNP
rs943743781 394 dbSNP
rs1040899987 399 dbSNP
rs899766561 400 dbSNP
rs1470400527 402 dbSNP
rs1442088413 403 dbSNP
rs549670419 406 dbSNP
rs1427114847 411 dbSNP
rs1469285707 414 dbSNP
rs879647216 426 dbSNP
rs566248561 427 dbSNP
rs1405852385 434 dbSNP
rs1176639663 435 dbSNP
rs1270876016 442 dbSNP
rs956447239 442 dbSNP
rs1010061036 446 dbSNP
rs1197028178 453 dbSNP
rs1011706683 455 dbSNP
rs1021090142 466 dbSNP
rs35506231 474 dbSNP
rs1403061991 481 dbSNP
rs528050280 483 dbSNP
rs970677424 485 dbSNP
rs982118906 493 dbSNP
rs1219269720 494 dbSNP
rs188947556 499 dbSNP
rs1033904051 527 dbSNP
rs571268996 531 dbSNP
rs1290527185 533 dbSNP
rs2931530 537 dbSNP
rs1284114285 538 dbSNP
rs1345236105 541 dbSNP
rs536729859 544 dbSNP
rs1433178488 554 dbSNP
rs1343611210 561 dbSNP
rs1158481325 562 dbSNP
rs974760076 569 dbSNP
rs11890338 572 dbSNP
rs973703353 579 dbSNP
rs568535024 589 dbSNP
rs954679958 591 dbSNP
rs1484708957 597 dbSNP
rs1210225890 604 dbSNP
rs1462262544 608 dbSNP
rs1265581054 611 dbSNP
rs1222194648 617 dbSNP
rs1323384304 621 dbSNP
rs1279265030 623 dbSNP
rs1360150704 625 dbSNP
rs929522843 625 dbSNP
rs143578429 626 dbSNP
rs1448934663 626 dbSNP
rs1408351297 629 dbSNP
rs1469251834 629 dbSNP
rs1491183950 629 dbSNP
rs1182085566 630 dbSNP
rs1207133123 630 dbSNP
rs1240744891 630 dbSNP
rs1252343512 630 dbSNP
rs1280239020 630 dbSNP
rs1295174247 630 dbSNP
rs1306122020 630 dbSNP
rs1424203695 630 dbSNP
rs1491102407 630 dbSNP
rs55966864 630 dbSNP
rs746215848 630 dbSNP
rs747303058 630 dbSNP
rs758554997 630 dbSNP
rs869088484 630 dbSNP
rs865801267 638 dbSNP
rs1385201756 639 dbSNP
rs1249394293 655 dbSNP
rs1437978483 661 dbSNP
rs1400962628 664 dbSNP
rs908300688 673 dbSNP
rs1183889498 674 dbSNP
rs553184020 675 dbSNP
rs943671800 684 dbSNP
rs1353681538 685 dbSNP
rs1165151469 698 dbSNP
rs1446112475 701 dbSNP
rs907782808 710 dbSNP
rs1182456539 731 dbSNP
rs1040707037 739 dbSNP
rs1439757843 740 dbSNP
rs1179430623 741 dbSNP
rs1251128917 743 dbSNP
rs1479891861 743 dbSNP
rs1223636231 746 dbSNP
rs1479974493 759 dbSNP
rs1289794834 762 dbSNP
rs11123765 768 dbSNP
rs1037504518 772 dbSNP
rs1309114592 791 dbSNP
rs1389624739 795 dbSNP
rs1372472066 796 dbSNP
rs545326336 797 dbSNP
rs1467667663 798 dbSNP
rs557862723 809 dbSNP
rs147643448 813 dbSNP
rs1162530300 818 dbSNP
rs1046120426 819 dbSNP
rs906243628 826 dbSNP
rs1156254648 830 dbSNP
rs1410742038 831 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 150590.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' aacagguaacauagACCCCUa 5'
                        |||||| 
Target 5' -------ucaguagUGGGGAa 3'
 		1 - 14
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000512183.2 | 3UTR | UCAGUAGUGGGGAAUUCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BRCA -0.36 0 -0.389 0 84 Click to see details
KIRC -0.279 0.01 -0.279 0.01 68 Click to see details
PRAD -0.306 0.02 -0.356 0.01 50 Click to see details
KICH -0.405 0.02 -0.319 0.06 25 Click to see details
KIRP -0.351 0.02 -0.346 0.03 32 Click to see details
BLCA 0.47 0.02 0.337 0.09 18 Click to see details
STAD 0.284 0.06 0.179 0.16 32 Click to see details
CHOL -0.51 0.08 -0.733 0.01 9 Click to see details
LIHC 0.138 0.17 0.091 0.27 49 Click to see details
HNSC -0.147 0.18 -0.150 0.17 42 Click to see details
PCPG 0.821 0.19 0.500 0.33 3 Click to see details
UCEC -0.187 0.22 -0.179 0.23 19 Click to see details
PAAD -0.478 0.26 -0.400 0.3 4 Click to see details
THCA 0.067 0.31 -0.070 0.3 59 Click to see details
LUAD 0.111 0.37 0.000 0.5 12 Click to see details
ESCA 0.064 0.43 -0.073 0.42 11 Click to see details
LUSC -0.023 0.45 -0.034 0.42 38 Click to see details
CESC -0.144 0.45 -0.500 0.33 3 Click to see details
CESC -0.144 0.45 -0.500 0.33 3 Click to see details
164 hsa-miR-2355-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT190653 PABPN1 poly(A) binding protein nuclear 1 2 2
MIRT286477 TAOK1 TAO kinase 1 2 4
MIRT318993 GIGYF1 GRB10 interacting GYF protein 1 2 2
MIRT345622 DCAF7 DDB1 and CUL4 associated factor 7 2 4
MIRT442513 SYT7 synaptotagmin 7 2 4
MIRT444247 CTNND1 catenin delta 1 2 2
MIRT444780 ECE1 endothelin converting enzyme 1 2 2
MIRT456525 TMEM63A transmembrane protein 63A 2 2
MIRT468960 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 2
MIRT469834 R3HDM4 R3H domain containing 4 2 2
MIRT470027 PTP4A1 protein tyrosine phosphatase type IVA, member 1 2 2
MIRT471167 PHB2 prohibitin 2 2 2
MIRT475819 HDGF heparin binding growth factor 2 4
MIRT479389 CDKN1B cyclin dependent kinase inhibitor 1B 2 6
MIRT481747 APH1A aph-1 homolog A, gamma-secretase subunit 2 2
MIRT485220 PRICKLE1 prickle planar cell polarity protein 1 2 2
MIRT487259 CCNF cyclin F 2 2
MIRT489971 MCC mutated in colorectal cancers 2 4
MIRT491399 C1D C1D nuclear receptor corepressor 2 2
MIRT494959 CCDC144A coiled-coil domain containing 144A 2 4
MIRT494979 PPP5D1 PPP5 tetratricopeptide repeat domain containing 1 2 2
MIRT495225 CHST14 carbohydrate sulfotransferase 14 2 2
MIRT496550 TBX15 T-box 15 2 2
MIRT501612 PISD phosphatidylserine decarboxylase 2 2
MIRT509393 TRIM24 tripartite motif containing 24 2 2
MIRT519616 ZNF788 zinc finger family member 788 2 4
MIRT519738 ZNF394 zinc finger protein 394 2 4
MIRT521230 SAR1A secretion associated Ras related GTPase 1A 2 4
MIRT521801 POM121C POM121 transmembrane nucleoporin C 2 2
MIRT526233 C2orf15 chromosome 2 open reading frame 15 2 2
MIRT526932 CMSS1 cms1 ribosomal small subunit homolog (yeast) 2 2
MIRT529189 ACBD7 acyl-CoA binding domain containing 7 2 2
MIRT529329 ZNF649 zinc finger protein 649 2 2
MIRT529698 MRPL30 mitochondrial ribosomal protein L30 2 2
MIRT529921 TOP1MT DNA topoisomerase I mitochondrial 2 2
MIRT530032 SMC1A structural maintenance of chromosomes 1A 2 2
MIRT530898 C9orf3 chromosome 9 open reading frame 3 2 2
MIRT531621 TM4SF5 transmembrane 4 L six family member 5 2 4
MIRT533132 XIAP X-linked inhibitor of apoptosis 2 2
MIRT533210 WAPAL WAPL cohesin release factor 2 2
MIRT534058 ST6GALNAC3 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 3 2 2
MIRT535487 PARVB parvin beta 2 2
MIRT536749 HOXD9 homeobox D9 2 2
MIRT551456 CARKD NAD(P)HX dehydratase 2 2
MIRT551858 ASB6 ankyrin repeat and SOCS box containing 6 2 2
MIRT552095 FAM8A1 family with sequence similarity 8 member A1 2 2
MIRT552332 ZNF704 zinc finger protein 704 2 2
MIRT552549 ZFP36L2 ZFP36 ring finger protein like 2 2 2
MIRT561505 SRSF2 serine and arginine rich splicing factor 2 2 2
MIRT562702 ZNF415 zinc finger protein 415 2 2
MIRT563052 ZNF138 zinc finger protein 138 2 2
MIRT564592 ZNF791 zinc finger protein 791 2 2
MIRT566422 PIGA phosphatidylinositol glycan anchor biosynthesis class A 2 2
MIRT570176 RCBTB1 RCC1 and BTB domain containing protein 1 2 2
MIRT570866 ZNF525 zinc finger protein 525 2 2
MIRT570875 ZFP1 ZFP1 zinc finger protein 2 2
MIRT571517 ZNF625 zinc finger protein 625 2 2
MIRT572551 DKK3 dickkopf WNT signaling pathway inhibitor 3 2 2
MIRT610894 HINFP histone H4 transcription factor 2 2
MIRT611037 PTGES prostaglandin E synthase 2 2
MIRT611479 HSPA4 heat shock protein family A (Hsp70) member 4 2 4
MIRT612419 SP1 Sp1 transcription factor 2 2
MIRT614478 FRMPD3 FERM and PDZ domain containing 3 2 2
MIRT616318 CACNA1A calcium voltage-gated channel subunit alpha1 A 2 2
MIRT616929 ZNF638 zinc finger protein 638 2 2
MIRT618131 GABARAPL3 GABA type A receptor associated protein like 3 pseudogene 2 2
MIRT618452 ZFP30 ZFP30 zinc finger protein 2 4
MIRT620671 BBS5 Bardet-Biedl syndrome 5 2 2
MIRT620713 ASB16 ankyrin repeat and SOCS box containing 16 2 2
MIRT621126 EMC7 ER membrane protein complex subunit 7 2 4
MIRT621443 TOMM22 translocase of outer mitochondrial membrane 22 2 2
MIRT623491 KCTD11 potassium channel tetramerization domain containing 11 2 2
MIRT623783 GOSR1 golgi SNAP receptor complex member 1 2 2
MIRT623918 FNBP1L formin binding protein 1 like 2 2
MIRT625723 CXorf38 chromosome X open reading frame 38 2 2
MIRT625778 GCNT1 glucosaminyl (N-acetyl) transferase 1, core 2 2 2
MIRT626940 TTR transthyretin 2 2
MIRT627357 TSC22D2 TSC22 domain family member 2 2 2
MIRT632078 ALDH1A2 aldehyde dehydrogenase 1 family member A2 2 2
MIRT633361 FAM71F2 family with sequence similarity 71 member F2 2 2
MIRT639793 MVK mevalonate kinase 2 2
MIRT643761 NAGK N-acetylglucosamine kinase 2 2
MIRT644358 NDUFAF6 NADH:ubiquinone oxidoreductase complex assembly factor 6 2 2
MIRT645558 ZMYM1 zinc finger MYM-type containing 1 2 2
MIRT646588 ANKRD36 ankyrin repeat domain 36 2 2
MIRT646631 SLC25A46 solute carrier family 25 member 46 2 2
MIRT648066 HSPA6 heat shock protein family A (Hsp70) member 6 2 2
MIRT648142 SUCLG2 succinate-CoA ligase GDP-forming beta subunit 2 2
MIRT648416 MYOZ3 myozenin 3 2 2
MIRT649218 AMMECR1L AMMECR1 like 2 2
MIRT649772 MRPS27 mitochondrial ribosomal protein S27 2 4
MIRT650510 UFM1 ubiquitin fold modifier 1 2 2
MIRT651007 ZNF740 zinc finger protein 740 2 2
MIRT651524 WNT2B Wnt family member 2B 2 2
MIRT652014 TTYH3 tweety family member 3 2 2
MIRT652513 TMEM109 transmembrane protein 109 2 2
MIRT652686 THUMPD3 THUMP domain containing 3 2 2
MIRT652772 TENM3 teneurin transmembrane protein 3 2 2
MIRT653160 SPRY4 sprouty RTK signaling antagonist 4 2 2
MIRT653765 SIX5 SIX homeobox 5 2 2
MIRT653792 SIRPA signal regulatory protein alpha 2 2
MIRT655649 OAZ2 ornithine decarboxylase antizyme 2 2 2
MIRT656263 MEX3A mex-3 RNA binding family member A 2 2
MIRT657044 KCNH6 potassium voltage-gated channel subfamily H member 6 2 2
MIRT657375 HMGA1 high mobility group AT-hook 1 2 2
MIRT657532 GTDC1 glycosyltransferase like domain containing 1 2 2
MIRT657542 GSTO2 glutathione S-transferase omega 2 2 2
MIRT657828 GJD3 gap junction protein delta 3 2 2
MIRT658946 DOK6 docking protein 6 2 2
MIRT660363 BACH2 BTB domain and CNC homolog 2 2 2
MIRT660406 ATXN7L3 ataxin 7 like 3 2 2
MIRT660948 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 2
MIRT661031 AAK1 AP2 associated kinase 1 2 2
MIRT662435 RALGAPA1 Ral GTPase activating protein catalytic alpha subunit 1 2 2
MIRT668419 FAM217B family with sequence similarity 217 member B 2 2
MIRT669332 BSND barttin CLCNK type accessory beta subunit 2 2
MIRT676105 CLUAP1 clusterin associated protein 1 2 2
MIRT677084 SMIM15 small integral membrane protein 15 2 2
MIRT677127 OGFOD3 2-oxoglutarate and iron dependent oxygenase domain containing 3 2 2
MIRT678001 CPM carboxypeptidase M 2 2
MIRT678531 TMEM78 transmembrane protein 78 2 2
MIRT680000 ZNF860 zinc finger protein 860 2 2
MIRT680098 PXMP4 peroxisomal membrane protein 4 2 2
MIRT686795 SOX12 SRY-box 12 2 2
MIRT698887 SPTBN2 spectrin beta, non-erythrocytic 2 2 2
MIRT699371 SLC30A6 solute carrier family 30 member 6 2 2
MIRT702005 MIDN midnolin 2 2
MIRT708101 IGF2BP1 insulin like growth factor 2 mRNA binding protein 1 2 2
MIRT709563 GYG2 glycogenin 2 2 2
MIRT710559 PPP2R5E protein phosphatase 2 regulatory subunit B'epsilon 2 2
MIRT710585 CDCA4 cell division cycle associated 4 2 2
MIRT710873 NT5DC1 5'-nucleotidase domain containing 1 2 2
MIRT711876 VASP vasodilator stimulated phosphoprotein 2 2
MIRT712226 RIMS3 regulating synaptic membrane exocytosis 3 2 2
MIRT713211 FAM13A family with sequence similarity 13 member A 2 2
MIRT713261 GPR55 G protein-coupled receptor 55 2 2
MIRT713327 DNAJC28 DnaJ heat shock protein family (Hsp40) member C28 2 2
MIRT713889 RNF19B ring finger protein 19B 2 2
MIRT714015 UBAP2L ubiquitin associated protein 2 like 2 2
MIRT714202 NLRP12 NLR family pyrin domain containing 12 2 2
MIRT714717 VPS8 VPS8, CORVET complex subunit 2 2
MIRT714748 ZNF385D zinc finger protein 385D 2 2
MIRT714806 ARHGEF19 Rho guanine nucleotide exchange factor 19 2 2
MIRT714852 ADAMTS17 ADAM metallopeptidase with thrombospondin type 1 motif 17 2 2
MIRT715717 MRPL4 mitochondrial ribosomal protein L4 2 2
MIRT715852 GRIN2A glutamate ionotropic receptor NMDA type subunit 2A 2 2
MIRT716853 MFSD12 major facilitator superfamily domain containing 12 2 2
MIRT717134 EBPL emopamil binding protein like 2 2
MIRT717248 TMEM246 transmembrane protein 246 2 2
MIRT717997 ZNF79 zinc finger protein 79 2 2
MIRT718341 PURA purine rich element binding protein A 2 2
MIRT719587 TFCP2L1 transcription factor CP2 like 1 2 2
MIRT720520 PTGR2 prostaglandin reductase 2 2 2
MIRT720671 SLC39A13 solute carrier family 39 member 13 2 2
MIRT721213 DCLK3 doublecortin like kinase 3 2 2
MIRT721757 INF2 inverted formin, FH2 and WH2 domain containing 2 2
MIRT721826 POU6F1 POU class 6 homeobox 1 2 2
MIRT722091 SUSD1 sushi domain containing 1 2 2
MIRT722275 LURAP1 leucine rich adaptor protein 1 2 2
MIRT722802 ARHGAP19 Rho GTPase activating protein 19 2 2
MIRT722866 FAM212B family with sequence similarity 212 member B 2 2
MIRT723113 ZSCAN16 zinc finger and SCAN domain containing 16 2 2
MIRT724378 NEK8 NIMA related kinase 8 2 2
MIRT732775 PYCR1 pyrroline-5-carboxylate reductase 1 3 0
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-2355 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-2355-5p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-2355-5p Fluorouracil 3385 NSC19893 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-2355-5p Imatinib 5291 NSC743414 approved resistant High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-2355-5p Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (A549, HCC827)
hsa-miR-2355-5p Gefitinib 123631 NSC715055 approved resistant High Non-Small Cell Lung Cancer cell line (A549, HCC827)
hsa-miR-2355-5p Temozolomide 5394 NSC362856 approved resistant High Glioma tissue
hsa-miR-2355-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-2355-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (451Lu)
hsa-miR-2355-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-2355-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-2355-5p Tamoxifen+Fulvestrant sensitive cell line (LCC9)
hsa-miR-2355-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-2355-5p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-2355-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (TOV-112D)
hsa-miR-2355-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (OVSAHO)

Error report submission