miRTarBase - #MIRT526236


—
pre-miRNA Information
pre-miRNA hsa-mir-4301   
Genomic Coordinates chr11: 113450023 - 113450088
Description Homo sapiens miR-4301 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4301
Sequence 11| UCCCACUACUUCACUUGUGA |30
Evidence Experimental
Experiments SOLiD
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs184176277 2 dbSNP
rs1191324913 13 dbSNP
rs1369198005 15 dbSNP
rs1036973189 16 dbSNP
rs944900541 18 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol C2orf15   
Synonyms -
Description chromosome 2 open reading frame 15
Transcript NM_144706   
Expression
Putative miRNA Targets on C2orf15
3'UTR of C2orf15
(miRNA target sites are highlighted)		 
>C2orf15|NM_144706|3'UTR
   1 AGCAATTTGTACGTATTACCAAAGAAACCAAAAACTGCCTTTGACTAAGGGGGGTGTTGAAAGAGAACTTAACCTTATTA
  81 GGAAACCCTGACAAAATGATGGAAGACTATTGCCTTATTTTGCACTATTTGTGAATCATCTTACACTGCATTTTTTTATG
 161 ATGCTTATTCAAAAGGCAGTTGCTTTAGGGTGAAAAAGCCTTCCAAGATTCAAAGCAGATTTCTCTGGTATTATATTATA
 241 TCCTTCTTAAAAACCAGAGTTTTTAAGTAACAGTATTTGAATGGCATCAAAACATTTTCATTTTAATGTATTTCTTTAAC
 321 AAGTGGTTAAAAAAAGTGTCCAAGCAGCCGGGCGCAGTGGCTCACACCTGTAATCCCAGCACTTTGGGAGGCCAAGGCGG
 401 GTCAATCACCTGAGGTCAGGAGTTCGCAACCAGCCTGGCCAATATGGTGAGACCCCATCTCTACTAAAAATGCAAAAAGT
 481 TAGCCAGGCATGGTGGTGGGCACCTGTGATCCCAGCTACCTGGGAGGCTGAGGAAGGAGAATCGCTTGAACCCTGGAGGC
 561 GGAGGCTGCACTGAGCTGAGGTCATGCCATTGTACTCCAGCCTGGGCAACAAGAGCAAAACTCCGTCTCAAAAAAAAAAA
 641 AAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' aguGUUCACUUCAUCACCCu 5'
             ||:|   :||:||||| 
Target 5' agcCAGGCATGGTGGTGGGc 3'
 482 - 501 137.00 -16.80
2 
miRNA  3' aguguucacuucaUCACCcu 5'
                       |||||  
Target 5' tatttctttaacaAGTGGtt 3'
 309 - 328 100.00 -8.11
3 
miRNA  3' aguguucacuucaUCACCcu 5'
                       |||||  
Target 5' agcagccgggcgcAGTGGct 3'
 343 - 362 100.00 -7.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN14017258 14 COSMIC
COSN30122587 54 COSMIC
COSN5270497 55 COSMIC
COSN30129399 66 COSMIC
COSN31552825 123 COSMIC
COSN5270498 123 COSMIC
COSN9394469 353 COSMIC
COSN22787739 467 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs751665325 1 dbSNP
rs1488812718 5 dbSNP
rs756640722 6 dbSNP
rs144085307 8 dbSNP
rs185415798 9 dbSNP
rs1289183743 12 dbSNP
rs111826595 13 dbSNP
rs376071599 14 dbSNP
rs1282496043 15 dbSNP
rs1391302908 25 dbSNP
rs879069731 29 dbSNP
rs1305548089 31 dbSNP
rs779926644 36 dbSNP
rs1234859315 38 dbSNP
rs1280529582 41 dbSNP
rs368152150 42 dbSNP
rs1208412705 46 dbSNP
rs768100089 48 dbSNP
rs763094198 49 dbSNP
rs764730615 49 dbSNP
rs774062161 49 dbSNP
rs1047188023 50 dbSNP
rs374028854 51 dbSNP
rs1173854357 52 dbSNP
rs886207080 55 dbSNP
rs112564961 57 dbSNP
rs868706269 61 dbSNP
rs1176326017 64 dbSNP
rs1016001642 66 dbSNP
rs1194579823 70 dbSNP
rs145478469 75 dbSNP
rs1019521672 87 dbSNP
rs894836972 96 dbSNP
rs572375617 97 dbSNP
rs1257041155 101 dbSNP
rs899672668 102 dbSNP
rs1321490798 108 dbSNP
rs997085437 108 dbSNP
rs1032400688 109 dbSNP
rs541068536 110 dbSNP
rs1262506051 115 dbSNP
rs10201856 123 dbSNP
rs528283161 129 dbSNP
rs1385490942 132 dbSNP
rs1268225889 140 dbSNP
rs971586412 151 dbSNP
rs981586725 154 dbSNP
rs1384052203 158 dbSNP
rs1032282244 159 dbSNP
rs1020956112 180 dbSNP
rs1322499148 186 dbSNP
rs1403750866 191 dbSNP
rs970752490 217 dbSNP
rs956221551 219 dbSNP
rs1466621074 227 dbSNP
rs990675884 229 dbSNP
rs914661580 231 dbSNP
rs1475256880 232 dbSNP
rs190897202 233 dbSNP
rs1383608901 235 dbSNP
rs1460068515 242 dbSNP
rs1242591272 247 dbSNP
rs926866651 255 dbSNP
rs974707659 256 dbSNP
rs772557123 258 dbSNP
rs923198051 274 dbSNP
rs1213832769 278 dbSNP
rs1356778578 283 dbSNP
rs1285630898 287 dbSNP
rs1277981040 293 dbSNP
rs1350455077 294 dbSNP
rs1309392217 308 dbSNP
rs1206047731 310 dbSNP
rs1448262533 311 dbSNP
rs933201870 327 dbSNP
rs1327423860 329 dbSNP
rs1047621120 336 dbSNP
rs77235418 337 dbSNP
rs1270601984 344 dbSNP
rs938159459 350 dbSNP
rs182852568 351 dbSNP
rs563849747 352 dbSNP
rs148829737 354 dbSNP
rs931038465 355 dbSNP
rs1046838534 358 dbSNP
rs886765873 362 dbSNP
rs1231167727 364 dbSNP
rs1037894786 365 dbSNP
rs894856723 370 dbSNP
rs1425031508 371 dbSNP
rs1011873133 377 dbSNP
rs571446360 378 dbSNP
rs1219925924 385 dbSNP
rs538583283 393 dbSNP
rs943743781 394 dbSNP
rs1040899987 399 dbSNP
rs899766561 400 dbSNP
rs1470400527 402 dbSNP
rs1442088413 403 dbSNP
rs549670419 406 dbSNP
rs1427114847 411 dbSNP
rs1469285707 414 dbSNP
rs879647216 426 dbSNP
rs566248561 427 dbSNP
rs1405852385 434 dbSNP
rs1176639663 435 dbSNP
rs1270876016 442 dbSNP
rs956447239 442 dbSNP
rs1010061036 446 dbSNP
rs1197028178 453 dbSNP
rs1011706683 455 dbSNP
rs1021090142 466 dbSNP
rs35506231 474 dbSNP
rs1403061991 481 dbSNP
rs528050280 483 dbSNP
rs970677424 485 dbSNP
rs982118906 493 dbSNP
rs1219269720 494 dbSNP
rs188947556 499 dbSNP
rs1033904051 527 dbSNP
rs571268996 531 dbSNP
rs1290527185 533 dbSNP
rs2931530 537 dbSNP
rs1284114285 538 dbSNP
rs1345236105 541 dbSNP
rs536729859 544 dbSNP
rs1433178488 554 dbSNP
rs1343611210 561 dbSNP
rs1158481325 562 dbSNP
rs974760076 569 dbSNP
rs11890338 572 dbSNP
rs973703353 579 dbSNP
rs568535024 589 dbSNP
rs954679958 591 dbSNP
rs1484708957 597 dbSNP
rs1210225890 604 dbSNP
rs1462262544 608 dbSNP
rs1265581054 611 dbSNP
rs1222194648 617 dbSNP
rs1323384304 621 dbSNP
rs1279265030 623 dbSNP
rs1360150704 625 dbSNP
rs929522843 625 dbSNP
rs143578429 626 dbSNP
rs1448934663 626 dbSNP
rs1408351297 629 dbSNP
rs1469251834 629 dbSNP
rs1491183950 629 dbSNP
rs1182085566 630 dbSNP
rs1207133123 630 dbSNP
rs1240744891 630 dbSNP
rs1252343512 630 dbSNP
rs1280239020 630 dbSNP
rs1295174247 630 dbSNP
rs1306122020 630 dbSNP
rs1424203695 630 dbSNP
rs1491102407 630 dbSNP
rs55966864 630 dbSNP
rs746215848 630 dbSNP
rs747303058 630 dbSNP
rs758554997 630 dbSNP
rs869088484 630 dbSNP
rs865801267 638 dbSNP
rs1385201756 639 dbSNP
rs1249394293 655 dbSNP
rs1437978483 661 dbSNP
rs1400962628 664 dbSNP
rs908300688 673 dbSNP
rs1183889498 674 dbSNP
rs553184020 675 dbSNP
rs943671800 684 dbSNP
rs1353681538 685 dbSNP
rs1165151469 698 dbSNP
rs1446112475 701 dbSNP
rs907782808 710 dbSNP
rs1182456539 731 dbSNP
rs1040707037 739 dbSNP
rs1439757843 740 dbSNP
rs1179430623 741 dbSNP
rs1251128917 743 dbSNP
rs1479891861 743 dbSNP
rs1223636231 746 dbSNP
rs1479974493 759 dbSNP
rs1289794834 762 dbSNP
rs11123765 768 dbSNP
rs1037504518 772 dbSNP
rs1309114592 791 dbSNP
rs1389624739 795 dbSNP
rs1372472066 796 dbSNP
rs545326336 797 dbSNP
rs1467667663 798 dbSNP
rs557862723 809 dbSNP
rs147643448 813 dbSNP
rs1162530300 818 dbSNP
rs1046120426 819 dbSNP
rs906243628 826 dbSNP
rs1156254648 830 dbSNP
rs1410742038 831 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 150590.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' aguguucacuUCAUCACCCu 5'
                    ||||||||| 
Target 5' --------ucAGUAGUGGGg 3'
 		1 - 12
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000512183.2 | 3UTR | UCAGUAGUGGGGAAUUCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
83 hsa-miR-4301 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT081134 LDLR low density lipoprotein receptor 2 4
MIRT090911 ARHGEF26 Rho guanine nucleotide exchange factor 26 2 2
MIRT229436 MECP2 methyl-CpG binding protein 2 2 2
MIRT274717 CPSF6 cleavage and polyadenylation specific factor 6 2 2
MIRT350957 BACH1 BTB domain and CNC homolog 1 2 2
MIRT386722 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 2
MIRT446022 PEX3 peroxisomal biogenesis factor 3 2 2
MIRT481303 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 2 14
MIRT483959 ZNF354B zinc finger protein 354B 2 6
MIRT495667 TUBAL3 tubulin alpha like 3 2 2
MIRT496554 TBX15 T-box 15 2 2
MIRT497702 ARL6IP6 ADP ribosylation factor like GTPase 6 interacting protein 6 2 2
MIRT498105 RMND5A required for meiotic nuclear division 5 homolog A 2 2
MIRT512535 SEMA4D semaphorin 4D 2 2
MIRT512556 MFN2 mitofusin 2 2 6
MIRT521465 RABGAP1 RAB GTPase activating protein 1 2 6
MIRT526236 C2orf15 chromosome 2 open reading frame 15 2 2
MIRT526743 HLA-DOB major histocompatibility complex, class II, DO beta 2 2
MIRT527578 BRD7 bromodomain containing 7 2 4
MIRT528038 WT1 Wilms tumor 1 2 2
MIRT528267 GPRIN2 G protein regulated inducer of neurite outgrowth 2 2 2
MIRT528505 HTR7 5-hydroxytryptamine receptor 7 2 4
MIRT528758 RPS27 ribosomal protein S27 2 6
MIRT528999 IPO9 importin 9 2 2
MIRT529701 MRPL30 mitochondrial ribosomal protein L30 2 2
MIRT529781 C17orf82 chromosome 17 open reading frame 82 2 2
MIRT533797 TMEM119 transmembrane protein 119 2 6
MIRT535308 PHF12 PHD finger protein 12 2 2
MIRT535917 MKL2 MKL1/myocardin like 2 2 2
MIRT544892 OSBPL1A oxysterol binding protein like 1A 2 2
MIRT555423 PPIC peptidylprolyl isomerase C 2 2
MIRT562068 KLHL15 kelch like family member 15 2 2
MIRT565623 SLC31A1 solute carrier family 31 member 1 2 2
MIRT565661 SIX1 SIX homeobox 1 2 2
MIRT570138 IL1RL2 interleukin 1 receptor like 2 2 2
MIRT571045 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 2 2
MIRT621232 LMAN1 lectin, mannose binding 1 2 2
MIRT622272 SH3TC2 SH3 domain and tetratricopeptide repeats 2 2 2
MIRT623844 GAN gigaxonin 2 2
MIRT626158 NFYA nuclear transcription factor Y subunit alpha 2 2
MIRT626464 CMKLR1 chemerin chemokine-like receptor 1 2 2
MIRT632087 ALDH1A2 aldehyde dehydrogenase 1 family member A2 2 2
MIRT637243 FAM26E calcium homeostasis modulator family member 5 2 2
MIRT642710 FGFR1OP2 FGFR1 oncogene partner 2 2 2
MIRT643611 KANSL3 KAT8 regulatory NSL complex subunit 3 2 2
MIRT644270 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 2 2
MIRT645470 SPIN3 spindlin family member 3 2 2
MIRT649193 DNPEP aspartyl aminopeptidase 2 2
MIRT650776 POP4 POP4 homolog, ribonuclease P/MRP subunit 2 2
MIRT651345 ZC2HC1C zinc finger C2HC-type containing 1C 2 2
MIRT652237 TRAPPC3L trafficking protein particle complex 3 like 2 2
MIRT652587 TIMM8A translocase of inner mitochondrial membrane 8A 2 2
MIRT654591 PURA purine rich element binding protein A 2 2
MIRT654649 PTAFR platelet activating factor receptor 2 2
MIRT656842 KLF7 Kruppel like factor 7 2 2
MIRT657209 IKZF2 IKAROS family zinc finger 2 2 2
MIRT658513 ETV3 ETS variant 3 2 2
MIRT659448 CNNM2 cyclin and CBS domain divalent metal cation transport mediator 2 2 2
MIRT668816 CYLD CYLD lysine 63 deubiquitinase 2 2
MIRT669067 CELSR3 cadherin EGF LAG seven-pass G-type receptor 3 2 2
MIRT677711 ELOF1 elongation factor 1 homolog 2 4
MIRT687146 PTPN12 protein tyrosine phosphatase, non-receptor type 12 2 2
MIRT698498 THOC2 THO complex 2 2 2
MIRT707930 PPP1R3D protein phosphatase 1 regulatory subunit 3D 4 2
MIRT708737 FAM71F2 family with sequence similarity 71 member F2 2 2
MIRT710031 POLL DNA polymerase lambda 2 2
MIRT712175 STK4 serine/threonine kinase 4 2 2
MIRT715297 MAPK1 mitogen-activated protein kinase 1 2 2
MIRT716892 AGPAT6 glycerol-3-phosphate acyltransferase 4 2 2
MIRT717378 RBM41 RNA binding motif protein 41 2 2
MIRT718082 CLIC5 chloride intracellular channel 5 2 2
MIRT718721 ANKRD18A ankyrin repeat domain 18A 2 2
MIRT719152 DPYSL5 dihydropyrimidinase like 5 2 2
MIRT719224 CAMK4 calcium/calmodulin dependent protein kinase IV 2 2
MIRT719528 SRCIN1 SRC kinase signaling inhibitor 1 2 2
MIRT719861 KLF2 Kruppel like factor 2 2 2
MIRT720326 CAMK2G calcium/calmodulin dependent protein kinase II gamma 2 2
MIRT721596 SREBF1 sterol regulatory element binding transcription factor 1 2 2
MIRT722020 NEBL nebulette 2 2
MIRT722484 QSOX1 quiescin sulfhydryl oxidase 1 2 2
MIRT722614 TEAD1 TEA domain transcription factor 1 2 2
MIRT723664 RPTN repetin 2 2
MIRT723939 SVOP SV2 related protein 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4301 Cisplatin 5460033 NSC119875 approved sensitive High Hepatocellular Carcinoma cell line (Hep3B, 97L)
hsa-miR-4301 Imatinib 5291 NSC743414 approved resistant High Chronic Myelogenous Leukemia cell line (K562)
hsa-mir-4301 Paclitaxel 36314 NSC125973 approved resistant cell line (BAS)
hsa-mir-4301 Paclitaxel 36314 NSC125973 approved sensitive cell line (W1)
hsa-mir-4301 Doxorubicin 31703 NSC123127 approved sensitive cell line (W1)
hsa-mir-4301 Methotrexate 126941 NSC740 approved sensitive cell line (W1)
hsa-mir-4301 Topotecan 60699 NSC609699 approved sensitive cell line (W1)
hsa-miR-4301 Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-4301 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)

Error report submission