miRTarBase - #MIRT526504


—
pre-miRNA Information
pre-miRNA hsa-mir-3663   
Genomic Coordinates chr10: 117167678 - 117167774
Description Homo sapiens miR-3663 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3663-5p
Sequence 21| GCUGGUCUGCGUGGUGCUCGG |41
Evidence Experimental
Experiments Northern
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs111525499 10 dbSNP
rs1186183324 11 dbSNP
rs1166397684 12 dbSNP
rs1391472885 17 dbSNP
rs1461514502 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol POU5F1B   
Synonyms OCT4-PG1, OCT4PG1, OTF3C, OTF3P1, POU5F1P1, POU5F1P4, POU5FLC20, POU5FLC8
Description POU class 5 homeobox 1B
Transcript NM_001159542   
Expression
Putative miRNA Targets on POU5F1B
3'UTR of POU5F1B
(miRNA target sites are highlighted)		 
>POU5F1B|NM_001159542|3'UTR
   1 GGTGCCTGCCCTTCTAGGAATGGGGAACAGGGGAGGGGAGGAGCTAGGGAAAGAGAACCTGGAGTTTGTGGCAGGGCTTT
  81 TGGGATTAAGTTCTTCATTCACTAAGGAAGGAATTGGGAACACTAAGGGTGGGGGCAGGGGAGTTTGGGGCAACTGGTTG
 161 GAGGGAAGGTGAAGTTCAATGATGCTCTTGATTTTAATCCCACATCATGTATCACTTTTTTCTTAAATAAAGAAGCCTGG
 241 GACACAGTAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ggcUCGUGGUGCGUCUGGUCg 5'
             || |  |:| :|| ||| 
Target 5' tctAGGA--ATGGGGAACAGg 3'
 13 - 31 102.00 -8.60
2 
miRNA  3' ggcUCGUGGUGCGUCUG-GUCg 5'
             || | | :| :||| ||| 
Target 5' taaAGAAGCCTG-GGACACAGt 3'
 228 - 248 101.00 -9.30
3 
miRNA  3' ggCUCGUGGUGC---GUCUGGUCg 5'
            || |||:| |    :|: ||| 
Target 5' ggGAACACTAAGGGTGGGGGCAGg 3'
 116 - 139 91.00 -11.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30138614 5 COSMIC
COSN30192590 7 COSMIC
COSN30190048 14 COSMIC
COSN30119654 27 COSMIC
COSN30512023 36 COSMIC
COSN30119655 57 COSMIC
COSN19657023 72 COSMIC
COSN24302619 91 COSMIC
COSN31606738 94 COSMIC
COSN26635477 144 COSMIC
COSN30167910 145 COSMIC
COSN25786736 195 COSMIC
COSN30128278 241 COSMIC
COSN8861223 250 COSMIC
COSN23013005 261 COSMIC
COSN8518341 262 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs780707684 5 dbSNP
rs745769186 6 dbSNP
rs756085416 9 dbSNP
rs1382272774 10 dbSNP
rs1319112017 12 dbSNP
rs1247034845 15 dbSNP
rs1317192950 21 dbSNP
rs779804055 22 dbSNP
rs920588496 22 dbSNP
rs373454446 26 dbSNP
rs749166599 27 dbSNP
rs187298898 29 dbSNP
rs755512421 29 dbSNP
rs774564179 30 dbSNP
rs371237720 32 dbSNP
rs772229313 38 dbSNP
rs1382963449 41 dbSNP
rs1242340775 42 dbSNP
rs1444822632 49 dbSNP
rs1182501314 54 dbSNP
rs1449532795 58 dbSNP
rs943769340 60 dbSNP
rs1489517123 63 dbSNP
rs9297754 72 dbSNP
rs1290361391 73 dbSNP
rs1211375726 76 dbSNP
rs1357602653 77 dbSNP
rs78695295 84 dbSNP
rs1229299430 86 dbSNP
rs1367433635 89 dbSNP
rs549402782 91 dbSNP
rs1184008109 95 dbSNP
rs1050662777 99 dbSNP
rs1411895323 104 dbSNP
rs1325982925 112 dbSNP
rs1403932825 115 dbSNP
rs1423522094 122 dbSNP
rs563132584 123 dbSNP
rs1162533647 124 dbSNP
rs9297755 125 dbSNP
rs1362544797 129 dbSNP
rs890437832 131 dbSNP
rs1421398146 132 dbSNP
rs1296291609 134 dbSNP
rs1165605903 135 dbSNP
rs78931371 136 dbSNP
rs182512875 138 dbSNP
rs1200791467 139 dbSNP
rs956794271 140 dbSNP
rs1268529530 142 dbSNP
rs1206139773 149 dbSNP
rs1344513286 166 dbSNP
rs1270996985 176 dbSNP
rs1304430154 178 dbSNP
rs534247326 180 dbSNP
rs1227388108 188 dbSNP
rs1277108162 192 dbSNP
rs547856508 200 dbSNP
rs1355251022 203 dbSNP
rs1345281698 207 dbSNP
rs1308956672 209 dbSNP
rs1237384351 210 dbSNP
rs1371982599 211 dbSNP
rs1285888778 217 dbSNP
rs1326331601 222 dbSNP
rs1443569707 223 dbSNP
rs188074125 224 dbSNP
rs1236104099 226 dbSNP
rs1483010887 227 dbSNP
rs1179530177 228 dbSNP
rs1174239054 229 dbSNP
rs943463276 229 dbSNP
rs1382198402 237 dbSNP
rs3179559 238 dbSNP
rs1437882921 244 dbSNP
rs1203987069 245 dbSNP
rs192359771 246 dbSNP
rs1407143549 247 dbSNP
rs199935435 248 dbSNP
rs1253583002 249 dbSNP
rs1323394437 249 dbSNP
rs1406146592 249 dbSNP
rs71303488 249 dbSNP
rs868125972 250 dbSNP
rs556160013 257 dbSNP
rs1172021598 258 dbSNP
rs1177884440 260 dbSNP
rs1473216454 261 dbSNP
rs200889381 261 dbSNP
rs71861974 261 dbSNP
rs1321136478 262 dbSNP
rs1461298145 262 dbSNP
rs368932899 262 dbSNP
rs969446054 264 dbSNP
rs1357239984 265 dbSNP
rs74548710 265 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 5462.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000465342.2 | 3UTR | AAAUUUUAUUUAUUUACUUAUUUAUUUUGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
203 hsa-miR-3663-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT222528 CRCP CGRP receptor component 2 2
MIRT442432 CACNG8 calcium voltage-gated channel auxiliary subunit gamma 8 2 6
MIRT450423 BCL2L14 BCL2 like 14 2 2
MIRT456341 RCSD1 RCSD domain containing 1 2 2
MIRT479763 CCND1 cyclin D1 2 2
MIRT487162 IFRD1 interferon related developmental regulator 1 2 8
MIRT495471 ALDOA aldolase, fructose-bisphosphate A 2 2
MIRT497193 DUSP18 dual specificity phosphatase 18 2 2
MIRT499717 PAGR1 PAXIP1 associated glutamate rich protein 1 2 10
MIRT502681 CSNK1G3 casein kinase 1 gamma 3 2 8
MIRT503641 POLR2F RNA polymerase II subunit F 2 4
MIRT510824 SBNO1 strawberry notch homolog 1 2 4
MIRT512347 ZNF665 zinc finger protein 665 2 4
MIRT512528 ATCAY ATCAY, caytaxin 2 4
MIRT513246 FBXO17 F-box protein 17 2 4
MIRT513502 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 2 6
MIRT516033 PTAFR platelet activating factor receptor 2 2
MIRT517669 TRIM72 tripartite motif containing 72 2 2
MIRT517691 FAM175A abraxas 1, BRCA1 A complex subunit 2 2
MIRT519524 ZNF8 zinc finger protein 8 2 2
MIRT520953 SRSF10 serine and arginine rich splicing factor 10 2 2
MIRT522074 ORAI2 ORAI calcium release-activated calcium modulator 2 2 4
MIRT525333 CNGB1 cyclic nucleotide gated channel beta 1 2 2
MIRT526504 POU5F1B POU class 5 homeobox 1B 2 2
MIRT527847 RDH11 retinol dehydrogenase 11 (all-trans/9-cis/11-cis) 2 2
MIRT529211 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT530071 VN1R1 vomeronasal 1 receptor 1 2 2
MIRT530639 PPIC peptidylprolyl isomerase C 2 4
MIRT530679 CHRNB1 cholinergic receptor nicotinic beta 1 subunit 2 4
MIRT532177 SEC14L5 SEC14 like lipid binding 5 2 2
MIRT532432 DHX33 DEAH-box helicase 33 2 2
MIRT532832 ZNF704 zinc finger protein 704 2 2
MIRT534236 SLC25A16 solute carrier family 25 member 16 2 4
MIRT535115 PLXNA2 plexin A2 2 2
MIRT535563 OMD osteomodulin 2 2
MIRT536487 KIAA1468 KIAA1468 2 2
MIRT538371 CRISPLD2 cysteine rich secretory protein LCCL domain containing 2 2 2
MIRT539931 NUCB1 nucleobindin 1 2 4
MIRT562305 GINM1 glycoprotein integral membrane 1 2 2
MIRT563280 BBS10 Bardet-Biedl syndrome 10 2 2
MIRT618205 C22orf39 chromosome 22 open reading frame 39 2 2
MIRT620113 HARBI1 harbinger transposase derived 1 2 2
MIRT621189 FAM153B family with sequence similarity 153 member B 2 2
MIRT623755 GRID1 glutamate ionotropic receptor delta type subunit 1 2 2
MIRT624059 EIF4E eukaryotic translation initiation factor 4E 2 2
MIRT625016 TMIGD2 transmembrane and immunoglobulin domain containing 2 2 2
MIRT626073 CWF19L1 CWF19 like 1, cell cycle control (S. pombe) 2 2
MIRT627875 PAN2 PAN2 poly(A) specific ribonuclease subunit 2 2
MIRT629306 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT630446 IDE insulin degrading enzyme 2 2
MIRT631000 ZNF573 zinc finger protein 573 2 2
MIRT631093 UQCRB ubiquinol-cytochrome c reductase binding protein 2 2
MIRT631282 SGSM1 small G protein signaling modulator 1 2 2
MIRT631530 MYO6 myosin VI 2 2
MIRT631642 WDR91 WD repeat domain 91 2 4
MIRT631825 TMEM154 transmembrane protein 154 2 2
MIRT632778 LZIC leucine zipper and CTNNBIP1 domain containing 2 2
MIRT633278 FGFR1OP2 FGFR1 oncogene partner 2 2 2
MIRT633658 SLC28A1 solute carrier family 28 member 1 2 2
MIRT634071 PLIN3 perilipin 3 2 2
MIRT634159 YME1L1 YME1 like 1 ATPase 2 2
MIRT634227 TMEM132B transmembrane protein 132B 2 2
MIRT636401 MYO5A myosin VA 2 2
MIRT638678 GCLM glutamate-cysteine ligase modifier subunit 2 2
MIRT640231 TOMM40 translocase of outer mitochondrial membrane 40 2 2
MIRT640304 PRR13 proline rich 13 2 2
MIRT641125 NPHP3 nephrocystin 3 2 2
MIRT643422 ERVMER34-1 endogenous retrovirus group MER34 member 1, envelope 2 2
MIRT643700 KIAA0586 KIAA0586 2 2
MIRT644314 NFKBID NFKB inhibitor delta 2 2
MIRT644345 MPV17L MPV17 mitochondrial inner membrane protein like 2 2
MIRT645736 POLR3A RNA polymerase III subunit A 2 2
MIRT648058 TRMT10C tRNA methyltransferase 10C, mitochondrial RNase P subunit 2 2
MIRT649462 UBA5 ubiquitin like modifier activating enzyme 5 2 2
MIRT650009 KLB klotho beta 2 2
MIRT650567 YIPF4 Yip1 domain family member 4 2 2
MIRT652639 TIMM10 translocase of inner mitochondrial membrane 10 2 2
MIRT653887 SGK3 serum/glucocorticoid regulated kinase family member 3 2 2
MIRT655369 PCBD2 pterin-4 alpha-carbinolamine dehydratase 2 2 2
MIRT659116 DENND6A DENN domain containing 6A 2 2
MIRT659520 CHST3 carbohydrate sulfotransferase 3 2 2
MIRT659946 C8orf44-SGK3 C8orf44-SGK3 readthrough 2 2
MIRT661384 RHCG Rh family C glycoprotein 2 2
MIRT662910 MED18 mediator complex subunit 18 2 2
MIRT663107 NPR1 natriuretic peptide receptor 1 2 2
MIRT663759 ZNF285 zinc finger protein 285 2 2
MIRT664554 MKI67IP nucleolar protein interacting with the FHA domain of MKI67 1 1
MIRT664611 LIMD1 LIM domains containing 1 2 2
MIRT666193 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 2 2
MIRT666794 PSMD1 proteasome 26S subunit, non-ATPase 1 2 2
MIRT668752 DDX19B DEAD-box helicase 19B 2 2
MIRT669601 AGO3 argonaute 3, RISC catalytic component 2 2
MIRT669704 AAK1 AP2 associated kinase 1 2 2
MIRT669812 STOML1 stomatin like 1 2 2
MIRT669927 LRPAP1 LDL receptor related protein associated protein 1 2 2
MIRT669951 FBXL2 F-box and leucine rich repeat protein 2 2 2
MIRT670005 GPR156 G protein-coupled receptor 156 2 4
MIRT670051 RPP14 ribonuclease P/MRP subunit p14 2 2
MIRT670301 RBBP4 RB binding protein 4, chromatin remodeling factor 2 2
MIRT670390 EMP2 epithelial membrane protein 2 2 2
MIRT670457 RSBN1L round spermatid basic protein 1 like 2 2
MIRT670486 DCUN1D2 defective in cullin neddylation 1 domain containing 2 2 2
MIRT670568 GLTP glycolipid transfer protein 2 2
MIRT671061 KIF1B kinesin family member 1B 2 2
MIRT671085 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 2
MIRT671306 RABGAP1L RAB GTPase activating protein 1 like 2 2
MIRT671807 WISP3 WNT1 inducible signaling pathway protein 3 2 2
MIRT671956 SPPL3 signal peptide peptidase like 3 2 2
MIRT671993 OSTF1 osteoclast stimulating factor 1 2 2
MIRT672092 WDR5B WD repeat domain 5B 2 2
MIRT672273 SHE Src homology 2 domain containing E 2 2
MIRT672447 TTPAL alpha tocopherol transfer protein like 2 2
MIRT672451 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 2 2
MIRT673652 CYCS cytochrome c, somatic 2 2
MIRT674003 KCNN3 potassium calcium-activated channel subfamily N member 3 2 2
MIRT674054 ATXN3 ataxin 3 2 2
MIRT674248 NUP62 nucleoporin 62 2 2
MIRT674437 MIOX myo-inositol oxygenase 2 4
MIRT674476 BCL2L15 BCL2 like 15 2 2
MIRT675472 NUBPL nucleotide binding protein like 2 2
MIRT675667 IVD isovaleryl-CoA dehydrogenase 2 2
MIRT675978 FAM126B family with sequence similarity 126 member B 2 2
MIRT676064 HSPE1-MOB4 HSPE1-MOB4 readthrough 2 2
MIRT676120 SCIMP SLP adaptor and CSK interacting membrane protein 2 2
MIRT676241 PARP2 poly(ADP-ribose) polymerase 2 2 2
MIRT676257 PBOV1 prostate and breast cancer overexpressed 1 2 2
MIRT676388 SEC24D SEC24 homolog D, COPII coat complex component 2 2
MIRT676744 SGTB small glutamine rich tetratricopeptide repeat containing beta 2 2
MIRT676880 ENSA endosulfine alpha 2 2
MIRT676905 PHLDA3 pleckstrin homology like domain family A member 3 2 2
MIRT676922 KLHDC8A kelch domain containing 8A 2 2
MIRT676968 RNF19B ring finger protein 19B 2 2
MIRT677048 ZNF34 zinc finger protein 34 2 2
MIRT677114 SS18L1 SS18L1, nBAF chromatin remodeling complex subunit 2 2
MIRT677324 PIGO phosphatidylinositol glycan anchor biosynthesis class O 2 2
MIRT677466 PDLIM3 PDZ and LIM domain 3 2 2
MIRT677584 TRIM65 tripartite motif containing 65 2 2
MIRT677646 HAUS2 HAUS augmin like complex subunit 2 2 2
MIRT677736 MOB4 MOB family member 4, phocein 2 2
MIRT677813 MRPS10 mitochondrial ribosomal protein S10 2 2
MIRT677830 TSPYL1 TSPY like 1 2 2
MIRT678083 EIF2A eukaryotic translation initiation factor 2A 2 2
MIRT678158 ZNF724P zinc finger protein 724 2 2
MIRT678256 FXN frataxin 2 2
MIRT678326 FBLIM1 filamin binding LIM protein 1 2 2
MIRT678419 ANKRD36 ankyrin repeat domain 36 2 2
MIRT678588 C15orf40 chromosome 15 open reading frame 40 2 2
MIRT678598 ARPC2 actin related protein 2/3 complex subunit 2 2 2
MIRT678831 PDE6A phosphodiesterase 6A 2 2
MIRT678945 MYADM myeloid associated differentiation marker 2 2
MIRT679046 CHCHD5 coiled-coil-helix-coiled-coil-helix domain containing 5 2 2
MIRT679201 FLVCR1 feline leukemia virus subgroup C cellular receptor 1 2 2
MIRT679205 FAM9B family with sequence similarity 9 member B 2 2
MIRT679223 MAN2A2 mannosidase alpha class 2A member 2 2 2
MIRT679270 POLM DNA polymerase mu 2 2
MIRT679288 DEGS1 delta 4-desaturase, sphingolipid 1 2 2
MIRT679316 NPHP1 nephrocystin 1 2 2
MIRT679485 CYTIP cytohesin 1 interacting protein 2 2
MIRT679551 LIPG lipase G, endothelial type 2 2
MIRT679625 TTC31 tetratricopeptide repeat domain 31 2 2
MIRT679649 MMAB methylmalonic aciduria (cobalamin deficiency) cblB type 2 2
MIRT679761 TLR6 toll like receptor 6 2 2
MIRT680124 ZNF576 zinc finger protein 576 2 2
MIRT680186 ZNF554 zinc finger protein 554 2 2
MIRT684282 CDK9 cyclin dependent kinase 9 2 2
MIRT689671 RBM23 RNA binding motif protein 23 2 2
MIRT690031 CCDC90B coiled-coil domain containing 90B 2 2
MIRT691447 CXorf36 chromosome X open reading frame 36 2 2
MIRT691547 FLYWCH2 FLYWCH family member 2 2 2
MIRT691726 LARS leucyl-tRNA synthetase 2 2
MIRT692029 ARSK arylsulfatase family member K 2 2
MIRT692635 SUSD1 sushi domain containing 1 2 2
MIRT693823 BACE2 beta-site APP-cleaving enzyme 2 2 2
MIRT693864 IYD iodotyrosine deiodinase 2 2
MIRT693977 ZNF70 zinc finger protein 70 2 2
MIRT694145 CYP27C1 cytochrome P450 family 27 subfamily C member 1 2 2
MIRT695486 TRAT1 T-cell receptor associated transmembrane adaptor 1 2 2
MIRT695544 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 2 2
MIRT695599 TMEM199 transmembrane protein 199 2 2
MIRT696003 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 2
MIRT696020 TYRO3 TYRO3 protein tyrosine kinase 2 2
MIRT696039 KCNK6 potassium two pore domain channel subfamily K member 6 2 2
MIRT696310 NIP7 NIP7, nucleolar pre-rRNA processing protein 2 2
MIRT696400 CORO7 coronin 7 2 2
MIRT696595 ORMDL2 ORMDL sphingolipid biosynthesis regulator 2 2 2
MIRT698044 TRPM7 transient receptor potential cation channel subfamily M member 7 2 2
MIRT698139 TNRC6B trinucleotide repeat containing 6B 2 2
MIRT702561 KBTBD6 kelch repeat and BTB domain containing 6 2 2
MIRT703018 HEATR5A HEAT repeat containing 5A 2 2
MIRT705118 C4orf29 abhydrolase domain containing 18 2 2
MIRT706303 NT5C2 5'-nucleotidase, cytosolic II 2 2
MIRT706610 CYB5B cytochrome b5 type B 2 2
MIRT706729 RFK riboflavin kinase 2 2
MIRT707321 TMEM184B transmembrane protein 184B 2 2
MIRT708652 LYRM7 LYR motif containing 7 2 2
MIRT710520 NDUFV3 NADH:ubiquinone oxidoreductase subunit V3 2 2
MIRT714283 KIF1C kinesin family member 1C 2 2
MIRT720438 C19orf47 chromosome 19 open reading frame 47 2 2
MIRT720612 ZCCHC8 zinc finger CCHC-type containing 8 2 2
MIRT722756 SIRPB2 signal regulatory protein beta 2 2 2
MIRT723296 MOGAT1 monoacylglycerol O-acyltransferase 1 2 2
MIRT724380 NEK8 NIMA related kinase 8 2 2
MIRT725105 THRA thyroid hormone receptor, alpha 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-3663 Platinum-based doublet chemotherapy sensitive High Lung Adenocarcinoma tissue
hsa-mir-3663 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-3663 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-3663 Cisplatin 5460033 NSC119875 approved sensitive cell line (CIS)
hsa-mir-3663 Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-mir-3663 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-3663-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (HS578T)
hsa-miR-3663-5p Doxorubicin 31703 NSC123127 approved sensitive cell line (HS578T)
hsa-miR-3663-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)

Error report submission