pre-miRNA Information
pre-miRNA hsa-mir-4282   
Genomic Coordinates chr6: 72967687 - 72967753
Description Homo sapiens miR-4282 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4282
Sequence 40| UAAAAUUUGCAUCCAGGA |57
Evidence Experimental
Experiments SOLiD
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN32074657 13 COSMIC
COSN6331413 18 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1195771339 5 dbSNP
rs755058572 6 dbSNP
rs1245753664 11 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol POU5F1B   
Synonyms OCT4-PG1, OCT4PG1, OTF3C, OTF3P1, POU5F1P1, POU5F1P4, POU5FLC20, POU5FLC8
Description POU class 5 homeobox 1B
Transcript NM_001159542   
Expression
Putative miRNA Targets on POU5F1B
3'UTR of POU5F1B
(miRNA target sites are highlighted)
>POU5F1B|NM_001159542|3'UTR
   1 GGTGCCTGCCCTTCTAGGAATGGGGAACAGGGGAGGGGAGGAGCTAGGGAAAGAGAACCTGGAGTTTGTGGCAGGGCTTT
  81 TGGGATTAAGTTCTTCATTCACTAAGGAAGGAATTGGGAACACTAAGGGTGGGGGCAGGGGAGTTTGGGGCAACTGGTTG
 161 GAGGGAAGGTGAAGTTCAATGATGCTCTTGATTTTAATCCCACATCATGTATCACTTTTTTCTTAAATAAAGAAGCCTGG
 241 GACACAGTAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' aggaCCUACGUUUAAAAu 5'
              |||| :||:|| | 
Target 5' tttgGGAT-TAAGTTCTt 3'
79 - 95 105.00 -5.02
2
miRNA  3' aggacCUACG---UUUAAAAu 5'
               |||||    :||||| 
Target 5' tcaatGATGCTCTTGATTTTa 3'
176 - 196 105.00 -6.80
3
miRNA  3' aggACCUACG----UUUAAAau 5'
             |||: ||    :|:|||  
Target 5' gggTGGGGGCAGGGGAGTTTgg 3'
127 - 148 97.00 -9.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30138614 5 COSMIC
COSN30192590 7 COSMIC
COSN30190048 14 COSMIC
COSN30119654 27 COSMIC
COSN30512023 36 COSMIC
COSN30119655 57 COSMIC
COSN19657023 72 COSMIC
COSN24302619 91 COSMIC
COSN31606738 94 COSMIC
COSN26635477 144 COSMIC
COSN30167910 145 COSMIC
COSN25786736 195 COSMIC
COSN30128278 241 COSMIC
COSN8861223 250 COSMIC
COSN23013005 261 COSMIC
COSN8518341 262 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs780707684 5 dbSNP
rs745769186 6 dbSNP
rs756085416 9 dbSNP
rs1382272774 10 dbSNP
rs1319112017 12 dbSNP
rs1247034845 15 dbSNP
rs1317192950 21 dbSNP
rs779804055 22 dbSNP
rs920588496 22 dbSNP
rs373454446 26 dbSNP
rs749166599 27 dbSNP
rs187298898 29 dbSNP
rs755512421 29 dbSNP
rs774564179 30 dbSNP
rs371237720 32 dbSNP
rs772229313 38 dbSNP
rs1382963449 41 dbSNP
rs1242340775 42 dbSNP
rs1444822632 49 dbSNP
rs1182501314 54 dbSNP
rs1449532795 58 dbSNP
rs943769340 60 dbSNP
rs1489517123 63 dbSNP
rs9297754 72 dbSNP
rs1290361391 73 dbSNP
rs1211375726 76 dbSNP
rs1357602653 77 dbSNP
rs78695295 84 dbSNP
rs1229299430 86 dbSNP
rs1367433635 89 dbSNP
rs549402782 91 dbSNP
rs1184008109 95 dbSNP
rs1050662777 99 dbSNP
rs1411895323 104 dbSNP
rs1325982925 112 dbSNP
rs1403932825 115 dbSNP
rs1423522094 122 dbSNP
rs563132584 123 dbSNP
rs1162533647 124 dbSNP
rs9297755 125 dbSNP
rs1362544797 129 dbSNP
rs890437832 131 dbSNP
rs1421398146 132 dbSNP
rs1296291609 134 dbSNP
rs1165605903 135 dbSNP
rs78931371 136 dbSNP
rs182512875 138 dbSNP
rs1200791467 139 dbSNP
rs956794271 140 dbSNP
rs1268529530 142 dbSNP
rs1206139773 149 dbSNP
rs1344513286 166 dbSNP
rs1270996985 176 dbSNP
rs1304430154 178 dbSNP
rs534247326 180 dbSNP
rs1227388108 188 dbSNP
rs1277108162 192 dbSNP
rs547856508 200 dbSNP
rs1355251022 203 dbSNP
rs1345281698 207 dbSNP
rs1308956672 209 dbSNP
rs1237384351 210 dbSNP
rs1371982599 211 dbSNP
rs1285888778 217 dbSNP
rs1326331601 222 dbSNP
rs1443569707 223 dbSNP
rs188074125 224 dbSNP
rs1236104099 226 dbSNP
rs1483010887 227 dbSNP
rs1179530177 228 dbSNP
rs1174239054 229 dbSNP
rs943463276 229 dbSNP
rs1382198402 237 dbSNP
rs3179559 238 dbSNP
rs1437882921 244 dbSNP
rs1203987069 245 dbSNP
rs192359771 246 dbSNP
rs1407143549 247 dbSNP
rs199935435 248 dbSNP
rs1253583002 249 dbSNP
rs1323394437 249 dbSNP
rs1406146592 249 dbSNP
rs71303488 249 dbSNP
rs868125972 250 dbSNP
rs556160013 257 dbSNP
rs1172021598 258 dbSNP
rs1177884440 260 dbSNP
rs1473216454 261 dbSNP
rs200889381 261 dbSNP
rs71861974 261 dbSNP
rs1321136478 262 dbSNP
rs1461298145 262 dbSNP
rs368932899 262 dbSNP
rs969446054 264 dbSNP
rs1357239984 265 dbSNP
rs74548710 265 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 5462.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000465342.2 | 3UTR | AAAUUUUAUUUAUUUACUUAUUUAUUUUGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
280 hsa-miR-4282 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT057628 LCOR ligand dependent nuclear receptor corepressor 2 2
MIRT060732 RPS3 ribosomal protein S3 2 2
MIRT063371 ETNK1 ethanolamine kinase 1 2 2
MIRT066257 LRIG3 leucine rich repeats and immunoglobulin like domains 3 2 4
MIRT070774 HIF1A hypoxia inducible factor 1 alpha subunit 2 2
MIRT070871 EIF2S1 eukaryotic translation initiation factor 2 subunit alpha 2 4
MIRT078056 PCTP phosphatidylcholine transfer protein 2 2
MIRT078408 DCAF7 DDB1 and CUL4 associated factor 7 2 4
MIRT084059 PPP1R3D protein phosphatase 1 regulatory subunit 3D 2 2
MIRT093537 GALNT7 polypeptide N-acetylgalactosaminyltransferase 7 2 6
MIRT096072 SFXN1 sideroflexin 1 2 2
MIRT098316 REV3L REV3 like, DNA directed polymerase zeta catalytic subunit 2 2
MIRT100493 UHRF1BP1 UHRF1 binding protein 1 2 2
MIRT102254 HBP1 HMG-box transcription factor 1 2 4
MIRT105318 VPS37A VPS37A, ESCRT-I subunit 2 2
MIRT114143 MZT1 mitotic spindle organizing protein 1 2 4
MIRT114873 DICER1 dicer 1, ribonuclease III 2 2
MIRT134683 PNRC2 proline rich nuclear receptor coactivator 2 2 2
MIRT137640 RCOR1 REST corepressor 1 2 2
MIRT155449 CCNT2 cyclin T2 2 4
MIRT165656 DCTN4 dynactin subunit 4 2 2
MIRT177570 CSTF2T cleavage stimulation factor subunit 2 tau variant 2 4
MIRT188514 E2F7 E2F transcription factor 7 2 10
MIRT193019 TMOD3 tropomodulin 3 2 4
MIRT195823 GADD45A growth arrest and DNA damage inducible alpha 2 2
MIRT195885 DEPDC1 DEP domain containing 1 2 6
MIRT206029 NUP50 nucleoporin 50 2 6
MIRT212148 CLCN3 chloride voltage-gated channel 3 2 2
MIRT213999 DCP2 decapping mRNA 2 2 2
MIRT214650 HNRNPA0 heterogeneous nuclear ribonucleoprotein A0 2 2
MIRT221568 CBX3 chromobox 3 2 2
MIRT224544 ZNF623 zinc finger protein 623 2 2
MIRT227654 SET SET nuclear proto-oncogene 2 2
MIRT229992 CHIC1 cysteine rich hydrophobic domain 1 2 2
MIRT238968 QKI QKI, KH domain containing RNA binding 2 2
MIRT239825 ACTB actin beta 2 2
MIRT241084 ZXDA zinc finger, X-linked, duplicated A 2 4
MIRT244852 ZBTB5 zinc finger and BTB domain containing 5 2 2
MIRT264534 TARDBP TAR DNA binding protein 2 2
MIRT271438 SKI SKI proto-oncogene 2 2
MIRT271597 ENAH ENAH, actin regulator 2 2
MIRT294332 ZNF264 zinc finger protein 264 2 2
MIRT296341 PARD6B par-6 family cell polarity regulator beta 2 2
MIRT301715 TEF TEF, PAR bZIP transcription factor 2 2
MIRT308549 ZNF654 zinc finger protein 654 2 2
MIRT313866 DEPDC1B DEP domain containing 1B 2 2
MIRT315529 MARCKS myristoylated alanine rich protein kinase C substrate 2 2
MIRT321066 RABGEF1 RAB guanine nucleotide exchange factor 1 2 2
MIRT343777 NUTF2 nuclear transport factor 2 2 2
MIRT359109 MAP1B microtubule associated protein 1B 2 2
MIRT397393 GOLGA3 golgin A3 2 4
MIRT400822 CPEB2 cytoplasmic polyadenylation element binding protein 2 2 2
MIRT442171 DSEL dermatan sulfate epimerase-like 2 2
MIRT442777 JAG1 jagged 1 2 2
MIRT442862 SCARF1 scavenger receptor class F member 1 2 4
MIRT442919 PCBD2 pterin-4 alpha-carbinolamine dehydratase 2 2 2
MIRT444567 TRA2B transformer 2 beta homolog 2 2
MIRT444718 CMSS1 cms1 ribosomal small subunit homolog (yeast) 2 2
MIRT445018 RBMS3 RNA binding motif single stranded interacting protein 3 2 2
MIRT445853 LRRC1 leucine rich repeat containing 1 2 2
MIRT446242 HELZ helicase with zinc finger 2 2
MIRT446542 GOLGA8B golgin A8 family member B 2 2
MIRT446643 SPTY2D1 SPT2 chromatin protein domain containing 1 2 2
MIRT446948 ZMAT3 zinc finger matrin-type 3 2 4
MIRT447061 KCNAB1 potassium voltage-gated channel subfamily A member regulatory beta subunit 1 2 2
MIRT447327 ZSCAN21 zinc finger and SCAN domain containing 21 2 2
MIRT447995 CDX1 caudal type homeobox 1 2 2
MIRT448543 RHEBP1 RHEB pseudogene 1 2 6
MIRT448752 HINT1 histidine triad nucleotide binding protein 1 2 2
MIRT448772 GOLGA8A golgin A8 family member A 2 2
MIRT449342 WDR26 WD repeat domain 26 2 2
MIRT450011 SLC16A6 solute carrier family 16 member 6 2 4
MIRT450229 PCNX pecanex homolog 1 2 2
MIRT450340 MRPL17 mitochondrial ribosomal protein L17 2 4
MIRT450381 MSI2 musashi RNA binding protein 2 2 2
MIRT450759 PGGT1B protein geranylgeranyltransferase type I subunit beta 2 2
MIRT450809 NRCAM neuronal cell adhesion molecule 2 2
MIRT450947 ATAD2 ATPase family, AAA domain containing 2 2 2
MIRT459095 CCPG1 cell cycle progression 1 2 2
MIRT462428 TWISTNB TWIST neighbor 2 2
MIRT465200 TROVE2 TROVE domain family member 2 2 4
MIRT467382 SON SON DNA binding protein 2 4
MIRT468546 SERP1 stress associated endoplasmic reticulum protein 1 2 2
MIRT471506 PDE4D phosphodiesterase 4D 2 2
MIRT471981 NR3C1 nuclear receptor subfamily 3 group C member 1 2 2
MIRT474478 KLHL11 kelch like family member 11 2 8
MIRT475011 KANSL1 KAT8 regulatory NSL complex subunit 1 2 8
MIRT480341 C5orf51 chromosome 5 open reading frame 51 2 2
MIRT482696 TEX9 testis expressed 9 2 6
MIRT483462 YTHDF1 YTH N6-methyladenosine RNA binding protein 1 2 6
MIRT485623 FAM217B family with sequence similarity 217 member B 2 2
MIRT485714 CASP16 caspase 16, pseudogene 2 8
MIRT486279 SEC23A Sec23 homolog A, coat complex II component 2 2
MIRT491000 PEBP1 phosphatidylethanolamine binding protein 1 2 4
MIRT492594 PPIL4 peptidylprolyl isomerase like 4 2 2
MIRT493365 KIF5B kinesin family member 5B 2 2
MIRT494316 CDKN1B cyclin dependent kinase inhibitor 1B 2 2
MIRT495208 EDN3 endothelin 3 2 2
MIRT497011 TCF15 transcription factor 15 2 2
MIRT498512 FRK fyn related Src family tyrosine kinase 2 2
MIRT498778 PARP15 poly(ADP-ribose) polymerase family member 15 2 2
MIRT501045 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 2 6
MIRT502939 CDC37L1 cell division cycle 37 like 1 2 8
MIRT504806 VHL von Hippel-Lindau tumor suppressor 2 6
MIRT505656 SHMT1 serine hydroxymethyltransferase 1 2 6
MIRT505964 RAB5C RAB5C, member RAS oncogene family 2 6
MIRT506322 OTUD4 OTU deubiquitinase 4 2 4
MIRT506803 KLHL15 kelch like family member 15 2 6
MIRT506917 KBTBD8 kelch repeat and BTB domain containing 8 2 4
MIRT507400 EMC7 ER membrane protein complex subunit 7 2 8
MIRT507471 EDEM3 ER degradation enhancing alpha-mannosidase like protein 3 2 6
MIRT508058 ATP13A3 ATPase 13A3 2 4
MIRT508135 AMD1 adenosylmethionine decarboxylase 1 2 2
MIRT509895 RPS23 ribosomal protein S23 2 4
MIRT510881 RAN RAN, member RAS oncogene family 2 8
MIRT513766 PEX5L peroxisomal biogenesis factor 5 like 2 4
MIRT516898 COPS8 COP9 signalosome subunit 8 2 2
MIRT518703 TIMD4 T-cell immunoglobulin and mucin domain containing 4 2 4
MIRT520429 TTPAL alpha tocopherol transfer protein like 2 6
MIRT521843 PNISR PNN interacting serine and arginine rich protein 2 4
MIRT522116 NUDT3 nudix hydrolase 3 2 4
MIRT525467 TMPRSS12 transmembrane protease, serine 12 2 2
MIRT525583 MTRNR2L7 MT-RNR2-like 7 2 2
MIRT525906 BUB1 BUB1 mitotic checkpoint serine/threonine kinase 2 2
MIRT526072 C11orf54 chromosome 11 open reading frame 54 2 2
MIRT526232 MTRNR2L5 MT-RNR2-like 5 2 4
MIRT526455 FAM71F2 family with sequence similarity 71 member F2 2 4
MIRT526515 POU5F1B POU class 5 homeobox 1B 2 2
MIRT528032 FEZ2 fasciculation and elongation protein zeta 2 2 2
MIRT528422 MRPS16 mitochondrial ribosomal protein S16 2 2
MIRT528995 ISLR2 immunoglobulin superfamily containing leucine rich repeat 2 2 4
MIRT529311 ATRNL1 attractin like 1 2 2
MIRT529376 SKP1 S-phase kinase associated protein 1 2 4
MIRT530015 SRRM1 serine and arginine repetitive matrix 1 2 2
MIRT530089 FMN2 formin 2 2 2
MIRT530942 ENPP6 ectonucleotide pyrophosphatase/phosphodiesterase 6 2 2
MIRT531229 HIST1H2BD histone cluster 1 H2B family member d 2 2
MIRT533088 YTHDF3 YTH N6-methyladenosine RNA binding protein 3 2 2
MIRT533299 USP46 ubiquitin specific peptidase 46 2 2
MIRT533318 UNKL unkempt family like zinc finger 2 2
MIRT533721 TMEM30A transmembrane protein 30A 2 2
MIRT534096 AZF1 azoospermia factor 1 2 2
MIRT534188 SLC7A11 solute carrier family 7 member 11 2 2
MIRT534493 SAR1B secretion associated Ras related GTPase 1B 2 2
MIRT536077 MBOAT2 membrane bound O-acyltransferase domain containing 2 2 2
MIRT536242 LRIG2 leucine rich repeats and immunoglobulin like domains 2 2 2
MIRT537524 FAM104A family with sequence similarity 104 member A 2 2
MIRT538088 DGKH diacylglycerol kinase eta 2 2
MIRT538475 CNBP CCHC-type zinc finger nucleic acid binding protein 2 2
MIRT538853 BTG1 BTG anti-proliferation factor 1 2 4
MIRT539075 GDNF glial cell derived neurotrophic factor 2 2
MIRT539480 ACVR2B activin A receptor type 2B 2 4
MIRT540210 ARHGAP18 Rho GTPase activating protein 18 2 2
MIRT541940 TSPAN2 tetraspanin 2 2 2
MIRT543812 COCH cochlin 2 2
MIRT545120 PDZRN4 PDZ domain containing ring finger 4 2 2
MIRT545571 GIMAP4 GTPase, IMAP family member 4 2 2
MIRT545989 XKR4 XK related 4 2 2
MIRT547213 PANK3 pantothenate kinase 3 2 4
MIRT547740 KIAA1468 KIAA1468 2 2
MIRT548022 GRB2 growth factor receptor bound protein 2 2 4
MIRT548032 GOLIM4 golgi integral membrane protein 4 2 2
MIRT548102 GFPT1 glutamine--fructose-6-phosphate transaminase 1 2 4
MIRT548217 FKBP1A FK506 binding protein 1A 2 2
MIRT548588 DDX3X DEAD-box helicase 3, X-linked 2 4
MIRT548953 CDC27 cell division cycle 27 2 2
MIRT549072 CACUL1 CDK2 associated cullin domain 1 2 2
MIRT550368 INCENP inner centromere protein 2 6
MIRT550546 MYZAP myocardial zonula adherens protein 2 2
MIRT551491 TMEM192 transmembrane protein 192 2 4
MIRT553078 UEVLD UEV and lactate/malate dehyrogenase domains 2 2
MIRT554104 SMU1 DNA replication regulator and spliceosomal factor 2 2
MIRT555127 PTPRG protein tyrosine phosphatase, receptor type G 2 2
MIRT555477 POC1B-GALNT4 POC1B-GALNT4 readthrough 2 2
MIRT555978 NPTN neuroplastin 2 2
MIRT557011 HPRT1 hypoxanthine phosphoribosyltransferase 1 2 2
MIRT557706 GALNT4 polypeptide N-acetylgalactosaminyltransferase 4 2 2
MIRT558333 DNAJC28 DnaJ heat shock protein family (Hsp40) member C28 2 4
MIRT558488 DBN1 drebrin 1 2 2
MIRT559942 ZNF567 zinc finger protein 567 2 2
MIRT561127 ATP2B1 ATPase plasma membrane Ca2+ transporting 1 2 2
MIRT561791 PAWR pro-apoptotic WT1 regulator 2 2
MIRT562438 EEF2 eukaryotic translation elongation factor 2 2 2
MIRT563102 PABPC4L poly(A) binding protein cytoplasmic 4 like 2 2
MIRT563212 ZNF813 zinc finger protein 813 2 2
MIRT563426 KIF3A kinesin family member 3A 2 2
MIRT563473 SPIN4 spindlin family member 4 2 2
MIRT564015 HSPA4 heat shock protein family A (Hsp70) member 4 2 4
MIRT564117 ZYG11B zyg-11 family member B, cell cycle regulator 2 2
MIRT564223 SDE2 SDE2 telomere maintenance homolog 2 2
MIRT564503 CACNG1 calcium voltage-gated channel auxiliary subunit gamma 1 2 2
MIRT564515 DUSP3 dual specificity phosphatase 3 2 2
MIRT564811 ZBTB21 zinc finger and BTB domain containing 21 2 2
MIRT565265 TPD52 tumor protein D52 2 2
MIRT566012 RHOB ras homolog family member B 2 2
MIRT566216 PTMA prothymosin, alpha 2 2
MIRT566638 NFYA nuclear transcription factor Y subunit alpha 2 2
MIRT566821 MAPK8 mitogen-activated protein kinase 8 2 2
MIRT566948 LEPROT leptin receptor overlapping transcript 2 2
MIRT567290 HNRNPAB heterogeneous nuclear ribonucleoprotein A/B 2 2
MIRT567895 CSTF2 cleavage stimulation factor subunit 2 2 2
MIRT568731 MTRNR2L3 MT-RNR2-like 3 2 2
MIRT571263 ZNF239 zinc finger protein 239 2 2
MIRT572593 EIF2AK4 eukaryotic translation initiation factor 2 alpha kinase 4 2 2
MIRT573827 TGOLN2 trans-golgi network protein 2 2 2
MIRT576391 Fhl2 four and a half LIM domains 2 2 2
MIRT609901 SMS spermine synthase 2 2
MIRT613710 ELMSAN1 ELM2 and Myb/SANT domain containing 1 2 2
MIRT614406 ADAT1 adenosine deaminase, tRNA specific 1 2 2
MIRT615042 DCX doublecortin 2 2
MIRT617514 C5orf45 MRN complex interacting protein 2 2
MIRT619476 PRDM10 PR/SET domain 10 2 2
MIRT620349 TLN1 talin 1 2 2
MIRT620910 PLA2G7 phospholipase A2 group VII 2 2
MIRT622131 SP4 Sp4 transcription factor 2 2
MIRT622955 OTUD7B OTU deubiquitinase 7B 2 2
MIRT623351 MAGI3 membrane associated guanylate kinase, WW and PDZ domain containing 3 2 2
MIRT623619 INTU inturned planar cell polarity protein 2 2
MIRT624409 CCDC171 coiled-coil domain containing 171 2 2
MIRT625171 CCS copper chaperone for superoxide dismutase 2 2
MIRT625685 RPP40 ribonuclease P/MRP subunit p40 2 2
MIRT625875 ALDH18A1 aldehyde dehydrogenase 18 family member A1 2 2
MIRT626002 FAM107A family with sequence similarity 107 member A 2 2
MIRT626872 HRH4 histamine receptor H4 2 4
MIRT628220 FKBP9 FK506 binding protein 9 2 2
MIRT628265 DIO2 iodothyronine deiodinase 2 2 2
MIRT628402 C8orf37 chromosome 8 open reading frame 37 2 2
MIRT630564 C3orf36 chromosome 3 open reading frame 36 2 4
MIRT631577 RASSF9 Ras association domain family member 9 2 2
MIRT635730 CCDC58 coiled-coil domain containing 58 2 2
MIRT636224 SLC8A1 solute carrier family 8 member A1 2 2
MIRT636613 CLIC5 chloride intracellular channel 5 2 2
MIRT638899 CDK9 cyclin dependent kinase 9 2 2
MIRT640167 ATXN7L1 ataxin 7 like 1 2 2
MIRT642070 GTDC1 glycosyltransferase like domain containing 1 2 2
MIRT643034 CHCHD7 coiled-coil-helix-coiled-coil-helix domain containing 7 2 2
MIRT644572 SPOP speckle type BTB/POZ protein 2 2
MIRT644954 IFNB1 interferon beta 1 2 2
MIRT645948 TTF2 transcription termination factor 2 2 2
MIRT646440 XRCC2 X-ray repair cross complementing 2 2 2
MIRT647896 EPN2 epsin 2 2 2
MIRT648276 ZNF582 zinc finger protein 582 2 2
MIRT649381 NEDD1 neural precursor cell expressed, developmentally down-regulated 1 2 2
MIRT650254 CD68 CD68 molecule 2 2
MIRT650333 ATP5S ATP synthase, H+ transporting, mitochondrial Fo complex subunit s (factor B) 2 2
MIRT651707 VMP1 vacuole membrane protein 1 2 2
MIRT651774 VASP vasodilator stimulated phosphoprotein 2 2
MIRT653144 SRPK2 SRSF protein kinase 2 2 2
MIRT654112 RPS6KA5 ribosomal protein S6 kinase A5 2 2
MIRT654161 RORB RAR related orphan receptor B 2 2
MIRT655716 MLF2 myeloid leukemia factor 2 2 2
MIRT657476 HDAC4 histone deacetylase 4 2 2
MIRT658095 FOXO1 forkhead box O1 2 2
MIRT658860 DTX3L deltex E3 ubiquitin ligase 3L 2 2
MIRT658988 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 2 2
MIRT660767 ALDH6A1 aldehyde dehydrogenase 6 family member A1 2 2
MIRT661622 C2orf15 chromosome 2 open reading frame 15 2 2
MIRT661694 TFDP2 transcription factor Dp-2 2 2
MIRT662208 PLA2G4E phospholipase A2 group IVE 2 2
MIRT662443 RALGAPA1 Ral GTPase activating protein catalytic alpha subunit 1 2 2
MIRT664422 ADH5 alcohol dehydrogenase 5 (class III), chi polypeptide 2 2
MIRT687505 NECAB1 N-terminal EF-hand calcium binding protein 1 2 2
MIRT689910 SOD2 superoxide dismutase 2 2 2
MIRT690781 PLA2G2C phospholipase A2 group IIC 2 2
MIRT698488 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 2 2
MIRT699685 SFMBT2 Scm like with four mbt domains 2 2 2
MIRT700926 PDS5A PDS5 cohesin associated factor A 2 2
MIRT702258 LMNB1 lamin B1 2 2
MIRT703166 GPR137C G protein-coupled receptor 137C 2 2
MIRT703242 GNS glucosamine (N-acetyl)-6-sulfatase 2 2
MIRT704737 CENPQ centromere protein Q 2 2
MIRT707310 GLRX2 glutaredoxin 2 2 2
MIRT710021 KCNQ5 potassium voltage-gated channel subfamily Q member 5 2 2
MIRT712212 SCOC short coiled-coil protein 2 2
MIRT714742 SETBP1 SET binding protein 1 2 2
MIRT718268 ZNF749 zinc finger protein 749 2 2
MIRT720553 DYRK4 dual specificity tyrosine phosphorylation regulated kinase 4 2 2
MIRT722248 RBM41 RNA binding motif protein 41 2 2
MIRT723767 MPLKIP M-phase specific PLK1 interacting protein 2 2
MIRT723977 KIAA0146 scaffolding protein involved in DNA repair 1 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4282 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-4282 Neoadjuvant chemotherapy sensitive tissue (breast cancer)
hsa-miR-4282 Neoadjuvant chemotherapy sensitive tissue (breast cancer)

Error report submission